ID: 1126728339

View in Genome Browser
Species Human (GRCh38)
Location 15:51655603-51655625
Sequence GAGGGATGGAAGTCAGCGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 703
Summary {0: 39, 1: 126, 2: 141, 3: 117, 4: 280}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126728328_1126728339 19 Left 1126728328 15:51655561-51655583 CCTCACTGGATCAGGAGCACAGC 0: 47
1: 109
2: 121
3: 106
4: 223
Right 1126728339 15:51655603-51655625 GAGGGATGGAAGTCAGCGGCAGG 0: 39
1: 126
2: 141
3: 117
4: 280
1126728333_1126728339 -9 Left 1126728333 15:51655589-51655611 CCCTGCCGGATCCGGAGGGATGG No data
Right 1126728339 15:51655603-51655625 GAGGGATGGAAGTCAGCGGCAGG 0: 39
1: 126
2: 141
3: 117
4: 280
1126728335_1126728339 -10 Left 1126728335 15:51655590-51655612 CCTGCCGGATCCGGAGGGATGGA No data
Right 1126728339 15:51655603-51655625 GAGGGATGGAAGTCAGCGGCAGG 0: 39
1: 126
2: 141
3: 117
4: 280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126728339 Original CRISPR GAGGGATGGAAGTCAGCGGC AGG Intergenic
901428866 1:9200142-9200164 CAGGGTTGGGAGTCAGAGGCTGG + Intergenic
901453786 1:9352023-9352045 GAGGGATGGGAGTCTGTGGGAGG - Intronic
902245953 1:15120442-15120464 GTGGGATGGAGGTGAGGGGCTGG + Intergenic
902550435 1:17216014-17216036 GAGAGAAGGAAGTGAGGGGCTGG + Intronic
903822196 1:26111443-26111465 GAGGGAGGGGAGGCCGCGGCCGG + Intronic
904397178 1:30229824-30229846 GAGGGGTGGAAGTCAGCAGTGGG - Intergenic
904462161 1:30686524-30686546 CAGGGATGGAACGCAGGGGCTGG + Intergenic
906107504 1:43303782-43303804 GAGGGAGAGAAATCAGGGGCAGG - Intronic
906282980 1:44566577-44566599 GGGGGATGGAAGTCTGAGACTGG + Intronic
906507527 1:46391152-46391174 GAGGGATGGAAGTCGGCGGCGGG + Intergenic
906582993 1:46952038-46952060 GAGGGATGGAAGTCAGTGGCAGG - Intergenic
907504957 1:54911339-54911361 GAGGGATGAAAGTCAGTGGCGGG + Intergenic
907506071 1:54919112-54919134 GAGGGATAGAAGTCAGTGGAGGG + Intergenic
907602272 1:55783512-55783534 GAGGGGTGGAAGTCAACAGCGGG + Intergenic
908717664 1:67087550-67087572 GAGGGGTGGAAATCAACGGCGGG - Intergenic
908723224 1:67148195-67148217 GAGGGGTGGAAGTCAGTGGTGGG + Intronic
908892684 1:68863878-68863900 GAGGGGTGGAAGTCAGTGGCAGG - Intergenic
909859907 1:80592511-80592533 GAGGGATGGAAGTCAGCAATGGG + Intergenic
909943047 1:81632882-81632904 GTGGGATGGAAGTCATTGGAGGG + Intronic
910116678 1:83739177-83739199 GAGGGATGGAAGTCAGTGACGGG + Intergenic
911039673 1:93582024-93582046 GAGGGATGGCAGGCTGCTGCCGG - Intronic
911462069 1:98203630-98203652 TAGGGATGGGGGTCAGGGGCAGG + Intergenic
912285717 1:108366259-108366281 GAGGGATGGAAGTCAGCGGTGGG + Intergenic
912463402 1:109852563-109852585 GAGGGGCGGAAGTCAGTGGCGGG + Intergenic
913247029 1:116879080-116879102 GAGGGAGGGCAGGCAGCTGCTGG - Intergenic
913440117 1:118888138-118888160 GAGAGAAGGAAGACAGCAGCTGG + Intronic
913470780 1:119183097-119183119 GAGGGTTGGAAGTCAGCTGCGGG + Intergenic
914747797 1:150512319-150512341 GAGAGAGGGAAGTCAGAAGCTGG - Intronic
915622646 1:157095328-157095350 GAGGGGTGGAGGTGAGGGGCTGG + Intronic
916258866 1:162820260-162820282 CAGGGATGGAAGACAGAGGGAGG - Intergenic
916399406 1:164429802-164429824 GAGTGATGGAAGTCACTGGAGGG + Intergenic
917097533 1:171414042-171414064 AAGGGGTGGAAGTCAACGGGGGG + Intergenic
917403531 1:174678898-174678920 GAGGGATGGAAGTCAGCAGTGGG + Intronic
917413367 1:174783101-174783123 GAGGGCTGGAAGTCAACGGTGGG - Intronic
917724027 1:177812796-177812818 GAGGGGTGGAAGTCAGCCGCGGG - Intergenic
919082776 1:192886764-192886786 GAGGTATGGGAGTCAGCGGCAGG + Intergenic
919861048 1:201739785-201739807 TCGGGACAGAAGTCAGCGGCGGG + Intronic
920434609 1:205939927-205939949 GGGGGATGGAAGGCAGTGGAGGG - Intronic
920639850 1:207741485-207741507 GAGGAATGGAAGTCAGCGGTGGG + Intergenic
921557141 1:216612357-216612379 GAGGGAAGGAAGGAAGGGGCGGG + Intronic
922007935 1:221551022-221551044 GAGGGATGGAAGTCAGTGGCGGG + Intergenic
922683929 1:227624844-227624866 GAGGGATGGAAGTCAGCAGTGGG + Intronic
922685157 1:227633129-227633151 GAGGGGTGGAAGTCATTGGTGGG + Intronic
922876309 1:228942545-228942567 GAGGCATGGAAGTCAGCGGCAGG - Intergenic
922877772 1:228953923-228953945 GAGGGATGGAAGTTAGTGGCTGG - Intergenic
923656782 1:235923864-235923886 CAGGGTTGGAAGTCAGCACCTGG + Intergenic
1064250814 10:13705139-13705161 GAAGGAAGGAAGTCGGAGGCAGG - Intronic
1065199857 10:23301979-23302001 GAGGGATGGAAGTCAGCGGTGGG + Intronic
1066246834 10:33591931-33591953 GAGGGATGGAAGTCAGTGGCAGG + Intergenic
1066673014 10:37859424-37859446 GAGGGATGGAAGTCAGCGGCGGG + Intergenic
1068191615 10:53659785-53659807 GAGGGATGGAAGTCAGTGGCGGG - Intergenic
1068791293 10:61034019-61034041 GAGGGGTGGAAGTCAGTGGCAGG + Intergenic
1068792069 10:61039484-61039506 GAGGGGTGGAAGTCAGTGGCGGG + Intergenic
1068988846 10:63130982-63131004 GAGGGGTGGAAGTCAGCGGCGGG + Intergenic
1069037962 10:63664967-63664989 GAGGGGTGGAAGTCAGTGGCAGG + Intergenic
1070492595 10:76991754-76991776 GAGGGAGGGAAGGCAGCCCCTGG + Intronic
1070602791 10:77877568-77877590 GAGGGAGGGAAGGCAGTGGGAGG + Intronic
1071051876 10:81460194-81460216 GAGGGATGGAAGTCAGTGGCGGG - Intergenic
1071082702 10:81831279-81831301 GAGGGGCGGAAGTCAGCGGCGGG + Intergenic
1071326724 10:84525701-84525723 GAGGGGTGGAAGTCAGCGGCGGG + Intergenic
1071327413 10:84530641-84530663 GAGGGGTGGAAGTCAGCGGCGGG + Intergenic
1071331537 10:84565537-84565559 GAGGGATGGAAGTCAGCGGCGGG + Intergenic
1071556998 10:86612114-86612136 GAGGGATGGAAGTCAGCGTCAGG - Intergenic
1072378559 10:94841359-94841381 GAGGGATGGAAGTCTGCAGCGGG + Intronic
1072472434 10:95724696-95724718 GAGGGGTGGAAGTCAGTGATGGG + Intronic
1072650309 10:97290252-97290274 GCGGGATGGGAGTCAGCGGCGGG - Intronic
1072650314 10:97290270-97290292 GAGGGATGGGAGTCAGCAGCGGG - Intronic
1072795086 10:98348583-98348605 GAGGGATTGAAGTGAGCAGCGGG - Intergenic
1072843779 10:98805114-98805136 GAAGGATGGTTGTCAGAGGCTGG + Intronic
1073474972 10:103746853-103746875 GAGGGATGCAAGGCAATGGCTGG - Intronic
1074284820 10:112088259-112088281 GAGTGATGGATGTGAGGGGCAGG + Intergenic
1074978463 10:118599856-118599878 GAGGGGTGGAAGTCAGAGGCGGG + Intergenic
1076792665 10:132785467-132785489 AAGGGAGGGAGGTCAGCGGCCGG + Intronic
1077021348 11:418457-418479 GTGGCATGGAAGGCAGAGGCTGG - Exonic
1078191863 11:9097721-9097743 GAGGGGTGGAAGTCAGCGGCGGG - Intronic
