ID: 1126728338

View in Genome Browser
Species Human (GRCh38)
Location 15:51655600-51655622
Sequence GCCGCTGACTTCCATCCCTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 440
Summary {0: 22, 1: 88, 2: 109, 3: 75, 4: 146}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126728338_1126728343 6 Left 1126728338 15:51655600-51655622 CCGGAGGGATGGAAGTCAGCGGC 0: 22
1: 88
2: 109
3: 75
4: 146
Right 1126728343 15:51655629-51655651 GTGGCGGCGGCAAACAGCAATGG No data
1126728338_1126728341 -10 Left 1126728338 15:51655600-51655622 CCGGAGGGATGGAAGTCAGCGGC 0: 22
1: 88
2: 109
3: 75
4: 146
Right 1126728341 15:51655613-51655635 AGTCAGCGGCAGGTCTGTGGCGG No data
1126728338_1126728342 -7 Left 1126728338 15:51655600-51655622 CCGGAGGGATGGAAGTCAGCGGC 0: 22
1: 88
2: 109
3: 75
4: 146
Right 1126728342 15:51655616-51655638 CAGCGGCAGGTCTGTGGCGGCGG No data
1126728338_1126728344 9 Left 1126728338 15:51655600-51655622 CCGGAGGGATGGAAGTCAGCGGC 0: 22
1: 88
2: 109
3: 75
4: 146
Right 1126728344 15:51655632-51655654 GCGGCGGCAAACAGCAATGGTGG No data
1126728338_1126728345 13 Left 1126728338 15:51655600-51655622 CCGGAGGGATGGAAGTCAGCGGC 0: 22
1: 88
2: 109
3: 75
4: 146
Right 1126728345 15:51655636-51655658 CGGCAAACAGCAATGGTGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126728338 Original CRISPR GCCGCTGACTTCCATCCCTC CGG (reversed) Intergenic
900594306 1:3473513-3473535 GCCGTGGACTTACATCCATCAGG - Exonic
901258764 1:7855947-7855969 GCCTCAGCCTTCCAACCCTCTGG + Intergenic
902550434 1:17216011-17216033 GCCCCTCACTTCCTTCTCTCAGG - Intronic
904397180 1:30229827-30229849 ACTGCTGACTTCCACCCCTCCGG + Intergenic
905268588 1:36771796-36771818 GCCTCTGGCTGCCAGCCCTCAGG + Intergenic
906507525 1:46391149-46391171 GCCGCCGACTTCCATCCCTCTGG - Intergenic
906591030 1:47024075-47024097 GCAGCTTTCTTCCATCCCTGGGG + Intronic
907602961 1:55788510-55788532 ACTGTTGACTTCCACCCCTCTGG - Intergenic
908723222 1:67148192-67148214 ACCACTGACTTCCACCCCTCTGG - Intronic
908892685 1:68863881-68863903 GCCACTGACTTCCACCCCTCTGG + Intergenic
909859905 1:80592508-80592530 ATTGCTGACTTCCATCCCTCCGG - Intergenic
910116676 1:83739174-83739196 GTCACTGACTTCCATCCCTCTGG - Intergenic
911657763 1:100464166-100464188 GCTGCTCATTTCCATCTCTCTGG - Intronic
912285715 1:108366256-108366278 ACCGCTGACTTCCATCCCTCCGG - Intergenic
912463400 1:109852560-109852582 GCCACTGACTTCCGCCCCTCTGG - Intergenic
913470778 1:119183094-119183116 GCAGCTGACTTCCAACCCTCTGG - Intergenic
914747798 1:150512322-150512344 GCTTCTGACTTCCCTCTCTCTGG + Intronic
917097528 1:171414039-171414061 CCCGTTGACTTCCACCCCTTGGG - Intergenic
917403529 1:174678895-174678917 ACTGCTGACTTCCATCCCTCCGG - Intronic
917413369 1:174783104-174783126 ACCGTTGACTTCCAGCCCTCTGG + Intronic
917506997 1:175636460-175636482 GCCCCTGACATCCATGCCCCAGG + Intronic
917724029 1:177812799-177812821 GCGGCTGACTTCCACCCCTCCGG + Intergenic
920639848 1:207741482-207741504 ACCGCTGACTTCCATTCCTCCGG - Intergenic
921406775 1:214788944-214788966 GCCTCTCTCTTCCAGCCCTCTGG - Intergenic
922683927 1:227624841-227624863 ACTGCTGACTTCCATCCCTCTGG - Intronic
922685155 1:227633126-227633148 ACCAATGACTTCCACCCCTCCGG - Intronic
922877773 1:228953926-228953948 GCCACTAACTTCCATCCCTCTGG + Intergenic
1065199855 10:23301976-23301998 ACCGCTGACTTCCATCCCTCTGG - Intronic
1066246833 10:33591928-33591950 GCCACTGACTTCCATCCCTCTGG - Intergenic
1066673012 10:37859421-37859443 GCCGCTGACTTCCATCCCTCCGG - Intergenic
1068030324 10:51698194-51698216 GCCCCTTGCTTCCATCCCTCTGG + Exonic
1068191617 10:53659788-53659810 GCCACTGACTTCCATCCCTCCGG + Intergenic
1068791292 10:61034016-61034038 GCCACTGACTTCCACCCCTCCGG - Intergenic
1068792067 10:61039481-61039503 GCCACTGACTTCCACCCCTCCGG - Intergenic
1068988844 10:63130979-63131001 GCCGCTGACTTCCACCCCTCTGG - Intergenic
1069037961 10:63664964-63664986 GCCACTGACTTCCACCCCTCTGG - Intergenic
1069051784 10:63802959-63802981 GCTGCTGACTTCCTGCCCTGGGG + Intergenic
1071051878 10:81460197-81460219 GCCACTGACTTCCATCCCTCTGG + Intergenic
