ID: 1126728340

View in Genome Browser
Species Human (GRCh38)
Location 15:51655610-51655632
Sequence GGAAGTCAGCGGCAGGTCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126728335_1126728340 -3 Left 1126728335 15:51655590-51655612 CCTGCCGGATCCGGAGGGATGGA No data
Right 1126728340 15:51655610-51655632 GGAAGTCAGCGGCAGGTCTGTGG No data
1126728328_1126728340 26 Left 1126728328 15:51655561-51655583 CCTCACTGGATCAGGAGCACAGC 0: 47
1: 109
2: 121
3: 106
4: 223
Right 1126728340 15:51655610-51655632 GGAAGTCAGCGGCAGGTCTGTGG No data
1126728333_1126728340 -2 Left 1126728333 15:51655589-51655611 CCCTGCCGGATCCGGAGGGATGG No data
Right 1126728340 15:51655610-51655632 GGAAGTCAGCGGCAGGTCTGTGG No data
1126728336_1126728340 -7 Left 1126728336 15:51655594-51655616 CCGGATCCGGAGGGATGGAAGTC No data
Right 1126728340 15:51655610-51655632 GGAAGTCAGCGGCAGGTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126728340 Original CRISPR GGAAGTCAGCGGCAGGTCTG TGG Intergenic
No off target data available for this crispr