1078416917 11:11173518-11173540 GAGTGAAGGAAGCCAGGGGCGGG - Intergenic
1078437857 11:11340241-11340263 GAGGGATAGAGGACAGTGGCAGG + Intronic
1079601742 11:22317908-22317930 GAGGGATGGAAGTCAGTGGCGGG + Intergenic
1079678725 11:23265116-23265138 GAGGGGTGGAAGTCAGCAGCGGG + Intergenic
1079692846 11:23441412-23441434 GAGGGATGGAAGTCAGCAGCGGG - Intergenic
1079761854 11:24338960-24338982 GAGGTGTGGAAGTCAGCGGCAGG - Intergenic
1079884282 11:25966528-25966550 GAGGGATGGAAGTCAGTGGCAGG + Intergenic
1079933254 11:26590782-26590804 GAGGGGTGGAAGTCAGTGGCGGG + Intronic
1079934239 11:26597501-26597523 GAGGGGTTGAAGTCAGCGGTGGG + Intronic
1080881480 11:36325328-36325350 GAGGGTTGGAAGTCAGCGGCAGG + Intronic
1081069736 11:38595832-38595854 GAGGGATGGAAGTCAGCAGCGGG + Intergenic
1081070180 11:38602005-38602027 AAGGGGTGGAAGTCAATGGCCGG - Intergenic
1081506070 11:43718479-43718501 GGGGGATGGGAGACAGAGGCAGG - Intronic
1081615653 11:44589589-44589611 GAGGGAGTGAGGTCAGCGCCTGG - Intronic
1082737605 11:56873933-56873955 GAGGGGTGGAAGTCAGTGGGGGG - Intergenic
1083183123 11:61000974-61000996 AAGGGATGGAGGGGAGCGGCTGG - Intronic
1084696430 11:70758372-70758394 GAGGGGTGGAAGTCAACGGCGGG - Intronic
1084714804 11:70866939-70866961 GAGGGAGTGAAGGCAGAGGCTGG - Intronic
1084878727 11:72154333-72154355 GAGGGGTGGAAGTCAGCGGCGGG - Intergenic
1085601989 11:77863309-77863331 GAGGGATGGAAGTCAGCAGCGGG + Intronic
1086057529 11:82664500-82664522 AAGGGATGGAACACAGCAGCAGG + Intergenic
1086511206 11:87559888-87559910 GAGGGGTGGAAGTCAGCAGTGGG + Intergenic
1087901299 11:103644859-103644881 GAGGGGTGGAAGTCAATGGCGGG + Intergenic
1088110097 11:106251168-106251190 GAGGGATAGACGTCAGTGGTGGG - Intergenic
1088242927 11:107789662-107789684 GAGGGGTGGAAGTCAATGGTGGG - Intergenic
1088484621 11:110328713-110328735 GAGTGGTGGAAGTCAGTGGCAGG + Intergenic
1088879804 11:113964519-113964541 GAAGGATGGAAGTCAGCGGCAGG - Intergenic
1089120734 11:116132834-116132856 GAAGGGTGGAAGAGAGCGGCAGG - Intergenic
1092211180 12:6647335-6647357 GAGGGAAGGAAGCCAGCGGCTGG + Exonic
1092293645 12:7181299-7181321 GAGGGGTGGAAGTCAGCAGCAGG - Intergenic
1092469921 12:8768294-8768316 GAGGGGTGGAAGTCAACGGTGGG + Intronic
1093106661 12:15095428-15095450 GAGGGATGGAAGTCAGTGGCGGG + Intergenic
1095552475 12:43459199-43459221 GAGGGATGGAAGTCAGCAGCAGG - Intronic
1095893109 12:47253029-47253051 GAGGGATGGAAGTCAGCGGCAGG + Intergenic
1096036265 12:48473767-48473789 GTTGGGTGGAAGTCCGCGGCTGG + Intergenic
1096351234 12:50902828-50902850 GAGGAATGGAAGTCAGTGGCGGG + Intergenic
1096352549 12:50912199-50912221 GAGGGATGGAAGTCAGCAGTGGG + Intergenic
1096939396 12:55325689-55325711 GAGGGATGGAAGTCAGCAGCAGG - Intergenic
1097376743 12:58852195-58852217 GAGGGATGGAAGTCAATGGCGGG + Intergenic
1097377751 12:58859324-58859346 GAGGGATGGAAGTCAACGGCGGG + Intergenic
1097840847 12:64319991-64320013 GAGGGATGGAAGTCAGTGGCGGG - Intronic
1098639876 12:72825604-72825626 GAGGGATGGAAGTCAGTGGCGGG + Intergenic
1098984874 12:77001481-77001503 GAGGGGTGGAAGTCAGCGGCGGG - Intergenic
1099256925 12:80325779-80325801 GAAGGAAGGAAGACAGCAGCAGG + Intronic
1099292617 12:80790106-80790128 GAGGGATGGAAGTCAGTGGCGGG - Intergenic
1099605035 12:84794124-84794146 GAGGGGTGGAAGTCAGTTACGGG - Intergenic
1099798629 12:87429615-87429637 GAGGGGTGGAAGTCAGTGGCAGG + Intergenic
1100205064 12:92339674-92339696 GAGGCATGGAAGTCAGCAGTGGG + Intergenic
1100992764 12:100267677-100267699 CCGGGATCGAAGTCAGCTGCCGG + Exonic
1101555293 12:105803015-105803037 GAGGGGTGGAAGTCAGCGGCGGG + Intergenic
1103802557 12:123548826-123548848 GAGGGGTGGAAGTCAGTGACGGG - Intergenic
1103803998 12:123558411-123558433 GACGGCTAGAAGTCAGCGGCGGG - Intergenic
1103872340 12:124100809-124100831 GAGGGGTGGAAGTTAGTGGCGGG + Intronic
1104187865 12:126449641-126449663 GAGGGATGGAAGTCAGCGGCGGG + Intergenic
1104850966 12:131873531-131873553 GAGGGGTGGAAGTCAGCGGCGGG + Intergenic
1105068684 12:133220703-133220725 GAGGGATGGAGGACTGGGGCAGG - Intronic
1105346006 13:19573354-19573376 AAGGCATGGAAGTCTGAGGCTGG - Intergenic
1105514340 13:21076522-21076544 GAAGGATGGAAGTCACTGGAAGG + Intergenic
1107156426 13:37172374-37172396 GAGGGATGGAAGTCAGCAGCGGG + Intergenic
1107395417 13:40011732-40011754 GAGTGAGGGAAGTCAGGGCCTGG - Intergenic
1107700913 13:43046810-43046832 GAGGGGTGTAAGTCAGCGGCAGG - Intronic
1108876196 13:55054036-55054058 GCGGGATGGGAGTCAGGGGCGGG - Intergenic
1108876203 13:55054054-55054076 GAGGGATGGGAGTCAGTGGCGGG - Intergenic
1108877216 13:55061351-55061373 GCGGGATGGGAGTCAGGGGCGGG - Intergenic
1108877223 13:55061369-55061391 GAGGGATGGGAGTCAGTGGCGGG - Intergenic
1109292830 13:60497134-60497156 GAAGGGTGGAAGTCAACGGCGGG + Intronic
1109380898 13:61558271-61558293 GTGGGGTGGAAGTCAGCAGCGGG + Intergenic
1109520630 13:63505553-63505575 GAGGGATGGAAGTCAGAGGCGGG + Intergenic
1109523585 13:63545113-63545135 GAGGGATGGAAGTCAGCGGAGGG + Intergenic
1109594004 13:64525854-64525876 GAGGGATGGAAGTCAGCGGCAGG - Intergenic
1109680715 13:65748439-65748461 GAGGGATGGAAGTCAGCGGCGGG + Intergenic
1109931293 13:69222026-69222048 GCGGGATGGGAGTCAGCGGCGGG - Intergenic
1109931298 13:69222044-69222066 GAGGGATGGGAGTCAGCAGCGGG - Intergenic
1110608516 13:77461978-77462000 GAGGGAAGGAAGGCAGCTGTGGG - Intergenic
1110660994 13:78059473-78059495 GAGGGGTGGAAGTCAGCAGCGGG - Intergenic
1110846144 13:80192461-80192483 GAGGGATGGAAGTCAGCGGTGGG - Intergenic
1110987074 13:81984411-81984433 GAGGGATGGAAGTCAGCGGCAGG + Intergenic
1111021444 13:82457714-82457736 GAGGGATGGGAGTCAGTGGTAGG - Intergenic
1111100908 13:83584917-83584939 GAGGGATGGAAGTCAACTGGCGG + Intergenic
1111174781 13:84580098-84580120 GAGGGACAGAAGTCAGCAGCGGG + Intergenic
1111536795 13:89612088-89612110 GAGGGATGGAAGTTAGCAGTGGG + Intergenic
1111820399 13:93206925-93206947 GAGGGATGGAAGTCAGCAGTGGG - Intergenic
1111910272 13:94303043-94303065 GAGGGGTGGGAGTCAGCAGTGGG + Intronic
1113075793 13:106466853-106466875 GAGAGATGAAAGCCAGAGGCAGG - Intergenic
1113534724 13:111056631-111056653 GAGAGATGGAAGTCAGCAGTGGG - Intergenic
1113592275 13:111509337-111509359 GAGGGATGGAAGTTAGAGGCGGG + Intergenic
1113607753 13:111622417-111622439 GAGGGGTGGATGGCAGCGCCCGG - Intronic
1113978299 13:114249142-114249164 GAGAGATGGGAGACAGCGACAGG + Intronic
1114043556 14:18702185-18702207 CAGGGATGGCTGTCACCGGCAGG + Intergenic