1071082700 10:81831276-81831298 GCCGCTGACTTCCGCCCCTCTGG - Intergenic
1071326722 10:84525698-84525720 GCCGCTGACTTCCACCCCTCCGG - Intergenic
1071327411 10:84530638-84530660 GCCGCTGACTTCCACCCCTCTGG - Intergenic
1071556999 10:86612117-86612139 GACGCTGACTTCCATCCCTCCGG + Intergenic
1072315592 10:94199757-94199779 CCTGCTGACTTCCATCCCACAGG - Intronic
1072472432 10:95724693-95724715 ATCACTGACTTCCACCCCTCTGG - Intronic
1072633891 10:97165062-97165084 GCAGCTGACATCCAACCCACTGG + Intronic
1072650316 10:97290273-97290295 GCTGCTGACTCCCATCCCTCCGG + Intronic
1074978461 10:118599853-118599875 GCCTCTGACTTCCACCCCTCTGG - Intergenic
1078437856 11:11340238-11340260 GCCACTGTCCTCTATCCCTCTGG - Intronic
1079601740 11:22317905-22317927 GCCACTGACTTCCATCCCTCCGG - Intergenic
1079607412 11:22387375-22387397 GTCCCTGACTTCCATAACTCTGG + Intergenic
1079678723 11:23265113-23265135 GCTGCTGACTTCCACCCCTCTGG - Intergenic
1079761855 11:24338963-24338985 GCCGCTGACTTCCACACCTCTGG + Intergenic
1079884281 11:25966525-25966547 GCCACTGACTTCCATCCCTCAGG - Intergenic
1079933252 11:26590779-26590801 GCCACTGACTTCCACCCCTCCGG - Intronic
1080699149 11:34629693-34629715 GAGCCTGAATTCCATCCCTCAGG - Intronic
1081063037 11:38504032-38504054 GCCGCTGACTTCCACCCCTCTGG + Intergenic
1081069734 11:38595829-38595851 GCTGCTGACTTCCATCCCTCTGG - Intergenic
1081070181 11:38602008-38602030 GCCATTGACTTCCACCCCTTTGG + Intergenic
1083107005 11:60368076-60368098 ACCGCTGACTTCTACCCCTCCGG + Intronic
1083314862 11:61808438-61808460 GCTGCTTGGTTCCATCCCTCTGG + Intronic
1083488991 11:63001007-63001029 GCCCCTGACCTGCATCCCTCAGG + Intronic
1084192570 11:67505490-67505512 GCCCCTGCCTTCCTTCCCCCGGG + Intronic
1084298179 11:68226570-68226592 GCCCCTGACTCCCAACCCTTTGG - Intergenic
1084696432 11:70758375-70758397 GCCGTTGACTTCCACCCCTCCGG + Intronic
1084929008 11:72538857-72538879 GCTGCCCACTTCCATCCTTCTGG - Intergenic
1085264633 11:75229937-75229959 GCAGATGACTCCCATCCCACGGG - Intergenic
1085529094 11:77181222-77181244 GCCTCTGACTTCCCCACCTCTGG - Intronic
1085601987 11:77863306-77863328 GCTGCTGACTTCCATCCCTCCGG - Intronic
1085621572 11:78041721-78041743 GCCACTGACTCCCATCCCTCCGG + Intronic
1088110099 11:106251171-106251193 ACCACTGACGTCTATCCCTCTGG + Intergenic
1088242929 11:107789665-107789687 ACCATTGACTTCCACCCCTCCGG + Intergenic
1088484620 11:110328710-110328732 GCCACTGACTTCCACCACTCTGG - Intergenic
1088879805 11:113964522-113964544 GCCGCTGACTTCCATCCTTCTGG + Intergenic
1090738726 11:129636848-129636870 GCCCCTCGCTACCATCCCTCTGG - Intergenic
1092293646 12:7181302-7181324 GCTGCTGACTTCCACCCCTCCGG + Intergenic
1093106659 12:15095425-15095447 GCCACTGACTTCCATCCCTCTGG - Intergenic
1095552476 12:43459202-43459224 GCTGCTGACTTCCATCCCTCCGG + Intronic
1096351232 12:50902825-50902847 GCCACTGACTTCCATTCCTCTGG - Intergenic
1096352547 12:50912196-50912218 ACTGCTGACTTCCATCCCTCTGG - Intergenic
1097289011 12:57898207-57898229 TCCTCTGACTTCCAGCCCACTGG - Intergenic
1097840849 12:64319994-64320016 GCCACTGACTTCCATCCCTCCGG + Intronic
1098984876 12:77001484-77001506 GCCGCTGACTTCCACCCCTCCGG + Intergenic
1099292619 12:80790109-80790131 GCCACTGACTTCCATCCCTCTGG + Intergenic
1099605037 12:84794127-84794149 GTAACTGACTTCCACCCCTCCGG + Intergenic
1099798628 12:87429612-87429634 GCCACTGACTTCCACCCCTCTGG - Intergenic
1100205062 12:92339671-92339693 ACTGCTGACTTCCATGCCTCTGG - Intergenic
1102197477 12:111035091-111035113 GCAGGTGACTCCCAGCCCTCGGG + Intronic
1103592399 12:122001556-122001578 GGCTCGGATTTCCATCCCTCGGG - Exonic
1103699232 12:122840121-122840143 GCCGCTGACTTCCCGACCCCTGG + Intronic
1103802559 12:123548829-123548851 GTCACTGACTTCCACCCCTCCGG + Intergenic
1103804000 12:123558414-123558436 GCCGCTGACTTCTAGCCGTCCGG + Intergenic
1103872338 12:124100806-124100828 GCCACTAACTTCCACCCCTCCGG - Intronic
1103873176 12:124105981-124106003 AGCCCTGACTTCCACCCCTCCGG - Intronic
1103918370 12:124387515-124387537 GCCCCAGACTTCCTGCCCTCCGG + Intronic
1104850964 12:131873528-131873550 GCCGCTGACTTCCACCCCTCTGG - Intergenic
