ID: 1126732963

View in Genome Browser
Species Human (GRCh38)
Location 15:51702999-51703021
Sequence GGGTCAGTGCTCTCTTGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 140}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126732963 Original CRISPR GGGTCAGTGCTCTCTTGGGT GGG Intronic
900186228 1:1334512-1334534 GGGTCATTGCTGGCTTGGGGGGG - Exonic
902651595 1:17841137-17841159 GGGTGAGTGCACTCTGGGCTTGG + Intergenic
911464425 1:98233703-98233725 AGGTCAGTGCCCTCCTGGGATGG + Intergenic
912541259 1:110417671-110417693 GGGACAGAGCTCTCCTGGTTGGG + Intergenic
915585774 1:156843153-156843175 GGGCCAGGGCTCTTTTGGGATGG - Exonic
917683871 1:177396112-177396134 GGGGCAGAGCTCTCTAGGCTGGG + Intergenic
923652545 1:235887622-235887644 GGGTAAATCCTCTCTTTGGTTGG + Intergenic
1066184966 10:33000999-33001021 GGTCCAGTGCTTTCTTTGGTTGG + Intronic
1068738407 10:60440668-60440690 GGGTCAGTGAATCCTTGGGTGGG - Intronic
1069879344 10:71581899-71581921 AGTTCAGTGCTCTGTTGGGGGGG - Intronic
1071565225 10:86668193-86668215 GGGGCTGAGCTCCCTTGGGTAGG - Intergenic
1075139489 10:119818573-119818595 GGGTCTGTGCCCTCGTTGGTAGG + Intronic
1075587394 10:123667673-123667695 TGGACAGTGCTCTCTGGGGAGGG - Intronic
1076465520 10:130678725-130678747 GGTTCAGTGCATTCTTGGCTGGG + Intergenic
1076579928 10:131500492-131500514 GGTCCTGTGCTCTCTTGGCTGGG + Intergenic
1076686924 10:132202375-132202397 GGGTCACTTCTCCCTTGGCTAGG - Intronic
1077084601 11:742697-742719 TGGGCAGTGCTCCCTTTGGTGGG + Intergenic
1082635740 11:55591246-55591268 AGGTCAGTGGTTTCTAGGGTTGG - Intergenic
1084863327 11:72036802-72036824 TGGTCTGTGGTCTCTTGGGTGGG - Intronic
1088848440 11:113686789-113686811 AAGTCAATGCTCTCTTGGGAAGG - Intergenic
1089495671 11:118907696-118907718 TGGGCAGTGCCCTCTAGGGTGGG - Intronic
1090521382 11:127483185-127483207 GGGTCAGATCCCTCTTGGCTTGG - Intergenic
1091710717 12:2738174-2738196 GGGGCAGTTCTTTCTCGGGTCGG - Intergenic
1092633024 12:10405913-10405935 CTGTCAGTTCTCTCATGGGTTGG - Intronic
1093066306 12:14661966-14661988 GCTTCAGTGCTTCCTTGGGTTGG - Intronic
1096242066 12:49964909-49964931 GGGTCTGTCCTCTGTGGGGTGGG + Intronic
1097052268 12:56230637-56230659 GGTTCACTGGTCTCTGGGGTAGG - Exonic
1097501436 12:60409311-60409333 GGGGCAGTGGACTCTTGGGAAGG - Intergenic
1102557733 12:113739484-113739506 GTGCCACTGCACTCTTGGGTGGG - Intergenic
1103183911 12:118939408-118939430 GAGGCTGTTCTCTCTTGGGTAGG - Intergenic
1104757486 12:131278214-131278236 TGCTGAGTGCTCTCTTGGGCTGG - Intergenic
1105547997 13:21365808-21365830 AGGTCAGGGCTCTGTTAGGTAGG - Intergenic
1105727076 13:23174190-23174212 GTGTCAGTGTTCTCTTGAGCTGG - Intergenic
1111171524 13:84533144-84533166 GGATCAGGTCTCTTTTGGGTAGG + Intergenic
1113363795 13:109656865-109656887 GGCTCCGTGCGGTCTTGGGTGGG - Intergenic
1113955222 13:114096759-114096781 GGGTCAGTGCTTCATTCGGTGGG - Intronic
1115518311 14:34207485-34207507 GGGTATGTGCTATTTTGGGTGGG - Intronic
1115897904 14:38110651-38110673 GGTTCAGTGTTCTAATGGGTTGG + Intergenic
1117196539 14:53345371-53345393 GGGTCAGTGATCACTTGGTAGGG + Intergenic
1119043149 14:71293683-71293705 GGGACAGTGATTTCTTGGGATGG - Intergenic
1122295757 14:100704866-100704888 GGGTCAGTGCTCACGTGGGTTGG - Intergenic
1126732963 15:51702999-51703021 GGGTCAGTGCTCTCTTGGGTGGG + Intronic
1129612944 15:77074769-77074791 GGGTCTGTGCTTCCTTGGGAGGG - Intronic
1132531900 16:455528-455550 TGGTCAGTCCATTCTTGGGTGGG + Intronic
1135488085 16:22883470-22883492 GGGTCTGTGCTATGTAGGGTGGG + Intronic