1114047840 14:18892627-18892649 CAGGGATGGCTGTCACCGGCAGG + Intergenic
1114114681 14:19509016-19509038 CAGGGATGGCTGTCACCGGCAGG - Intergenic
1114116376 14:19626779-19626801 CAGGGATGGCTGTCACCGGCAGG - Intergenic
1114383852 14:22236765-22236787 GAGGGATGGAAGTCAGCAGCAGG - Intergenic
1114384827 14:22243812-22243834 GAGGGATGGAAGTCAGCGGCAGG - Intergenic
1114840842 14:26260614-26260636 GAGGGATGGAAGTCAGTGGCGGG - Intergenic
1116118805 14:40694723-40694745 GAGGGATGGGAGTCAGCGGCGGG + Intergenic
1116740329 14:48746732-48746754 GAGGGATGGGAGTTAGCGGTGGG - Intergenic
1117171812 14:53108157-53108179 GAGGGATGGAAGTCAGCGGCAGG - Intronic
1117737852 14:58785900-58785922 GGGGGATGGAAGGCAGGGTCTGG - Intergenic
1118453515 14:65925224-65925246 GAGGGTTGGGAGTCAGCGGCAGG + Intergenic
1119057583 14:71438837-71438859 GAGGGAGGCAAGTAAGCTGCAGG - Intronic
1119089940 14:71772184-71772206 GAGGGATGGAAGTCAGAGGCGGG + Intergenic
1120097379 14:80403892-80403914 GAGGGATGGAAGTCAGTGGAGGG - Intergenic
1120107983 14:80517945-80517967 GAGGGGTGGAAGTCAGTGGCAGG + Intronic
1120341438 14:83225727-83225749 GAGGGATGGAAGTCAGTGGCGGG - Intergenic
1120350890 14:83356820-83356842 GTGGAATGGAAGCCAGAGGCAGG + Intergenic
1120397385 14:83985613-83985635 GAGGGATGGAAGTCAGCGGTGGG - Intergenic
1121019120 14:90568173-90568195 GAGGAATGAAAGGCAGCAGCAGG + Intronic
1121583497 14:95047498-95047520 CAGGGATGGGACTCAGCGGCGGG + Intergenic
1122384981 14:101338502-101338524 GAAGGATGGAAGACGGAGGCTGG + Intergenic
1122792613 14:104190658-104190680 GCAGGATGGAAGGCAGGGGCAGG + Intergenic
1123125462 14:105942898-105942920 GAGGGATGGAAGCCAGCGGTGGG - Intergenic
1124104998 15:26729421-26729443 GAGAGGTGGCAGTCAGTGGCTGG - Intronic
1124421228 15:29524722-29524744 GAGGGGTGTCAGTCAGTGGCAGG + Intronic
1126153885 15:45547362-45547384 GAGGGGGGGAAGTCAATGGCAGG + Intergenic
1126728339 15:51655603-51655625 GAGGGATGGAAGTCAGCGGCAGG + Intergenic
1126929052 15:53626431-53626453 AAGGGATGGAAGTCAGCGGCAGG + Intronic
1127074516 15:55312204-55312226 GAGGGATGGAAGTCAGCGGCGGG + Intronic
1128363109 15:66976451-66976473 GAGGGGTGGAAGTCAGTGGTGGG + Intergenic
1129776375 15:78239296-78239318 GACGGATGGCAGTCAGCAGCGGG + Intronic
1130304040 15:82700828-82700850 GATGGATGGGAGTCTGGGGCAGG - Intronic
1130825969 15:87546661-87546683 GAGGGACAGAAGTCAGCAGCGGG + Intergenic
1130869422 15:87958785-87958807 GAGGGATGGAAGAGAGGGGTGGG - Intronic
1131420113 15:92298298-92298320 GAGGGATGGAAATCAGCAGCGGG - Intergenic
1131629145 15:94157677-94157699 GAGGAGTGGAAGTCAGCGACGGG - Intergenic
1131673849 15:94651171-94651193 GAGGGATGGAAGTCAGTGGCGGG - Intergenic
1131739350 15:95370489-95370511 GAGGGATGGGAGCCATTGGCAGG - Intergenic
1132212078 15:100031553-100031575 AAGGGGTGGAAATCAGAGGCTGG - Intronic
1133913197 16:10084598-10084620 GAGGCATGGTAGTAAGAGGCAGG - Intronic
1133924109 16:10180518-10180540 CAGGCATGGAACTCAGCAGCAGG + Intronic
1134005941 16:10818788-10818810 GAGGAATGGGAGTCGGGGGCGGG + Intronic
1134851185 16:17480299-17480321 GAAGGAGGAAAGTCAGAGGCAGG - Intergenic
1137355320 16:47756884-47756906 GAGGGATGGGAGTGAGTGGGAGG + Intergenic
1137510448 16:49095141-49095163 GAGGGATGGAAGGCACTGACTGG + Intergenic
1137709035 16:50553897-50553919 GGGGGATGGGAGGCAGAGGCTGG + Intronic
1139579682 16:67865026-67865048 GAGGGGTGGGGGTCAGTGGCTGG + Intronic
1140905184 16:79403472-79403494 GAGGCAGGGAAGTGAGGGGCGGG - Intergenic
1141298458 16:82791628-82791650 GAGGGGTGGAAGTCAGCCACGGG - Intronic
1141509132 16:84501384-84501406 GTGGGATGGAAGTGAGGGGCTGG - Intronic
1141829045 16:86499251-86499273 GAGAGAGAGAAGTCAGGGGCAGG + Intergenic
1141897057 16:86964913-86964935 GAGGGAGGGCAGGCAGGGGCCGG - Intergenic
1142062072 16:88036740-88036762 GATGGATGGAAGGAAGCAGCAGG + Intronic
1142278315 16:89134466-89134488 GAGGAATAGAAGTCAGCGGCGGG + Intronic
1142495827 17:305826-305848 GAGGGAAGGAAGAAAGGGGCTGG - Intronic
1143445432 17:7006426-7006448 GAGGAATAGAGGTCAGAGGCGGG + Intronic
1144256713 17:13475637-13475659 GGAGGATGGAAGTGAGTGGCAGG + Intergenic
1144328672 17:14205625-14205647 GGGGGCTGGAAGGCAGGGGCTGG - Intronic
1144948205 17:18980580-18980602 GGGGGAGGGAAGTCAGCACCTGG - Intronic
1145800849 17:27683851-27683873 CAGGGATGGCTGTCACCGGCAGG + Intergenic
1145811210 17:27765436-27765458 CAGGGATGGCTGTCACCGGCAGG + Intronic
1146312060 17:31776840-31776862 GAGGAATGTAAGCCAGTGGCAGG - Intergenic
1146813556 17:35923749-35923771 TAGGGTTTGAAGTCAGAGGCAGG - Intronic
1148175056 17:45556799-45556821 TAGGGTTTGAAGTCAGAGGCAGG - Intergenic
1148296316 17:46506228-46506250 TAGGGTTTGAAGTCAGAGGCAGG + Intergenic
1148371991 17:47106728-47106750 GAGGAATGGAAGTCAGTGGCGGG + Intergenic
1148479459 17:47950516-47950538 GAGGGATGGAAGTCAGGCTCAGG - Intergenic
1148826728 17:50399294-50399316 GAGGGGTGGAAGTCAGCAGCGGG + Intergenic
1148827588 17:50405272-50405294 GAGGGGTGGAAGTCAGCAGCAGG + Intergenic
1149243107 17:54673742-54673764 GAGGGATGGAAGTCAGTGGCGGG + Intergenic
1149274554 17:55018326-55018348 GAGGGATGGAAGTCAGCAGCGGG + Intronic
1150281889 17:63933648-63933670 GAGCCACGGAAGTCAGGGGCAGG + Intergenic
1150406274 17:64903710-64903732 TAGGGTTTGAAGTCAGAGGCAGG - Intronic
1151224449 17:72638381-72638403 GAGGGGTGGAAGTCAGCAGTGGG - Intergenic
1151653437 17:75484280-75484302 GAGGGACGGAAGAAAGGGGCAGG - Intronic
1152928820 17:83099865-83099887 GAGGGGCGGAAGGCAGGGGCGGG + Intergenic
1153400777 18:4682078-4682100 GAGGGACAGAAGTCAGCAGTGGG - Intergenic
1153402058 18:4692036-4692058 AAGGGATGGAAGCCAGCAGCGGG - Intergenic
1154416824 18:14179714-14179736 GAGGGATGGAAAACAGCTGAGGG - Intergenic
1155148853 18:23106346-23106368 GAGAGAGAGAAGTCAGAGGCTGG + Intergenic
1155349237 18:24890271-24890293 AAGGGAAGGAAGACAGAGGCAGG + Intergenic
1156652558 18:39241697-39241719 GAGTGATGGTTGTCAGGGGCTGG + Intergenic
1157093821 18:44668223-44668245 GAGGGAGGGAAGACACCAGCAGG - Intergenic
1157235637 18:45962638-45962660 GAGGAATGTAGGTCAGCTGCTGG + Intronic
1157259336 18:46165136-46165158 AAGGGATGGAAGTCAGCGGCGGG - Intergenic
1157782202 18:50449481-50449503 AAGGGATGGAAGTCAGTGGCAGG + Intergenic
1158018213 18:52809617-52809639 GAGGGGTGGAAATCAGCAGTGGG + Intronic
1158152298 18:54387000-54387022 AGAGGATGGAAGTCAGCGGCGGG - Intergenic
1158470803 18:57735226-57735248 GAGGGATGGAAGTCAGCGGCGGG - Intronic