1105284293 13:18992240-18992262 GCCTCTGTCTTCTGTCCCTCTGG - Intergenic
1107156424 13:37172371-37172393 GCTGCTGACTTCCATCCCTCCGG - Intergenic
1107700914 13:43046813-43046835 GCCGCTGACTTACACCCCTCTGG + Intronic
1109292828 13:60497131-60497153 GCCGTTGACTTCCACCCTTCCGG - Intronic
1109520628 13:63505550-63505572 GCCTCTGACTTCCATCCCTCTGG - Intergenic
1109680713 13:65748436-65748458 GCCGCTGACTTCCATCCCTCCGG - Intergenic
1109931300 13:69222047-69222069 GCTGCTGACTCCCATCCCTCCGG + Intergenic
1110846146 13:80192464-80192486 ACCGCTGACTTCCATCCCTCCGG + Intergenic
1111021445 13:82457717-82457739 ACCACTGACTCCCATCCCTCCGG + Intergenic
1111100906 13:83584914-83584936 CCAGTTGACTTCCATCCCTCAGG - Intergenic
1111536793 13:89612085-89612107 ACTGCTAACTTCCATCCCTCTGG - Intergenic
1111657264 13:91169376-91169398 GCCACTGACTTCTGTCTCTCAGG - Intergenic
1111820401 13:93206928-93206950 ACTGCTGACTTCCATCCCTCCGG + Intergenic
1111910270 13:94303040-94303062 ACTGCTGACTCCCACCCCTCCGG - Intronic
1112732899 13:102386646-102386668 GACCCTGACTTCCTTTCCTCAGG + Intronic
1113494567 13:110716114-110716136 GCCCCTGCCTTCCTTCCGTCCGG - Intronic
1113592273 13:111509334-111509356 GCCTCTAACTTCCATCCCTCTGG - Intergenic
1115757573 14:36544485-36544507 GCCGCTGACTTCTATCCCTCCGG - Intergenic
1116118803 14:40694720-40694742 GCCGCTGACTCCCATCCCTCCGG - Intergenic
1116862555 14:50006286-50006308 AACACTGACTTCCATGCCTCTGG + Exonic
1117171813 14:53108160-53108182 GCCGCTGACTTCCATCCCTCCGG + Intronic
1118453514 14:65925221-65925243 GCCGCTGACTCCCAACCCTCCGG - Intergenic
1119668215 14:76499490-76499512 CCCGCTGAGTTCCCTCCCTTTGG - Intronic
1120097381 14:80403895-80403917 TCCACTGACTTCCATCCCTCTGG + Intergenic
1120107982 14:80517942-80517964 GCCACTGACTTCCACCCCTCTGG - Intronic
1120397387 14:83985616-83985638 ACCGCTGACTTCCATCCCTCTGG + Intergenic
1120857341 14:89223722-89223744 CCCCCTGACTTCCACACCTCAGG - Intronic
1121639337 14:95474926-95474948 GCAGTTGACTTCCACACCTCTGG - Intronic
1122353980 14:101112571-101112593 GCCGCAGCCTGCCATCCCTGCGG - Intergenic
1122610168 14:102976950-102976972 GCTGCTGTCTTCCAGCCCACAGG - Intronic
1122671011 14:103372077-103372099 GCCACTGTCTTCCATTCCTCAGG - Intergenic
1123125464 14:105942901-105942923 ACCGCTGGCTTCCATCCCTCCGG + Intergenic
1123987296 15:25657065-25657087 TCCATTGACTTCCACCCCTCCGG + Intergenic
1126728338 15:51655600-51655622 GCCGCTGACTTCCATCCCTCCGG - Intergenic
1127074514 15:55312201-55312223 GCCGCTGACTTCCATCCCTCCGG - Intronic
1128363107 15:66976448-66976470 ACCACTGACTTCCACCCCTCCGG - Intergenic
1129076718 15:73003176-73003198 GCCTCTCTCTTCAATCCCTCAGG - Intergenic
1129503309 15:76060146-76060168 GCCGCTGACCTTCATCCCCCTGG + Intronic
1129776373 15:78239293-78239315 GCTGCTGACTGCCATCCGTCTGG - Intronic
1130825967 15:87546658-87546680 GCTGCTGACTTCTGTCCCTCTGG - Intergenic
1131161333 15:90106836-90106858 GACTCAGACTTCCATCCCTGGGG + Intergenic
1131673851 15:94651174-94651196 GCCACTGACTTCCATCCCTCTGG + Intergenic
1133090568 16:3400982-3401004 GCCGCTGACTTCCGGCCCGGAGG - Exonic
1137709034 16:50553894-50553916 GCCTCTGCCTCCCATCCCCCAGG - Intronic
1138963350 16:62053551-62053573 GCCTCTGACTCCCATCACCCTGG - Intergenic
1141298460 16:82791631-82791653 GTGGCTGACTTCCACCCCTCTGG + Intronic
1142231772 16:88903461-88903483 GCCGCTGACCTCCCTCGCACAGG + Intronic
1142278313 16:89134463-89134485 GCCGCTGACTTCTATTCCTCCGG - Intronic
1142488998 17:265901-265923 TCTGCTGACTTCCACCCCACAGG + Intronic
1144948206 17:18980583-18980605 GGTGCTGACTTCCCTCCCCCAGG + Intronic
1145966152 17:28919181-28919203 GCCGCTCACTGCCATGCCCCTGG - Exonic
1148371989 17:47106725-47106747 GCCACTGACTTCCATTCCTCCGG - Intergenic
1148826726 17:50399291-50399313 GCTGCTGACTTCCACCCCTCTGG - Intergenic
1150281888 17:63933645-63933667 GCCCCTGACTTCCGTGGCTCAGG - Intergenic
1153400779 18:4682081-4682103 ACTGCTGACTTCTGTCCCTCTGG + Intergenic
1153402060 18:4692039-4692061 GCTGCTGGCTTCCATCCCTTCGG + Intergenic
1155749235 18:29399205-29399227 CTTGCTGACTTCCATCCCTCCGG - Intergenic
