ID: 1126728345

View in Genome Browser
Species Human (GRCh38)
Location 15:51655636-51655658
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126728335_1126728345 23 Left 1126728335 15:51655590-51655612 CCTGCCGGATCCGGAGGGATGGA No data
Right 1126728345 15:51655636-51655658 CGGCAAACAGCAATGGTGGACGG No data
1126728333_1126728345 24 Left 1126728333 15:51655589-51655611 CCCTGCCGGATCCGGAGGGATGG No data
Right 1126728345 15:51655636-51655658 CGGCAAACAGCAATGGTGGACGG No data
1126728336_1126728345 19 Left 1126728336 15:51655594-51655616 CCGGATCCGGAGGGATGGAAGTC No data
Right 1126728345 15:51655636-51655658 CGGCAAACAGCAATGGTGGACGG No data
1126728338_1126728345 13 Left 1126728338 15:51655600-51655622 CCGGAGGGATGGAAGTCAGCGGC 0: 22
1: 88
2: 109
3: 75
4: 146
Right 1126728345 15:51655636-51655658 CGGCAAACAGCAATGGTGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126728345 Original CRISPR CGGCAAACAGCAATGGTGGA CGG Intergenic
No off target data available for this crispr