1159010716 18:63057028-63057050 GAGGGAGGGACATCAGCGGAAGG - Intergenic
1159276122 18:66223468-66223490 GAGGGATGGAAGTCAGCGGCAGG - Intergenic
1159279776 18:66270444-66270466 GAGGGATGGAAGTCAGTGGCGGG + Intergenic
1159860606 18:73644307-73644329 GAGGGATGGTTGCCAGAGGCTGG + Intergenic
1160102764 18:75938510-75938532 GAGGGACAGAAGACAGCAGCAGG + Intergenic
1161327587 19:3671071-3671093 GAGGGCAGGAAGCCAGCGGTGGG + Intronic
1161362619 19:3859515-3859537 GGGGCACGGAAGTCAGTGGCTGG - Intronic
1161683361 19:5691484-5691506 GTGGGATGGGAGTCAGGGCCGGG + Intronic
1161788897 19:6346729-6346751 GACTGATGGAAAACAGCGGCTGG - Intergenic
1162462358 19:10820629-10820651 GAGGTGGGGAAGGCAGCGGCAGG + Intronic
1163110951 19:15160839-15160861 GAGGGAGGGAGGTGAGGGGCTGG + Exonic
1164056876 19:21629506-21629528 GAGGGATGAAAGTCAGTGGCAGG - Intergenic
1164173173 19:22745553-22745575 GAGGGGTGGAAGTCAGCGGCAGG - Intergenic
1164943597 19:32270795-32270817 GAGGGATGGAATGCATCGACTGG + Intergenic
1165126114 19:33599074-33599096 GAGGAATGGCAGTGGGCGGCAGG + Intergenic
1165725871 19:38112453-38112475 AAGGGAGGGAGGTCAGCTGCAGG - Intronic
1165823197 19:38690297-38690319 GAGGGGTGGAAGTCAACAGTGGG - Intronic
1166014318 19:39968892-39968914 GAGGGGTGGAAGTCAGCGGCAGG - Intergenic
1166143530 19:40818984-40819006 GAGGAAAGGAAGACAGCAGCTGG + Intronic
1166184024 19:41127794-41127816 GAGGAAAGGAAGACAGCAGCTGG - Intronic
1167195399 19:48024677-48024699 GATGGACAGAAGTCAGAGGCTGG - Intronic
1167389932 19:49188418-49188440 CAGGGATGCAAGTCAGGGGCTGG - Intronic
1167695016 19:51010041-51010063 GAGGGGTGGAAGACAGAGTCAGG + Intergenic
1168147014 19:54425215-54425237 GGAGGGTGGAAGTCAGCGGCGGG + Intronic
924973619 2:153869-153891 GAGGGGTGGAAGTCAGTGGTGGG + Intergenic
924974505 2:160353-160375 GAGGGGTGGAAGTCAGTGGCAGG + Intergenic
925023812 2:592616-592638 GAGAGATGGAAGTCAGCGGCGGG - Intergenic
925385590 2:3459667-3459689 TAGGGAAGGAAGCCAGCTGCAGG + Intronic
925473138 2:4184229-4184251 CAGGGATGGAAGCGTGCGGCTGG + Intergenic
925789583 2:7470467-7470489 GAGAGAAGGAAGTCACCTGCAGG + Intergenic
926863989 2:17339338-17339360 GAAGAATGGAAGTCAGCGGTGGG - Intergenic
926864986 2:17346342-17346364 GAAGAATGGAAGTCAGCAGTGGG - Intergenic
927820323 2:26258547-26258569 GAGGGGTGGAAGTCAACAGCGGG + Intronic
928319124 2:30269293-30269315 GAGGGATGGAAGTCAGCGGCGGG - Intronic
928373009 2:30754780-30754802 GAAGGATGGAAGTAAGTGCCTGG - Intronic
928440103 2:31285123-31285145 GAGGGGTGGAAGTTAGCGGCGGG - Intergenic
928671904 2:33610999-33611021 GAGGGGTGGAAGTCAATGGTGGG + Intergenic
928676633 2:33657574-33657596 GAGGGGTGAAAGTCAGCAGCGGG - Intergenic
929437730 2:41940952-41940974 GTGGGAGGGAAGACAGCGGGTGG + Intronic
929542359 2:42832127-42832149 GAGGGATGGAAGTCAGCGGCGGG - Intergenic
930237656 2:48903280-48903302 GAGGGATGCCAGTAAGAGGCTGG - Intergenic
930454624 2:51590894-51590916 GAGGGATGGAAGTAAGATGCCGG + Intergenic
930485719 2:52008242-52008264 GAGGGGTGGAAGTCAACCGCCGG - Intergenic
930631154 2:53756790-53756812 GAGGGGTAGAAGTCAACAGCGGG - Intronic
931038984 2:58275783-58275805 GACGGATGGAAGTCAGCAGCAGG - Intergenic
932412002 2:71553142-71553164 GAGTGGTGGAGGCCAGCGGCAGG - Exonic
932917177 2:75872086-75872108 GAGGGATAGAAGTCAGTGGCGGG - Intergenic
932918183 2:75879124-75879146 GAGGGATAGAACTCAGCAGTGGG - Intergenic
933175733 2:79170185-79170207 GAGGGATGGGAGTCAGTGGCGGG + Intergenic
933328831 2:80871720-80871742 GAGGGATGGGAGTCAGCAGCGGG - Intergenic
933500207 2:83101797-83101819 GAGGGATGGGAGTCAGCAGCAGG - Intergenic
933556337 2:83835392-83835414 GAGGGATGGAAGTCAGCAGAGGG + Intergenic
933690918 2:85178943-85178965 GATGGATGGAAGAAAGGGGCTGG + Intronic
934662700 2:96151570-96151592 GTGGGATGGAAGTCACTGTCAGG + Intergenic
934672429 2:96223150-96223172 GAGGGGTGGAAGTCAGCAGCAGG + Intergenic
934856075 2:97731232-97731254 GAGCTGTGGAAGTCAGAGGCAGG - Intronic
935748351 2:106209360-106209382 GAGGGGTGGAAGTCAGTAGCAGG - Intergenic
936387735 2:112044815-112044837 GAGGGATGGAAGTCAGTGGCAGG + Intergenic
937594973 2:123661601-123661623 GAGGGGTGGAAGTCAGCAGCAGG - Intergenic
938425214 2:131181150-131181172 CAGGGATGGCTGTCACCGGCAGG + Intronic
939134084 2:138273487-138273509 GAGGGATGGAAATCAGCGGTGGG + Intergenic
939493157 2:142900255-142900277 GAGAGGTGGAAGTCAGTGGTGGG + Intronic
939494105 2:142907468-142907490 GAGGGGTGGGAGTCAATGGCGGG + Intronic
939739126 2:145884537-145884559 AAGGAATGGAAGTTAGAGGCTGG - Intergenic
940669042 2:156645173-156645195 GAGGGATGGGAGTCAGTGGTGGG - Intergenic
941395561 2:164968878-164968900 GAGGAGTGGAAGTCAGCGGCAGG + Intergenic
941763099 2:169266181-169266203 GGGGGAGGGAAGTCAGAAGCTGG + Intronic
942207793 2:173639180-173639202 GAGGGCAGGAAATCAGAGGCAGG + Intergenic
942679489 2:178462568-178462590 GAGGGATGGGAGTCAGCAGCGGG - Intergenic
942830309 2:180232087-180232109 GAGGGGTGGAAGTCAATGGCAGG - Intergenic
942831226 2:180238946-180238968 GAGGGGTGGAAGTCAATGGTGGG - Intergenic
943019258 2:182552933-182552955 GAGGGATGGGAGTCAGCAGCGGG - Intergenic
944039791 2:195339908-195339930 GAGGGGTGGAAGTCAATGGCGGG + Intergenic
944822441 2:203444069-203444091 GAGGGAGGGAAGTGAGGGGAGGG + Exonic
944925422 2:204459078-204459100 GTGGGAGGGAAGTCAGGGTCAGG - Intergenic
945395001 2:209306618-209306640 GAGGGATGGAAGTCAGCGGCCGG - Intergenic
947156244 2:227164836-227164858 GAGGGATGGAAGTGCGGGGGTGG - Intronic
948519899 2:238529370-238529392 GAGGGAAGGAAGTTAGCTGGGGG + Intergenic
1171388065 20:24783522-24783544 GATGGCGGGAAGTCAGCTGCTGG - Intergenic
1171500791 20:25591460-25591482 GAGGGATGGAAGTCAGCGGCAGG + Intergenic
1172777311 20:37415157-37415179 GAGGGCTGGAACTCAGGGGATGG - Intergenic
1172947197 20:38698777-38698799 GAGGGGTGGAAGTCAGCGGCGGG - Intergenic
1173276249 20:41586272-41586294 GAGGGGTGAAAGTCAACGGCGGG - Intronic
1174630623 20:51953861-51953883 GAGGGAGGGAAGTCATCAGAGGG - Intergenic
1175786046 20:61712354-61712376 GAGAGATGGCAGTCAGGGACAGG + Intronic
1175957222 20:62617577-62617599 GAGGGAAGGAGGTCACCTGCAGG - Intergenic
1176413080 21:6459258-6459280 GGGGGAAGGAAGTCAGGGGTCGG - Intergenic
1176856515 21:13979563-13979585 GAGGGATGGAAAACAGCTGAGGG + Intergenic
1177263009 21:18753093-18753115 GAGGGATGGGAGTCAGTGGCAGG + Intergenic
1177263976 21:18760120-18760142 GAGGGATGGGAGTCAGCGGCAGG + Intergenic