1156662248 18:39359393-39359415 CGTGCTGACTTCCACCCCTCAGG - Intergenic
1157782201 18:50449478-50449500 GCCACTGACTTCCATCCCTTCGG - Intergenic
1160731312 19:642843-642865 CCCCCTGACGTCCGTCCCTCTGG + Intronic
1161362621 19:3859518-3859540 GCCACTGACTTCCGTGCCCCGGG + Intronic
1163867523 19:19786533-19786555 GCCGTTGCTTTCCATTCCTCAGG + Exonic
1164943596 19:32270792-32270814 GTCGATGCATTCCATCCCTCTGG - Intergenic
1165823199 19:38690300-38690322 ACTGTTGACTTCCACCCCTCCGG + Intronic
1166014319 19:39968895-39968917 GCCGCTGACTTCCACCCCTCCGG + Intergenic
1166165567 19:40985917-40985939 GCCACTGACTTCCACCCGTCCGG + Intergenic
1166911650 19:46163379-46163401 GCTGCTGACCTTCATCTCTCTGG - Intergenic
924973617 2:153866-153888 ACCACTGACTTCCACCCCTCCGG - Intergenic
924974504 2:160350-160372 GCCACTGACTTCCACCCCTCCGG - Intergenic
926863991 2:17339341-17339363 ACCGCTGACTTCCATTCTTCTGG + Intergenic
926864988 2:17346345-17346367 ACTGCTGACTTCCATTCTTCTGG + Intergenic
926866423 2:17364007-17364029 TCCACAGACTTCCATCCATCTGG - Intergenic
927480975 2:23453621-23453643 GCCGCTGCCGTCCATTTCTCAGG - Intronic
928319126 2:30269296-30269318 GCCGCTGACTTCCATCCCTCTGG + Intronic
928348191 2:30519914-30519936 GCCATTGACTTTCACCCCTCTGG + Intronic
928440105 2:31285126-31285148 GCCGCTAACTTCCACCCCTCCGG + Intergenic
928671902 2:33610996-33611018 ACCATTGACTTCCACCCCTCCGG - Intergenic
928676635 2:33657577-33657599 GCTGCTGACTTTCACCCCTCCGG + Intergenic
928773663 2:34732749-34732771 TCTGCTGACTTCCATCCCTCTGG - Intergenic
930018167 2:46984948-46984970 TGCGCTGACTCCCACCCCTCTGG + Intronic
932360247 2:71099144-71099166 GCTCCTGACTTCTGTCCCTCAGG + Intergenic
932917179 2:75872089-75872111 GCCACTGACTTCTATCCCTCCGG + Intergenic
932918185 2:75879127-75879149 ACTGCTGAGTTCTATCCCTCCGG + Intergenic
933121768 2:78547013-78547035 CCCGTTGACTTCCACCCCTCTGG - Intergenic
933175731 2:79170182-79170204 GCCACTGACTCCCATCCCTCAGG - Intergenic
933328833 2:80871723-80871745 GCTGCTGACTCCCATCCCTCTGG + Intergenic
933500208 2:83101800-83101822 GCTGCTGACTCCCATCCCTCCGG + Intergenic
933556335 2:83835389-83835411 TCTGCTGACTTCCATCCCTCTGG - Intergenic
934757129 2:96832187-96832209 GGCGCTCCCTTCCATCCTTCTGG + Intronic
935748352 2:106209363-106209385 GCTACTGACTTCCACCCCTCCGG + Intergenic
935753878 2:106262181-106262203 CCCACTGCCTTCCATCCTTCGGG - Intergenic
936387734 2:112044812-112044834 GCCACTGACTTCCATCCCTCTGG - Intergenic
936868893 2:117109691-117109713 GCCACTGATTTCCATCCCTCAGG + Intergenic
938264158 2:129914222-129914244 TCTGCTGACTTCCCTCCTTCAGG - Intergenic
938791397 2:134679519-134679541 GTCGCTCACTTCTATCACTCTGG - Intronic
939134082 2:138273484-138273506 ACCGCTGATTTCCATCCCTCTGG - Intergenic
939493155 2:142900252-142900274 ACCACTGACTTCCACCTCTCTGG - Intronic
939494103 2:142907465-142907487 GCCATTGACTCCCACCCCTCTGG - Intronic
940669044 2:156645176-156645198 ACCACTGACTCCCATCCCTCCGG + Intergenic
942458130 2:176151760-176151782 GGCGCAGACTTCCAGCCCCCGGG + Exonic
942830310 2:180232090-180232112 GCCATTGACTTCCACCCCTCAGG + Intergenic
942831228 2:180238949-180238971 ACCATTGACTTCCACCCCTCCGG + Intergenic
944039789 2:195339905-195339927 GCCATTGACTTCCACCCCTCCGG - Intergenic
945064776 2:205939577-205939599 CCCGCTGACTTCCATCCCTCCGG + Intergenic
945395002 2:209306621-209306643 GCCGCTGACTTCCATCCCTCCGG + Intergenic
948517647 2:238514233-238514255 GCCGCTGACTTCCACCCCTCTGG + Intergenic
948897784 2:240935252-240935274 GGCACTGTCTTCCCTCCCTCAGG - Intronic
1170942835 20:20863290-20863312 GCCACTGACTTACCTCCCTAGGG - Intergenic
1171500790 20:25591457-25591479 GCCGCTGACTTCCATCCCTCCGG - Intergenic
1172947199 20:38698780-38698802 GCCGCTGACTTCCACCCCTCTGG + Intergenic
1173276251 20:41586275-41586297 GCCGTTGACTTTCACCCCTCCGG + Intronic
1174551573 20:51366212-51366234 GCCCCTGGATTCCATCCCTGTGG + Intergenic
1177263008 21:18753090-18753112 GCCACTGACTCCCATCCCTCCGG - Intergenic
1177263975 21:18760117-18760139 GCCGCTGACTCCCATCCCTCCGG - Intergenic