1177359357 21:20048617-20048639 GAGGGGTGGAAGTCAGTGGCAGG + Intergenic
1177531192 21:22360117-22360139 GAGGGATGGCAGTCAGCGGTGGG + Intergenic
1177647793 21:23921964-23921986 GAGAGAAGGCAGTTAGCGGCTGG + Intergenic
1177738126 21:25118808-25118830 GAGGGGTGGAAGTCAGCGGCGGG - Intergenic
1177896707 21:26861677-26861699 GAGGGATGGAAGTCAGCGACGGG - Intergenic
1178894064 21:36544225-36544247 GAGGGATGGATGGCAGCAGAGGG - Intronic
1179183055 21:39061744-39061766 GAGGGATGGACGAGAGCAGCTGG + Intergenic
1179259608 21:39746244-39746266 GAGGAATGGAAGTCAGCGGCGGG + Exonic
1179353448 21:40635253-40635275 GAGGGAGGGATGTCAGCAGGAGG + Intronic
1179642910 21:42758926-42758948 GAGGGAAGGAAGCCAGGGGCTGG + Intronic
1179688575 21:43067580-43067602 GGGGGAAGGAAGTCAGGGGTCGG - Intronic
1179981137 21:44896610-44896632 GACGGATGGAAGTGGGCGGTGGG - Intronic
1180466376 22:15615303-15615325 CAGGGATGGCTGTCACCGGCAGG + Intergenic
1180754328 22:18149945-18149967 GAGGGCTGGAAGTCTGGAGCAGG + Exonic
1181666878 22:24404651-24404673 GGGGGAGGGCAGTCAGAGGCCGG - Intronic
1182014999 22:27032189-27032211 GAGCGCTGGGAGTCAGGGGCAGG + Intergenic
1182895802 22:33858255-33858277 GAGGGATGGAAGTCAGCGGCAGG + Intronic
1183628946 22:39021630-39021652 GAGGGAAGGAAGTCCAGGGCTGG - Intronic
1183713501 22:39520443-39520465 GAGGGAGGGAAGGGAGCGGGCGG + Intronic
1183907054 22:41049507-41049529 GAGGGATGCAAGTCACAGGATGG + Intergenic
1184091323 22:42294471-42294493 GAGGCAGGGAAGTCACTGGCAGG + Intronic
1184164119 22:42717423-42717445 GGGAGTTGGAAGTCAGCGGAGGG - Intronic
1184893850 22:47395714-47395736 GAGGGATGGGAGTCTCTGGCTGG - Intergenic
1184993839 22:48188254-48188276 GAGGGATGGGAGGCAGAAGCTGG - Intergenic
949811671 3:8012939-8012961 GAGGGATGGAAGTCAGCCGCGGG + Intergenic
950471107 3:13186954-13186976 GAGGGAAGGAAGTAAGGAGCGGG - Intergenic
950686121 3:14619758-14619780 GTGGGGTGGAAGTCAGAGGTTGG + Intergenic
950709550 3:14804710-14804732 GGGGGAGGGGAGTCAGAGGCTGG - Intergenic
951016253 3:17735778-17735800 GAGGGGTGGAAGTCAGCAGCAGG + Intronic
951200106 3:19867058-19867080 GATGGATGGGAGACAGAGGCAGG + Intergenic
951201170 3:19876441-19876463 GAGGGATGGGAATCAGCAGCAGG + Intergenic
951201175 3:19876459-19876481 GCAGGATGGGAGTCAGCGGCGGG + Intergenic
951326072 3:21303102-21303124 GAGGGATGGAAGTCAGCGGCGGG + Intergenic
951837646 3:27001168-27001190 GAGGGATGGAAGTCAGCGGCGGG - Intergenic
952921714 3:38289749-38289771 GAGGGGTGGAAGTCAGCGGCGGG + Intronic
952922695 3:38296896-38296918 GAGGGGTGGAAGTCAGCGGTGGG + Intronic
953505898 3:43485293-43485315 GAGGTATGGAAGTCAGCAGCGGG - Intronic
953515825 3:43591220-43591242 GAGGGATGGAAGTCAATGGTGGG - Intronic
954680456 3:52343235-52343257 GAGGGAAGGAAGTCAAGGGGCGG + Intronic
955381274 3:58440191-58440213 GAGGGGTGGAAGTCAGCAGCGGG + Intergenic
955687768 3:61562868-61562890 GGGGAATGGAAGTCGGAGGCTGG + Intronic
956096519 3:65722027-65722049 GAGGGAAGGAGGTCAGCAACAGG - Intronic
956564244 3:70617515-70617537 GAGGGATGGAAGTCAGCGGTGGG - Intergenic
957000504 3:74877912-74877934 GAGGGATGGAAGTCAGCAGCGGG + Intergenic
957296908 3:78344238-78344260 GAGGGATGGAAGTCAGTGGCGGG + Intergenic
957557725 3:81782329-81782351 GAGGGGTGGAAGTCAGCAGTGGG - Intergenic
957687045 3:83515320-83515342 GAGGGATGGAAGTCAGCGGCAGG - Intergenic
957741657 3:84278643-84278665 GAAGGATGGAAGCCAACAGCTGG + Intergenic
958424505 3:93965303-93965325 GAGGGATGGGAGTCAGCAGCGGG - Intronic
958457047 3:94345285-94345307 GAGCGGTGGAAGTCAGCAGCAGG + Intergenic
958629245 3:96666801-96666823 GAGGGATGGTAGTCAGCAGCGGG + Intergenic
958630366 3:96675019-96675041 GAGGGATGTAAGTCAGCAGCGGG + Intergenic
959161772 3:102732787-102732809 GAGGGATGGAAGTCAGTGGCGGG + Intergenic
959304410 3:104642431-104642453 GAAGGATGGGTGTCAGAGGCTGG + Intergenic
959406345 3:105966194-105966216 GAAGGGTGGAAGTCAGTGGCAGG - Intergenic
959450013 3:106487173-106487195 GAAGAATGGAAGTCAGCGGCGGG + Intergenic
959885717 3:111497371-111497393 GAGGGATGAAAGTCAACGGCAGG + Intronic
960006985 3:112790744-112790766 GAGGGGTGGAAGACAGCGTCAGG + Intronic
960540900 3:118861379-118861401 GAGGGATGGTTATCAGAGGCTGG - Intergenic
961490595 3:127254399-127254421 CAGGGAAGGAAGTGAGCGGAGGG - Intergenic
962311709 3:134331510-134331532 CAGGGATGGAACTCTGCTGCAGG - Intergenic
963024090 3:140901177-140901199 GAAGGGTGGAAGTCAGCGGTGGG - Intergenic
963255683 3:143142517-143142539 GAGGGGTGGAAGTCAGCGGCAGG - Intergenic
963575888 3:147060182-147060204 GAGGGATGGAAGTCAGCGGCAGG - Intergenic
963915313 3:150854403-150854425 GAGGGATGGAAGTCAGCGGCAGG - Intergenic
964706175 3:159621079-159621101 ATGGGAAGGAAATCAGCGGCAGG + Intronic
964980018 3:162667030-162667052 GAGGGGTGGAAGTCAGCGGCGGG + Intergenic
965342132 3:167503677-167503699 GAGGGATGGAAGTCAGCGGTGGG + Intronic
966353270 3:179054751-179054773 GAGGCATGGAAGTCGCCGGCGGG - Intronic
966994308 3:185265045-185265067 GAGGGGTGGGAGTCAACAGCGGG - Intronic
967191704 3:186990595-186990617 GAGGGATGGGAGAAGGCGGCTGG - Intronic
967389160 3:188938553-188938575 GGGGGATGGAAGTCAGCGGTGGG + Intergenic
967623101 3:191658941-191658963 GAGGGATGGAGGTCAGTGGTGGG - Intergenic
967825477 3:193873912-193873934 GAGGCATGGCAGTCAGAGGGAGG + Intergenic
968390872 4:192113-192135 GAAGGTTGGAAGTCAGTGGTGGG + Intergenic
968756328 4:2418146-2418168 GAGGGAAGGATGTCGGCGGTGGG + Intronic
969162620 4:5274827-5274849 GAGGGATGAAAGTCAGCGGCGGG - Intronic
969644663 4:8420775-8420797 GAGGGGTGGAAGTCAGTGGTGGG - Intronic
970095528 4:12459578-12459600 CAGGGATGGAAGTCTGCGGCGGG - Intergenic
970738111 4:19198109-19198131 GAGGGATGGAAGTCAGCGGCAGG + Intergenic
971980352 4:33742977-33742999 GAAGAATGGAAGTCAGTGGTGGG - Intergenic
972148600 4:36061368-36061390 GAAGGATGGCAGCCAGAGGCTGG - Intronic
972766770 4:42158538-42158560 GAGGGATGGAAGTCAGTGGCAGG + Intergenic
973205069 4:47550818-47550840 CAGGGGTGGAAGTCAGCGGCGGG + Intronic
973245874 4:48010807-48010829 GAGGGATGGAAGTCAGCAGCAGG + Intronic
973279567 4:48344289-48344311 AGGGGATGGATGTCAGTGGCAGG + Intronic
974190092 4:58493391-58493413 GAGGGATGGAAGTCAGCGGCGGG + Intergenic
974190482 4:58496522-58496544 GAGGGGTGGAAGTCAACAGCGGG + Intergenic
974487284 4:62522461-62522483 GAGGGGTAGAAGTCAGCTGCGGG - Intergenic
974487849 4:62526865-62526887 GAGGGATGGAAGTCAGTGGCAGG + Intergenic
975313225 4:72925995-72926017 GAGGGATGGAAGTCAGCAGCGGG + Intergenic