1177359356 21:20048614-20048636 GCCACTGACTTCCACCCCTCCGG - Intergenic
1177380756 21:20341109-20341131 GCTGCTGACTTCCATCCTGAAGG + Intergenic
1177738128 21:25118811-25118833 GCCGCTGACTTCCACCCCTCCGG + Intergenic
1182221365 22:28761580-28761602 GTCGCTGACTTCCATCCCTCTGG + Intergenic
1182895801 22:33858252-33858274 GCCGCTGACTTCCATCCCTCTGG - Intronic
1183288748 22:36984645-36984667 GCAGTTGACTTCCATCCCCCAGG + Intergenic
1183628947 22:39021633-39021655 GCCCTGGACTTCCTTCCCTCTGG + Intronic
1184609027 22:45590732-45590754 GCCCCTTACTCCCATCCCTCAGG - Intronic
949811669 3:8012936-8012958 GCGGCTGACTTCCATCCCTCTGG - Intergenic
952921712 3:38289746-38289768 GCCGCTGACTTCCACCCCTCCGG - Intronic
953505900 3:43485296-43485318 GCTGCTGACTTCCATACCTCCGG + Intronic
955381272 3:58440188-58440210 GCTGCTGACTTCCACCCCTCTGG - Intergenic
957000502 3:74877909-74877931 GCTGCTGACTTCCATCCCTCCGG - Intergenic
957557727 3:81782332-81782354 ACTGCTGACTTCCACCCCTCTGG + Intergenic
957687046 3:83515323-83515345 GCCGCTGACTTCCATCCCTCCGG + Intergenic
957895111 3:86411992-86412014 GCTGCTGGCTTCCACCCTTCTGG + Intergenic
958016743 3:87946203-87946225 GCCGCTGACTTCCACCCCTCTGG - Intergenic
958091891 3:88886804-88886826 GCTGCTGACTTCCACCCCTCTGG - Intergenic
958424507 3:93965306-93965328 GCTGCTGACTCCCATCCCTCCGG + Intronic
958457046 3:94345282-94345304 GCTGCTGACTTCCACCGCTCCGG - Intergenic
958629243 3:96666798-96666820 GCTGCTGACTACCATCCCTCTGG - Intergenic
958630364 3:96675016-96675038 GCTGCTGACTTACATCCCTCCGG - Intergenic
959161770 3:102732784-102732806 GCCACTGACTTCCATCCCTCCGG - Intergenic
959450011 3:106487170-106487192 GCCGCTGACTTCCATTCTTCCGG - Intergenic
959885716 3:111497368-111497390 GCCGTTGACTTTCATCCCTCTGG - Intronic
961133183 3:124487703-124487725 AATGCTGACTTCCATCCCACTGG - Intronic
963255684 3:143142520-143142542 GCCGCTGACTTCCACCCCTCCGG + Intergenic
963915314 3:150854406-150854428 GCCGCTGACTTCCATCCCTCTGG + Intergenic
965342130 3:167503674-167503696 ACCGCTGACTTCCATCCCTCTGG - Intronic
966353272 3:179054754-179054776 GCCGGCGACTTCCATGCCTCCGG + Intronic
966994310 3:185265048-185265070 GCTGTTGACTCCCACCCCTCCGG + Intronic
967389158 3:188938550-188938572 ACCGCTGACTTCCATCCCCCTGG - Intergenic
968390870 4:192110-192132 ACCACTGACTTCCAACCTTCTGG - Intergenic
969574969 4:8031359-8031381 GAAGCTGACATCCCTCCCTCAGG + Intronic
969644665 4:8420778-8420800 ACCACTGACTTCCACCCCTCCGG + Intronic
970095530 4:12459581-12459603 GCCGCAGACTTCCATCCCTGCGG + Intergenic
970738110 4:19198106-19198128 GCCGCTGACTTCCATCCCTCTGG - Intergenic
971764412 4:30811198-30811220 GCCACTGACTGCCATCCCAGAGG - Intronic
972766769 4:42158535-42158557 GCCACTGACTTCCATCCCTCTGG - Intergenic
973205067 4:47550815-47550837 GCCGCTGACTTCCACCCCTGCGG - Intronic
973245873 4:48010804-48010826 GCTGCTGACTTCCATCCCTCTGG - Intronic
974190480 4:58496519-58496541 GCTGTTGACTTCCACCCCTCTGG - Intergenic
974487286 4:62522464-62522486 GCAGCTGACTTCTACCCCTCCGG + Intergenic
974487848 4:62526862-62526884 GCCACTGACTTCCATCCCTCTGG - Intergenic
974519963 4:62971428-62971450 ACAACTGACTTCCAGCCCTCCGG + Intergenic
974648495 4:64724949-64724971 GCCACTGACTACCACCCCTCTGG - Intergenic
975313223 4:72925992-72926014 GCTGCTGACTTCCATCCCTCTGG - Intergenic
975314188 4:72932754-72932776 GCTGCTGACTTCCATCCCTCCGG - Intergenic
975434405 4:74334652-74334674 GCAGATGACTTCCCTCCCTTGGG - Intergenic
976189292 4:82473727-82473749 ACCACTGACTTCCACCCCTCCGG + Intergenic
976190171 4:82479748-82479770 GCCGCTGACTTCCACCCCTCCGG + Intergenic
976464848 4:85355208-85355230 GCCACTGACTTCCACCCCTCCGG - Intergenic
977251323 4:94692660-94692682 GCCGCTGAATTCCACCCCTCTGG + Intergenic
977556179 4:98489613-98489635 ACCACTGACTTCCACCCCTCCGG + Intronic
978527668 4:109681763-109681785 GCTGCTGACTTACATTCTTCCGG - Intronic
978909023 4:114044533-114044555 ACCGCTGACTTCCATCCCTCCGG + Intergenic
979883511 4:125993305-125993327 GCCATTTACTTCCACCCCTCGGG + Intergenic
980190523 4:129519360-129519382 GCTGCCGACTTCCATCCCTCTGG + Intergenic
980386300 4:132090738-132090760 GCCTCTGACTTCCATCCCTCTGG - Intergenic
980625718 4:135372333-135372355 GCCCCTGACTTCCATCCCTCTGG + Intergenic
980683941 4:136201402-136201424 TCGGCTGGCTTCCATCCTTCCGG + Intergenic
980790435 4:137613303-137613325 GCCGCTGACTTCCATCCCTGCGG + Intergenic
980969569 4:139556171-139556193 GCGGCTGCCTCCCGTCCCTCTGG + Exonic
981117671 4:141010833-141010855 CCCGCAGACTTCTTTCCCTCAGG - Intronic
981363269 4:143871850-143871872 GCAGCTGAATTCCATCCATTTGG + Exonic
981740761 4:147999469-147999491 ACCACTGACTTCCATCCCTCCGG + Intronic
982110109 4:152045959-152045981 GCTCCTGGCTTCCCTCCCTCCGG + Intergenic
982978789 4:162104103-162104125 ACTGCTGACTTCCATCCCTCCGG + Intronic
983777798 4:171629915-171629937 GCCGCTGACTTCCATCCCTCTGG + Intergenic
985226360 4:187765552-187765574 GCTGCTGACTCCCATCCCTCCGG + Intergenic
985663976 5:1172278-1172300 GCTGCTGGCTTCCGTCCCTGTGG - Intergenic
985851014 5:2389186-2389208 GCCGGTGACCGCCATCTCTCCGG - Intergenic
986492615 5:8307813-8307835 ACCGTTGACTTCCACACCTCAGG - Intergenic
986918837 5:12660729-12660751 GCTGCTGAGTTCCATCCCTCCGG - Intergenic
987502700 5:18733533-18733555 CGCGCTGACTTCCATCCCTTCGG - Intergenic
987508230 5:18800459-18800481 GCTGCTGACTTCCATCCCTCCGG + Intergenic
987719412 5:21615319-21615341 GCCGCTGACTTCCACCCTTCTGG - Intergenic
987761179 5:22164450-22164472 TCCGCTGACTTCCATCCCTCAGG - Intronic
987855129 5:23411335-23411357 ATCACTGACTTCCACCCCTCCGG + Intergenic
987905353 5:24069402-24069424 GCCACTGACTTCCACCCCTCTGG + Intronic
987934914 5:24451323-24451345 TCCGCTGACTTCCACCCCTCCGG - Intergenic
988099682 5:26660317-26660339 GCCGCTGACTTCCACCCCTCCGG - Intergenic
988182550 5:27816280-27816302 GCCATTGACTTCCACCCCTCTGG - Intergenic
988881480 5:35508163-35508185 GCTGTTGACTTCCACCCCTCTGG + Intergenic
988957393 5:36332945-36332967 GCCGCTGACTTCCATCCTTCTGG - Intergenic
989373552 5:40735093-40735115 ACCTCTGACTTCCTTTCCTCTGG - Intronic
989688433 5:44114706-44114728 GCTGCTGACTTCCATCCCTTTGG + Intergenic
989717702 5:44483527-44483549 GCTGCTGACTTCCACCCCTCTGG + Intergenic
990478808 5:56187576-56187598 GCCGCTGACTTCTATCCCTCTGG + Intronic
990741377 5:58915955-58915977 GCCGCTGACTTCTATCCCTCTGG + Intergenic
990891812 5:60658906-60658928 GCCACTGACTTCCACCCCTCCGG + Intronic
990905182 5:60795650-60795672 GCCACTGACTTCCAACCCTCCGG + Intronic
991895969 5:71397904-71397926 TCCGCTGACTTCCATCCCTCAGG - Intergenic
992293498 5:75304605-75304627 GACCCTGACTTCCACCCCTCTGG + Intergenic
993054984 5:82970953-82970975 GCTGCTGACTTCCATCCCTCCGG - Intergenic
993305767 5:86272986-86273008 ATGGCTGACTTCCATCCCTCCGG - Intergenic
993941853 5:94068357-94068379 GCCACTGACTTCCACCCCTCCGG - Intronic
993982341 5:94557927-94557949 GCTGCTAACTTCCATCCCTCTGG + Intronic
995717282 5:115092651-115092673 GCTGCTGACTTCCACCCCTCCGG + Intergenic
998122120 5:139587304-139587326 GCTGCTGACTTCCATCCCTCCGG - Intronic
998665966 5:144297970-144297992 CCCCTTGACTTTCATCCCTCTGG + Intronic
998700171 5:144689343-144689365 TCCGCTGACTTCAACTCCTCAGG + Intergenic
1000095455 5:157967405-157967427 GCCGCTGACTTCCATCCCTCCGG + Intergenic
1001597153 5:172905663-172905685 ACCGCTGACTTCCACCCCTCTGG - Intronic
1002382136 5:178838743-178838765 GCCTCTGTCTCCCGTCCCTCTGG - Intergenic
1002648589 5:180674522-180674544 GCCTCTGTCTCCCGTCCCTCTGG + Intergenic
1002932019 6:1641254-1641276 GCCCCTGAATTACATCCTTCAGG - Intronic
1002950901 6:1810219-1810241 CCAGCTGAGTTCCCTCCCTCTGG - Intronic
1003936069 6:10976602-10976624 GATGCTGACATCCAGCCCTCGGG + Intronic
1004007315 6:11649072-11649094 GCCTCTGACTTCCACCCCTCTGG + Intergenic
1004256415 6:14068843-14068865 GCCGCTGACTTCCATCCCTCCGG + Intergenic
1004306763 6:14508326-14508348 CCAGCTGATTCCCATCCCTCAGG + Intergenic
1005324135 6:24682641-24682663 ACCACTGACTCCCATCCCTCCGG - Intronic
1007011956 6:38426558-38426580 ACCGCTGACTTCCATTCTTCCGG + Intronic
1007094180 6:39203330-39203352 GCCCCTGACTCCCAGCCATCAGG - Intronic
1008582771 6:52921482-52921504 GCCACTGACTTCCATACCTCTGG - Intergenic