976515226 4:85956769-85956791 CCAGGGTGGAAGTCAGCGGCAGG + Intronic
976963621 4:91009098-91009120 GAGGGATGGAAGTCAGGGGCGGG + Intronic
977618435 4:99109787-99109809 GAGTGGTGGAAGTCAACAGCGGG + Intergenic
978587026 4:110284270-110284292 GAGGGATGGAAGTCAGCGGTGGG + Intergenic
978618034 4:110615006-110615028 GAGGGATGGAAGGGGGTGGCGGG + Intergenic
978909021 4:114044530-114044552 GAGGGATGGAAGTCAGCGGTGGG - Intergenic
979136005 4:117113867-117113889 GAGGGATAGAAGTCAGCGGCAGG + Intergenic
979910832 4:126363704-126363726 GAGGGATGGAAGTCAGTGGTAGG - Intergenic
980190522 4:129519357-129519379 GAGGGATGGAAGTCGGCAGCAGG - Intergenic
980443821 4:132882447-132882469 GAGGGGTAGAAGTCAGTGGCGGG - Intergenic
980523652 4:133961745-133961767 GAGGGGTGGAAGTCAACGGCGGG - Intergenic
980625716 4:135372330-135372352 GAGGGATGGAAGTCAGGGGCGGG - Intergenic
980683939 4:136201399-136201421 GAAGGATGGAAGCCAGCCGAGGG - Intergenic
980790433 4:137613300-137613322 CAGGGATGGAAGTCAGCGGCGGG - Intergenic
980871968 4:138622106-138622128 GAGGGGTGGAAGTCAGTGGCAGG + Intergenic
981740759 4:147999466-147999488 GAGGGATGGAAGTCAGTGGTGGG - Intronic
981823745 4:148915622-148915644 GGGGAGTGGAAGTCAGTGGCGGG - Intergenic
982332114 4:154192501-154192523 GAGGGGTAGAAGTCAATGGCGGG - Intergenic
982978787 4:162104100-162104122 GAGGGATGGAAGTCAGCAGTGGG - Intronic
983387418 4:167082813-167082835 GAGGGAGGGAAGACAGAGGGAGG + Intronic
983777796 4:171629912-171629934 GAGGGATGGAAGTCAGCGGCGGG - Intergenic
984257774 4:177408263-177408285 GGAGGGTGGAAGTCAGTGGCGGG + Intergenic
984280667 4:177666612-177666634 GAGGGGTGGAAGTCAATGGCGGG + Intergenic
984812889 4:183810486-183810508 GCTGGGTGGAAGTCAGTGGCTGG + Intergenic
985226358 4:187765549-187765571 GAGGGATGGGAGTCAGCAGCGGG - Intergenic
986492616 5:8307816-8307838 GAGGTGTGGAAGTCAACGGTAGG + Intergenic
986918839 5:12660732-12660754 GAGGGATGGAACTCAGCAGCGGG + Intergenic
987129613 5:14848552-14848574 GAGGGGTGGAAGTCAGCGGCGGG - Intronic
987508228 5:18800456-18800478 GAGGGATGGAAGTCAGCAGCGGG - Intergenic
987761181 5:22164453-22164475 GAGGGATGGAAGTCAGCGGAGGG + Intronic
987855127 5:23411332-23411354 GAGGGGTGGAAGTCAGTGATGGG - Intergenic
987905352 5:24069399-24069421 GAGGGGTGGAAGTCAGTGGCAGG - Intronic
987934904 5:24451259-24451281 GAGGGGTGGAAGTCAGCAATGGG + Intergenic
987934916 5:24451326-24451348 GAGGGGTGGAAGTCAGCGGAGGG + Intergenic
988047864 5:25981211-25981233 GAGGGGTGGAAGTGAGGGGAGGG + Intergenic
988182551 5:27816283-27816305 GAGGGGTGGAAGTCAATGGCTGG + Intergenic
988881478 5:35508160-35508182 GAGGGGTGGAAGTCAACAGCGGG - Intergenic
988957395 5:36332948-36332970 GAAGGATGGAAGTCAGCGGCGGG + Intergenic
989688013 5:44111494-44111516 GAGGGATGGAAGTCAGCAGTGGG - Intergenic
989688431 5:44114703-44114725 AAGGGATGGAAGTCAGCAGCGGG - Intergenic
989717701 5:44483524-44483546 GAGGGGTGGAAGTCAGCAGCAGG - Intergenic
990465964 5:56071703-56071725 CAGGGCTGGAAGGCAGCGCCTGG + Intergenic
990478806 5:56187573-56187595 GAGGGATAGAAGTCAGCGGCGGG - Intronic
990741375 5:58915952-58915974 GAGGGATAGAAGTCAGCGGCGGG - Intergenic
990891811 5:60658903-60658925 GAGGGGTGGAAGTCAGTGGCCGG - Intronic
991013925 5:61911800-61911822 GAGAGATGGAAGTCAGAGAATGG - Intergenic
991290615 5:65030888-65030910 GACGGATGGAAGTCAGTGGCGGG - Intergenic
991660879 5:68949658-68949680 GAGGGGTGGAGGTCAGAGGATGG - Intergenic
991895971 5:71397907-71397929 GAGGGATGGAAGTCAGCGGAGGG + Intergenic
992093478 5:73339543-73339565 GAGAGAGGGAAGACAGCAGCAGG - Intergenic
992116176 5:73540505-73540527 GAGGGAGGGAGGAAAGCGGCAGG + Intergenic
993004464 5:82415594-82415616 GTGGGAAGGAAGTAAGAGGCAGG + Intergenic
993054986 5:82970956-82970978 GAGGGATGGAAGTCAGCAGCGGG + Intergenic
993225637 5:85165322-85165344 GCAGGATGGGAGTCAGCAGCGGG - Intergenic
993225641 5:85165340-85165362 GCAGGATGGGAGTCAGCGGCAGG - Intergenic
993225645 5:85165358-85165380 GAGGGATGGGAGTCAGCGGCAGG - Intergenic
993305769 5:86272989-86273011 GAGGGATGGAAGTCAGCCATGGG + Intergenic
993460759 5:88177698-88177720 GAGGGATGGGAGTCAGGGGCGGG + Intergenic
993590951 5:89794663-89794685 GAGGGATGGAAGTCAGTGGCGGG - Intergenic
993941854 5:94068360-94068382 GAGGGGTGGAAGTCAGTGGCAGG + Intronic
993982339 5:94557924-94557946 GAGGGATGGAAGTTAGCAGCGGG - Intronic
995125592 5:108574457-108574479 GAGGGATGGAAGTCAGTGGCAGG + Intergenic
995465168 5:112444103-112444125 GATGGATGGAAGTCAGCGGCGGG - Intergenic
995466154 5:112451125-112451147 GAGGGATGGAAGTCAGCGGTGGG - Intergenic
995785080 5:115819058-115819080 GAGGGGTGGAAGTCGGTGGCGGG + Intergenic
996128273 5:119751557-119751579 GAGGGATGGAAGTCGGTGGCGGG - Intergenic
996939811 5:128990910-128990932 GAGGGGTGGAAGTCAGCAGCGGG + Intronic
998395774 5:141816913-141816935 GAAGGAGGGAAGGCAGCGGGTGG - Intergenic
998429635 5:142059964-142059986 GAGGGATGGGAGGCAGTGGTAGG - Intergenic
998449381 5:142222605-142222627 GAGAGGTGGAAGTGAGCAGCAGG + Intergenic
998644317 5:144045566-144045588 GAGGGATGGAAGTCAGTGGCGGG - Intergenic
1000095453 5:157967402-157967424 GAGGGATGGAAGTCAGCGGCGGG - Intergenic
1001429040 5:171645219-171645241 GAAGGCTGGAAGTGAGCCGCAGG + Intergenic
1001597155 5:172905666-172905688 GAGGGGTGGAAGTCAGCGGTGGG + Intronic
1001897866 5:175396970-175396992 GAGGGATGGAAAAGAGAGGCTGG + Intergenic
1002647533 5:180668047-180668069 TAAGGATGGAAGTCAGGGGCCGG + Intergenic
1002827268 6:785021-785043 GAGGGATGGTACTCAGAGCCCGG - Intergenic
1004007313 6:11649069-11649091 GAGGGGTGGAAGTCAGAGGCGGG - Intergenic
1004256413 6:14068840-14068862 GAGGGATGGAAGTCAGCGGCGGG - Intergenic
1004306761 6:14508323-14508345 GAGGGATGGGAATCAGCTGGTGG - Intergenic
1005324137 6:24682644-24682666 GAGGGATGGGAGTCAGTGGTGGG + Intronic
1005816658 6:29558618-29558640 GAGGGATGGAAGTCAGCCGCGGG - Intronic
1006593348 6:35174113-35174135 GAGGCAAGGAAGGCAGGGGCAGG + Intergenic
1007011954 6:38426555-38426577 GAAGAATGGAAGTCAGCGGTGGG - Intronic
1007018686 6:38496679-38496701 GAGAGATGGAAATCAGCTTCAGG + Intronic
1007763282 6:44146780-44146802 CATGGATGAAAGTCAGGGGCAGG + Intronic
1008582773 6:52921485-52921507 GAGGTATGGAAGTCAGTGGCGGG + Intergenic
1009023934 6:57974996-57975018 GATGGGTGGAAGTCAGTGGCGGG - Intergenic
1009199506 6:60726535-60726557 GATGGGAGGAAGTCACCGGCGGG - Intergenic
1009519546 6:64664042-64664064 GAGGGATGGAAGTAAGCGGCAGG + Intronic