1009023936 6:57974999-57975021 GCCACTGACTTCCACCCATCTGG + Intergenic
1009199508 6:60726538-60726560 GCCGGTGACTTCCTCCCATCCGG + Intergenic
1009702463 6:67201749-67201771 ACCGCTGACTTCCACCCCTCTGG + Intergenic
1009885209 6:69617060-69617082 GCCGCTGACTTCAACCCCTCTGG + Intergenic
1010895031 6:81351513-81351535 GCCGCTGACTTCCATTCTTCCGG + Intergenic
1011076390 6:83443915-83443937 GCCACTGACTTTCACCCCTCCGG + Intergenic
1011189084 6:84712032-84712054 GCCATTGACTTCCACCCCTCTGG - Intronic
1011190318 6:84720719-84720741 ACCGTTGACTTCCACCCCTCTGG - Intronic
1012120019 6:95354765-95354787 GCCACTGACTTCCACCCCTCCGG + Intergenic
1012734536 6:102921667-102921689 ACTACTGACTTCCATCCCTCCGG - Intergenic
1013021760 6:106228290-106228312 GCCACTGACTTCCATCCCTCTGG + Intronic
1013359631 6:109382222-109382244 GCCGGTGACGTCCCTCCCGCTGG - Exonic
1013410510 6:109879635-109879657 GCCACTGACTTCCACCCCTCTGG + Intergenic
1013543077 6:111131173-111131195 GCCGCTGACTTCCACCCCTCTGG + Intronic
1014243343 6:119041693-119041715 GCCGCTGACTTCCACCCCTCCGG + Intronic
1015632769 6:135247980-135248002 ACCACTGACTTCCACCCCTCTGG + Intergenic
1016343647 6:143087532-143087554 GCCGCTGACTTCCATCCCTCTGG - Intronic
1016444922 6:144121388-144121410 ACCGCTGACTTCCACCCCTCCGG - Intergenic
1018760554 6:166891228-166891250 GCCGCTGACTTCCATCCCTCCGG + Intronic
1019635879 7:2075321-2075343 GCCTCTGCCTCCCACCCCTCAGG + Intronic
1021430873 7:20557380-20557402 TCCTCTTACTTCCTTCCCTCTGG - Intergenic
1021692613 7:23245480-23245502 GTGGCTGACTTCCATCCCTAAGG - Intronic
1021885337 7:25131917-25131939 GCCGCTGACTTCCATCCCTCCGG - Intergenic
1022989919 7:35696675-35696697 ACAGCTGACTTCCATCCCTCTGG + Intergenic
1023439770 7:40173332-40173354 GCCGCTGACTTCCACCCCTCCGG - Intronic
1023733132 7:43210808-43210830 ACTACTGACTTCCACCCCTCTGG - Intronic
1023871432 7:44264983-44265005 ACCCCTGACCCCCATCCCTCTGG + Intronic
1023886328 7:44359907-44359929 ACTGCTGACTTACATCTCTCTGG - Intergenic
1024148014 7:46536748-46536770 GCCGCTGACTTCCCTCCCTTTGG - Intergenic
1024318648 7:48044196-48044218 GCCGCTAATTTCCACCTCTCCGG - Intronic
1026213085 7:68324145-68324167 GCTGCTGACTCCCATCCCTCCGG + Intergenic
1027868361 7:83675040-83675062 CCCGCTGACTTCCATACCTCCGG - Intergenic
1028147063 7:87330038-87330060 GCCGCTGACTTCCACCCCTCTGG - Intergenic
1028587723 7:92468275-92468297 GCCGCTGACTCCCATCCCTCTGG - Intergenic
1028589086 7:92477762-92477784 GCCGCTGACTCCCATCCCTCTGG - Intronic
1028926148 7:96358687-96358709 GCCGCTGACTTCCACCCCTCTGG - Intergenic
1028993391 7:97074826-97074848 GCTGCTGACTTCCATCCCTCCGG + Intergenic
1029015973 7:97315967-97315989 GCCACTGACTTCCATCCCTCTGG + Intergenic
1029717442 7:102339033-102339055 CACGCTGACTGTCATCCCTCTGG - Intergenic
1030208392 7:106972743-106972765 GCCACTGACTTTCACCCCTCCGG - Intergenic
1030336811 7:108337440-108337462 ACTGCTGACTTCCATCCCTCTGG + Intronic
1030843979 7:114386125-114386147 ACCGCCGACTCCCATCCCTCTGG - Intronic
1031250872 7:119378920-119378942 GCTGCTGACTTCCACCCCTCTGG - Intergenic
1031472002 7:122177225-122177247 GCCACTGACTTCCACCCCTCCGG + Intergenic
1031742822 7:125455909-125455931 GCTGCTGACTTCCATCCCTCCGG - Intergenic
1032425789 7:131821168-131821190 GCCGTTGACTCCCACCCCTCTGG - Intergenic
1034248770 7:149671731-149671753 GCCACTGACTTCCACCCCTCTGG + Intergenic
1034249499 7:149676851-149676873 GCCGTTGACTTCCACCCTTCTGG + Intergenic
1034650841 7:152688831-152688853 GCCACTGACTTCCATCCCTCCGG - Intergenic
1034707075 7:153155174-153155196 ACCACTGACTTCCACCCCTCTGG - Intergenic
1034965008 7:155385376-155385398 GCCGCCGACTTCCATCCCTCCGG - Intronic
1037379955 8:18274626-18274648 ACCGTTGACTTCCACCCCTCAGG - Intergenic
1037648687 8:20817030-20817052 GCCACTGACATCCATCCCTCCGG - Intergenic
1038742248 8:30225912-30225934 CCCGCTGACTTCCATCCCTCTGG - Intergenic
1040768449 8:50944271-50944293 GCTGCTGACTTCCACCCCTCCGG - Intergenic
1041664090 8:60425342-60425364 ATCACTGACTTCCACCCCTCGGG - Intergenic
1041741911 8:61165208-61165230 GCCGCTGACTTCCATTCTTCCGG - Intronic
1042055658 8:64763111-64763133 GCCACTGACTTCCACCCCTCCGG + Intronic