1009544325 6:65005142-65005164 AAGGGATGGAAGTCAGCAGCTGG - Intronic
1009702461 6:67201746-67201768 GAGGGGTGGAAGTCAGCGGTGGG - Intergenic
1009885208 6:69617057-69617079 GAGGGGTTGAAGTCAGCGGCAGG - Intergenic
1010893020 6:81337361-81337383 GAAGAATGGAAGTCAGCGGTGGG - Intergenic
1010895029 6:81351510-81351532 GAAGAATGGAAGTCAGCGGCGGG - Intergenic
1011076389 6:83443912-83443934 GAGGGGTGAAAGTCAGTGGCAGG - Intergenic
1011189086 6:84712035-84712057 GAGGGGTGGAAGTCAATGGCGGG + Intronic
1011190320 6:84720722-84720744 GAGGGGTGGAAGTCAACGGTGGG + Intronic
1011540390 6:88421327-88421349 GAGGGATGGGTGTCAGCGGCGGG + Intergenic
1012120018 6:95354762-95354784 GAGGGGTGGAAGTCAGTGGCAGG - Intergenic
1012734538 6:102921670-102921692 GAGGGATGGAAGTCAGTAGTGGG + Intergenic
1013021759 6:106228287-106228309 GAGGGATGGAAGTCAGTGGCAGG - Intronic
1013410509 6:109879632-109879654 GAGGGGTGGAAGTCAGTGGCAGG - Intergenic
1013543075 6:111131170-111131192 GAGGGGTGGAAGTCAGCGGCGGG - Intronic
1014208915 6:118687785-118687807 GAGGGATGGAAGTCAGTCGTGGG - Intronic
1014243341 6:119041690-119041712 GAGGGGTGGAAGTCAGCGGCGGG - Intronic
1015632767 6:135247977-135247999 GAGGGGTGGAAGTCAGTGGTGGG - Intergenic
1016343649 6:143087535-143087557 GAGGGATGGAAGTCAGCGGCGGG + Intronic
1016444924 6:144121391-144121413 GAGGGGTGGAAGTCAGCGGTGGG + Intergenic
1017869004 6:158470213-158470235 GAGGGATGGGAGTCAGCGGCGGG + Intronic
1018176484 6:161182707-161182729 GAGGGTGGGCAGCCAGCGGCTGG + Intronic
1018760552 6:166891225-166891247 GAGGGATGGAAGTCAGCGGCGGG - Intronic
1020080049 7:5282276-5282298 GAGGGAGGGAAGACAGAGGGAGG + Intronic
1020906209 7:14067243-14067265 GAGGGATGGAAGTCAGAGGCGGG - Intergenic
1021347788 7:19548815-19548837 GAGTGATGGGAGACAGTGGCAGG + Intergenic
1021574424 7:22094269-22094291 GAGAGAGGGAAGGCAGTGGCAGG + Intergenic
1021885339 7:25131920-25131942 GAGGGATGGAAGTCAGCGGCGGG + Intergenic
1022117657 7:27276498-27276520 GAGGGATGGAAGTCAGTGGCAGG - Intergenic
1022989917 7:35696672-35696694 GAGGGATGGAAGTCAGCTGTGGG - Intergenic
1023094791 7:36649790-36649812 AAGAGATGGAAGTTAGCGGTAGG - Intronic
1023282930 7:38590352-38590374 GAGGGGTAGAAGTCAGCAGCGGG + Intronic
1023439000 7:40167789-40167811 GAGGGGTGGAAGTCAGCGGCGGG + Intronic
1023439772 7:40173335-40173357 GAGGGGTGGAAGTCAGCGGCGGG + Intronic
1023733134 7:43210811-43210833 GAGGGGTGGAAGTCAGTAGTGGG + Intronic
1024148016 7:46536751-46536773 AAGGGAGGGAAGTCAGCGGCGGG + Intergenic
1024318650 7:48044199-48044221 GAGAGGTGGAAATTAGCGGCGGG + Intronic
1024841685 7:53594123-53594145 GAGGGATGAAAGTGAGTGGCTGG + Intergenic
1025716576 7:63962606-63962628 GAGGGATGGGAGTCAGTGGCGGG + Intergenic
1025716580 7:63962624-63962646 GCGGGATGGGAGTCAGCGGCAGG + Intergenic
1026213084 7:68324142-68324164 GAGGGATGGGAGTCAGCAGCAGG - Intergenic
1026300177 7:69090836-69090858 GAGGGAGGGAAGGTAGCGGAGGG + Intergenic
1026346973 7:69482838-69482860 GAGGGGTGGAAGTCAGCTGTGGG - Intergenic
1028013988 7:85684138-85684160 GAGGGATGGAAGTCAGCTGCGGG - Intergenic
1028587725 7:92468278-92468300 GAGGGATGGGAGTCAGCGGCGGG + Intergenic
1028589087 7:92477765-92477787 GAGGGATGGGAGTCAGCGGCAGG + Intronic
1028926150 7:96358690-96358712 GAGGGGTGGAAGTCAGCGGCGGG + Intergenic
1028993390 7:97074823-97074845 GAGGGATGGAAGTCAGCAGCAGG - Intergenic
1029015971 7:97315964-97315986 GAGGGATGGAAGTCAGTGGCGGG - Intergenic
1029225273 7:99022458-99022480 GAGCCATGGAAGGCAGTGGCAGG + Intergenic
1030208394 7:106972746-106972768 GAGGGGTGAAAGTCAGTGGCGGG + Intergenic
1030336809 7:108337437-108337459 GAGGGATGGAAGTCAGCAGTGGG - Intronic
1030431257 7:109452210-109452232 GAGGGGTGGAAGTCAGAGGTGGG - Intergenic
1030661151 7:112221066-112221088 GAAGGGTGGAAGTCAGCGGCGGG - Intronic
1030843981 7:114386128-114386150 GAGGGATGGGAGTCGGCGGTGGG + Intronic
1031250874 7:119378923-119378945 GAGGGGTGGAAGTCAGCAGCGGG + Intergenic
1031299575 7:120047497-120047519 GAGGGATGGAAGGCAGTGGCGGG - Intergenic
1031472000 7:122177222-122177244 GAGGGGTGGAAGTCAGTGGCGGG - Intergenic
1031742824 7:125455912-125455934 GAGGGATGGAAGTCAGCAGCGGG + Intergenic
1032653845 7:133906717-133906739 GAGGGATGGAAGTCAGCGGTGGG - Intronic
1033355507 7:140595846-140595868 GGAGGATGGAAGTCAGCGCGTGG - Intronic
1033444259 7:141406230-141406252 GAGAGATGGAAGCCAGAGCCAGG - Intronic
1034248769 7:149671728-149671750 GAGGGGTGGAAGTCAGTGGCAGG - Intergenic
1034249497 7:149676848-149676870 GAAGGGTGGAAGTCAACGGCGGG - Intergenic
1034633019 7:152545368-152545390 GAGGCAGGGAAGCCAGAGGCAGG + Intergenic
1034650843 7:152688834-152688856 GAGGGATGGAAGTCAGTGGCGGG + Intergenic
1034707077 7:153155177-153155199 GAGGGGTGGAAGTCAGTGGTGGG + Intergenic
1034965010 7:155385379-155385401 GAGGGATGGAAGTCGGCGGCGGG + Intronic
1035670437 8:1412897-1412919 GAGGGAGGGAAGTCAGAGACAGG - Intergenic
1037123416 8:15316968-15316990 GAGGAATGGAAGTCAACAGCAGG + Intergenic
1037379957 8:18274629-18274651 GAGGGGTGGAAGTCAACGGTGGG + Intergenic
1037570605 8:20154867-20154889 GAGGGGTGGAAGTCAATGGTGGG - Intronic
1037648689 8:20817033-20817055 GAGGGATGGATGTCAGTGGCGGG + Intergenic
1037739883 8:21600112-21600134 AAGGGAGGGAAGTCAGAGGTGGG + Intergenic
1038688961 8:29743720-29743742 GAGAGATGGATGGCAGCTGCTGG + Intergenic
1039604316 8:38868051-38868073 GAGGGGTGGAAGTCAGCGATGGG + Intergenic
1039786069 8:40835122-40835144 GAGGGATGAAAGTGAGTGACAGG + Intronic
1040541216 8:48357727-48357749 GTGGGATGGGGGTCAGTGGCAGG + Intergenic
1040768451 8:50944274-50944296 GAGGGGTGGAAGTCAGCAGCGGG + Intergenic
1041664093 8:60425345-60425367 GAGGGGTGGAAGTCAGTGATGGG + Intergenic
1041741913 8:61165211-61165233 GAAGAATGGAAGTCAGCGGCGGG + Intronic
1042055656 8:64763108-64763130 GAGGGGTGGAAGTCAGTGGCGGG - Intronic
1042292929 8:67188686-67188708 GAGGGGTGGAAGTCAGTGGCAGG - Intronic
1042307048 8:67343405-67343427 GAGGCGTGGAGGGCAGCGGCAGG + Exonic
1043451110 8:80367550-80367572 GTGGGATGGAAGACAGCTTCAGG + Intergenic
1044988291 8:97774170-97774192 GAGGGGTGGAAGTCAACGGCGGG + Intergenic
1045657593 8:104403147-104403169 GAGAGATGGAAGTCAGCAGTAGG - Intronic
1045660750 8:104435246-104435268 GGGTGATAGAAGTCAGGGGCTGG + Intronic
1045664324 8:104468959-104468981 GAGGGGTGGAAGTCAGCGGCGGG - Intergenic
1045863514 8:106839363-106839385 GAGGGGTGGGAGTCAATGGCAGG + Intergenic
1046504366 8:115117892-115117914 GAGGAATGGGAGTTAGCGGGTGG - Intergenic
1047097367 8:121639841-121639863 GTGGGAGGGAAGCCAGAGGCTGG - Intronic
1047276654 8:123410794-123410816 GAGGGATAGAAGTCAGTGGCGGG - Intronic
1047599744 8:126413939-126413961 GAGGGGTGGAAGTCAGTGGTGGG + Intergenic
1047618314 8:126581354-126581376 GAGGGGTGGAAGTCAGCAGCGGG - Intergenic
1047626838 8:126665323-126665345 GAGGGCTGGAATTCAGTGACTGG + Intergenic
1048100256 8:131343199-131343221 GAAGGGTGGAAGTCAGTGGCAGG + Intergenic
1048631494 8:136247678-136247700 GAGGGGTGGAAGTCAGCGGAAGG - Intergenic
1049306344 8:141906304-141906326 GAGGAATGGAAGCCAGCGCACGG + Intergenic
1049664508 8:143837003-143837025 GAGGGATGGCACTGAGCAGCAGG + Intronic
1050116057 9:2264574-2264596 GAGGGGTGGAAGTCAGCAGTGGG + Intergenic
1050593501 9:7183574-7183596 GAGGGATGGAAGTCAGTGGTGGG - Intergenic
1051699192 9:19801389-19801411 GAGGGATGGAAGTCAGCGGCGGG + Intergenic
1051970174 9:22878044-22878066 GAGGGATGGAAGTCAGCGGCAGG + Intergenic
1052812140 9:33070847-33070869 GAAGGATGGTTGTCAGAGGCTGG + Intronic
1053134331 9:35640634-35640656 GAGGGATGGGAGTCAGCAGCAGG + Intronic
1053134335 9:35640652-35640674 GCAGGATGGGAGTCAGCGGCAGG + Intronic
1053215193 9:36265042-36265064 GAGGGGTGGAAGTCAGCGGCGGG - Intronic
1054986163 9:71264028-71264050 GAGGTTTGGAAGACAGAGGCAGG - Intronic
1055049595 9:71965005-71965027 GAGGGATGGAAGTCAGTGGTGGG + Intronic
1055431340 9:76247191-76247213 GAGGGATGGAAGTCAGCGGCAGG + Intronic
1055455698 9:76469638-76469660 GAGGGATGGAAGTCAGTGGCAGG - Intronic
1055529647 9:77171235-77171257 GAGGGAAAGAAATCAGAGGCAGG + Intergenic
1055789839 9:79911930-79911952 GAGGTGGGGAAGTCAGCGGCGGG + Intergenic
1056449704 9:86705006-86705028 GAGGGAAGGAAGTCACAGGGAGG - Intergenic
1056452458 9:86729322-86729344 AAGGTATGGAACTCAGCGCCAGG - Intergenic
1056705012 9:88944250-88944272 GAGGGATGGAAGTCAGCGGTGGG + Intergenic
1057546303 9:96022014-96022036 GAGGAAGGGAAGGCAGCTGCAGG - Intergenic
1058231954 9:102436794-102436816 GAGGGATGGAAGTCAGCGGTGGG + Intergenic
1060886877 9:127160694-127160716 GGGGGCTGGAAGTCATTGGCTGG - Intronic
1061079894 9:128363671-128363693 GAGGGCTGGAAGTCCAGGGCAGG + Intergenic
1061220573 9:129248161-129248183 GAGGGATGGAAGTGAGGGTGTGG + Intergenic
1061941786 9:133887777-133887799 GGGGGATGGGAGGCAGAGGCAGG - Intronic
1062226688 9:135456361-135456383 GAGGGATGGAGGTGAGAGGAGGG + Intergenic
1186254534 X:7703894-7703916 GAGGGATGGAAGTCAGCAGTGGG + Intergenic
1187038765 X:15570653-15570675 GAGGAATGGAAGTCAGGGTGTGG + Intronic
1187613820 X:20971887-20971909 GAGGGATGGAAGTCAGCAGCGGG - Intergenic
1187629887 X:21157386-21157408 AAGAGGTGGAAGTCAGCTGCGGG - Intergenic
1188285586 X:28322518-28322540 GAGGGGTGGAAGTCAACGGCGGG - Intergenic
1188809573 X:34636277-34636299 CAGAGATGGAAATCAGCTGCAGG + Intronic
1189152095 X:38719480-38719502 GAGGGTTGGAAGTCAATGGTGGG + Intergenic
1189954275 X:46261970-46261992 GAGGGATGGAAGTCAGCGGTGGG + Intergenic
1190234461 X:48605045-48605067 GTGGGATGGAGGACAGCAGCAGG - Exonic
1190240562 X:48654933-48654955 GAGGGATGGAAGTCAATGGCGGG - Intergenic
1190368106 X:49716703-49716725 GAGGGGTGGAAGTCAGTGGTGGG - Intergenic
1192571977 X:72213571-72213593 GAGGGGTGGAAGTCAGCGATGGG - Intronic
1192803107 X:74485853-74485875 GAGGGGTGGAAGTCAGAAGTGGG + Intronic
1192940369 X:75904900-75904922 GAGGGATGGAAGTCAGTGGCGGG + Intergenic
1192961001 X:76130770-76130792 GAGGGGTGGAAGTCAGCAGTGGG - Intergenic
1193172384 X:78350342-78350364 GAGGGGAGGAAGTCAGCAGCGGG + Intergenic
1193295493 X:79827537-79827559 GAGGGATGGAAGTCAGCGGCGGG + Intergenic
1193306254 X:79956069-79956091 GAGGCATGGGAGTCAGTGGCAGG - Intergenic
1194103278 X:89734556-89734578 GAGGGATGGAAGTCAGCGGCTGG + Intergenic
1194154504 X:90370269-90370291 GAGAGATGGAAGTCAGTGGTGGG + Intergenic
1194445399 X:93981461-93981483 GAGTGATGGAAGTCAGCGGCGGG + Intergenic
1195256574 X:103096805-103096827 GAGGGGTGGAAGTCAGCAGCGGG - Intergenic
1195259086 X:103115371-103115393 GAGGGGTAGAAGTCAGCAGCGGG + Intergenic
1195505080 X:105647204-105647226 GAGGGGTGGAAGCCAGCGATGGG + Intronic
1195584606 X:106551422-106551444 GAGGGATGGAAGTCAGCGGCAGG - Intergenic
1196258168 X:113547172-113547194 GAGCGATGGAAGTCAACGGCAGG + Intergenic
1196287276 X:113897440-113897462 GAGGGATGGGAGTCAGCAGCAGG + Intergenic
1196410351 X:115411921-115411943 GAGGGAATGAAGTAAGCAGCTGG - Intergenic
1196772524 X:119309125-119309147 GAGGGATGGAAGTCAGTGGCGGG + Intergenic
1196993635 X:121356653-121356675 GAGGGGTGAAAGTCAGTGGCGGG - Intergenic
1197545326 X:127816573-127816595 GAGGGATGGAAGTCAGCGGTGGG + Intergenic
1197999715 X:132420316-132420338 GAGGGGTGGAAGTCAGCGGCGGG + Intronic
1198566838 X:137913880-137913902 GAGGGATGGAAGTCAGCGGCGGG + Intergenic
1198862333 X:141084378-141084400 GAGGAGTGGAAGTCAATGGCGGG - Intergenic
1198900361 X:141503008-141503030 GAGGAGTGGAAGTCAATGGCGGG + Intergenic
1199078316 X:143549030-143549052 GAGGGATGGAAGGAAGTGGTAGG - Intergenic
1199268784 X:145858474-145858496 GAGGGATGGAAGTCAGCGGCGGG + Intergenic
1199368805 X:147020916-147020938 GCGGGATGGGAGTCAGCAGCGGG - Intergenic
1199368809 X:147020934-147020956 GAGGGATGGGAGTCAGCGGCGGG - Intergenic
1199432077 X:147773198-147773220 GAAGAATGGAAGTCAGCGGCGGG - Intergenic
1199536302 X:148906802-148906824 GAGGGGTGGAAGTCAAGGGCAGG - Intronic
1200037734 X:153344320-153344342 GAGGGTAGGAAGGCAGCAGCTGG - Intronic
1200061416 X:153485441-153485463 GAGGGAAGGAAGTGAGTGGGAGG + Intronic
1200179604 X:154142381-154142403 GAGGAATGGAAGGCAGGGTCTGG - Intergenic
1200500857 Y:3947162-3947184 GAGAGATGGAAGTCAGTGGTGGG + Intergenic
1200546753 Y:4527353-4527375 GACGGATGGAAGTCAGCGGTGGG + Intergenic
1200762685 Y:7054615-7054637 GAGGGATGGAAGTCAGCGGTAGG - Intronic
1200851262 Y:7886377-7886399 GAGGGGTGGAAGTCAGTGGCTGG + Intergenic
1201329232 Y:12800034-12800056 GAGGGGTGGAAGTCAATGGTGGG - Intronic
1201421476 Y:13804575-13804597 GAGGGGTGGAAGTCAGTGGAGGG - Intergenic
1201642243 Y:16192170-16192192 GAGGGGTGGAAGTCAGTGGCAGG + Intergenic
1201660572 Y:16393151-16393173 GAGGGGTGGAAGTCAGTGGCAGG - Intergenic
1201723818 Y:17133006-17133028 GAGGGTTGGAAGTCAGTGCCAGG + Intergenic
1201905230 Y:19080347-19080369 GAGGGATGGAAGTCAGTGGCGGG - Intergenic
1201906114 Y:19087143-19087165 GAGGGGTGTAAGTCAGTGGTGGG - Intergenic
1201962281 Y:19694682-19694704 GAGGGGTGGGAGTCAACGGTGGG + Intergenic