1042292930 8:67188689-67188711 GCCACTGACTTCCACCCCTCCGG + Intronic
1042902988 8:73746855-73746877 GCCGCCGGCTTCCACCCCTCGGG + Exonic
1044988289 8:97774167-97774189 GCCGTTGACTTCCACCCCTCTGG - Intergenic
1045863513 8:106839360-106839382 GCCATTGACTCCCACCCCTCAGG - Intergenic
1047618316 8:126581357-126581379 GCTGCTGACTTCCACCCCTCCGG + Intergenic
1048100255 8:131343196-131343218 GCCACTGACTTCCACCCTTCTGG - Intergenic
1048631495 8:136247681-136247703 TCCGCTGACTTCCACCCCTCTGG + Intergenic
1050116055 9:2264571-2264593 ACTGCTGACTTCCACCCCTCCGG - Intergenic
1050286216 9:4104824-4104846 ACCCCTGACTCCCATCCTTCTGG - Intronic
1050593503 9:7183577-7183599 ACCACTGACTTCCATCCCTCTGG + Intergenic
1051970173 9:22878041-22878063 GCCGCTGACTTCCATCCCTCCGG - Intergenic
1051993712 9:23186790-23186812 GGAGCTGACTTCAATCCATCTGG - Intergenic
1053215195 9:36265045-36265067 GCCGCTGACTTCCACCCCTCCGG + Intronic
1055049593 9:71965002-71965024 ACCACTGACTTCCATCCCTCTGG - Intronic
1055455699 9:76469641-76469663 GCCACTGACTTCCATCCCTCTGG + Intronic
1055789837 9:79911927-79911949 GCCGCTGACTTCCCCACCTCCGG - Intergenic
1056449706 9:86705009-86705031 CCCTGTGACTTCCTTCCCTCTGG + Intergenic
1056705010 9:88944247-88944269 ACCGCTGACTTCCATCCCTCTGG - Intergenic
1056708543 9:88971631-88971653 GCCTCTGCCTTCCTTCCCTATGG + Intergenic
1057134901 9:92680659-92680681 TCCTCTAACTTCCATCCCTGGGG - Intergenic
1058231952 9:102436791-102436813 ACCGCTGACTTCCATCCCTCCGG - Intergenic
1061113546 9:128592911-128592933 GCTGCTGCCTTTCATCCCTGTGG + Intronic
1061281134 9:129598052-129598074 GCGGCTGAATGCCCTCCCTCCGG + Intergenic
1185615203 X:1418005-1418027 GCCGCCCACTTCCAACCCCCCGG - Exonic
1186254532 X:7703891-7703913 ACTGCTGACTTCCATCCCTCTGG - Intergenic
1187400075 X:18951385-18951407 GCAGCTGCCTTCCATCCCTCTGG - Intronic
1187613822 X:20971890-20971912 GCTGCTGACTTCCATCCCTCAGG + Intergenic
1187629889 X:21157389-21157411 GCAGCTGACTTCCACCTCTTCGG + Intergenic
1187654529 X:21455634-21455656 GCCACTGACATCAATCTCTCTGG - Intronic
1187775290 X:22749757-22749779 TCTGCTGATTTCCATCCCTGTGG - Intergenic
1189954273 X:46261967-46261989 ACCGCTGACTTCCATCCCTCCGG - Intergenic
1190525304 X:51323541-51323563 GCCACTGCCTGCCATTCCTCTGG - Intergenic
1190693892 X:52935286-52935308 GCCGCAGGCTTCCTTCCCTGCGG + Intronic
1191167483 X:57405526-57405548 GCCACTTACTTCCACCACTCTGG - Intronic
1192202987 X:69078630-69078652 GCACCAAACTTCCATCCCTCTGG + Intergenic
1192803105 X:74485850-74485872 ACTTCTGACTTCCACCCCTCCGG - Intronic
1192940367 X:75904897-75904919 GCCACTGACTTCCATCCCTCTGG - Intergenic
1193172382 X:78350339-78350361 GCTGCTGACTTCCTCCCCTCTGG - Intergenic
1193295491 X:79827534-79827556 GCCGCTGACTTCCATCCCTCCGG - Intergenic
1193423824 X:81316563-81316585 GCCTCTGACTGCCCTCCCTAAGG + Intergenic
1194103277 X:89734553-89734575 GCCGCTGACTTCCATCCCTCCGG - Intergenic
1194154502 X:90370266-90370288 ACCACTGACTTCCATCTCTCTGG - Intergenic
1194445397 X:93981458-93981480 GCCGCTGACTTCCATCACTCCGG - Intergenic
1195256576 X:103096808-103096830 GCTGCTGACTTCCACCCCTCCGG + Intergenic
1195505078 X:105647201-105647223 ATCGCTGGCTTCCACCCCTCCGG - Intronic
1195584607 X:106551425-106551447 GCCGCTGACTTCCATCCCTCTGG + Intergenic
1196258167 X:113547169-113547191 GCCGTTGACTTCCATCGCTCCGG - Intergenic
1196287275 X:113897437-113897459 GCTGCTGACTCCCATCCCTCCGG - Intergenic
1196410352 X:115411924-115411946 GCTGCTTACTTCATTCCCTCAGG + Intergenic
1196772522 X:119309122-119309144 GCCACTGACTTCCATCCCTCCGG - Intergenic
1197545324 X:127816570-127816592 ACCGCTGACTTCCATCCCTCCGG - Intergenic
1199432079 X:147773201-147773223 GCCGCTGACTTCCATTCTTCAGG + Intergenic
1199536303 X:148906805-148906827 GCCCTTGACTTCCACCCCTCCGG + Intronic
1200179605 X:154142384-154142406 GACCCTGCCTTCCATTCCTCTGG + Intergenic
1200500855 Y:3947159-3947181 ACCACTGACTTCCATCTCTCTGG - Intergenic
1200851261 Y:7886374-7886396 GCCACTGACTTCCACCCCTCTGG - Intergenic
1201905232 Y:19080350-19080372 GCCACTGACTTCCATCCCTCTGG + Intergenic