1136342106 16:29650920-29650942 TGGTTATTTCTCTCTTGGGTGGG - Intergenic
1140721393 16:77775506-77775528 AGGTCAGAGCTCTCTTGAGTGGG + Intergenic
1140986202 16:80160172-80160194 GGGTCAGTGGTTTCCTTGGTAGG + Intergenic
1141803273 16:86325007-86325029 AGGGCGGTGCTCTCTAGGGTCGG + Intergenic
1141928333 16:87183892-87183914 GTCTCAGTGCTCTGTTGGGCGGG - Intronic
1142960742 17:3551062-3551084 GGCTCTGTGCTCTGTTGGGGTGG + Intronic
1145157773 17:20554230-20554252 GTGCCCGTGCTCTCCTGGGTGGG - Intergenic
1147538416 17:41335576-41335598 GTGCTTGTGCTCTCTTGGGTGGG - Intergenic
1148319493 17:46738530-46738552 GGGTCAGTATTTTCATGGGTGGG + Intronic
1148516933 17:48228348-48228370 GTGTCAGTGCTCTCTATGGGAGG - Intronic
1148562304 17:48613106-48613128 GGGCCAGAGCTCTCTCGGGCAGG + Exonic
1151979521 17:77500220-77500242 GGGTCCTTCCTCTCTTGGGTGGG - Exonic
1152681636 17:81671553-81671575 GGGTCAGAGCCTTCTTTGGTGGG + Intronic
1153677884 18:7471450-7471472 GGGTAAGTGCTATCTGGAGTAGG + Intergenic
1154412582 18:14149347-14149369 GGGTGAGGGGTCTCCTGGGTTGG - Intergenic
1161042459 19:2117275-2117297 AGGTCAGCGCTCTCTTTGCTGGG - Exonic
1161332393 19:3694534-3694556 TGGGCAGTGCTCTGTGGGGTTGG - Intronic
1161595513 19:5149156-5149178 GGGTCTGTGCTCCCTTGGAGAGG + Intronic
1161948506 19:7453977-7453999 TGGTGGGTGCTATCTTGGGTTGG + Intronic
1162231480 19:9270601-9270623 GAGCCTGTGCTCTCCTGGGTGGG + Intergenic
1162741323 19:12775400-12775422 GGGTCTCTGCTCACCTGGGTAGG - Exonic
1166293711 19:41878875-41878897 GGGTGAGGACTCTCCTGGGTGGG - Intronic
1166930670 19:46299284-46299306 GGGGCAGGGGCCTCTTGGGTGGG + Intronic
1167966289 19:53149851-53149873 GGCTGAGTGCTGTCTTTGGTGGG - Intronic
1168098070 19:54126701-54126723 AGGACAGTGCTCGCTGGGGTGGG - Intronic
1168282814 19:55314607-55314629 GACTCAGTAGTCTCTTGGGTGGG - Intronic
929780001 2:44951451-44951473 AGGTGGGTGCTTTCTTGGGTGGG - Intergenic
930001644 2:46865741-46865763 GGGTCACTGCACTAGTGGGTGGG + Intergenic
931680997 2:64750260-64750282 GGGTGAGTGCTGTGCTGGGTTGG - Intronic
932947947 2:76259403-76259425 GGATCAATGCTCTCTTGATTGGG + Intergenic
934746736 2:96764194-96764216 AGGGCTGAGCTCTCTTGGGTTGG + Intronic
936282849 2:111157872-111157894 GGGAGAGTGCTCTCCTGGTTTGG + Intronic
937155498 2:119715926-119715948 GGGTCACTGCACTTGTGGGTTGG - Intergenic
937419345 2:121741263-121741285 GGGAGAGGGCTCTCTGGGGTGGG + Intronic
938085363 2:128396353-128396375 GGCCCATTTCTCTCTTGGGTAGG + Intergenic
938095288 2:128457424-128457446 GGCTCAGTCATCACTTGGGTTGG - Intergenic
939263152 2:139835937-139835959 GGATAAGTGCTCTATTGGGCTGG + Intergenic
940005773 2:149008294-149008316 GGGTTTGAGCTCTCTGGGGTTGG + Intronic
940345347 2:152622936-152622958 GGGTGAGTGCTCCCTGGAGTGGG - Intronic
941587288 2:167376466-167376488 GGTCCAGGGCTTTCTTGGGTTGG + Intergenic
943040086 2:182794107-182794129 TGTTCACTGCTCTCTTGGGTTGG - Exonic
945410401 2:209499868-209499890 GGGGCAGAGCTCTCATGGCTTGG - Intronic
948688755 2:239688861-239688883 GTGTCAGAGTTCTCCTGGGTGGG + Intergenic
1175530891 20:59673709-59673731 GGGACAGTGAGCTCTTGGATGGG + Intronic
1175939231 20:62530312-62530334 AGGTCACTGCTCTCGTGGATTGG + Intergenic
1176127918 20:63484217-63484239 GGGGCAGAGCTCACTGGGGTTGG - Intergenic
1176223055 20:63979165-63979187 GGGTCAGCGCGCCCTTGGCTTGG - Intronic
1176860424 21:14008908-14008930 GGGTGAGGGGTCTCCTGGGTTGG + Intergenic
1176918966 21:14663476-14663498 TGGTCAGGGCTCTCAGGGGTTGG - Intergenic
1177201549 21:17962513-17962535 GTGTCTGTGCTGTCTGGGGTAGG + Intronic
1179840171 21:44067394-44067416 GGGTGGGTGCTCTCATGTGTAGG + Intronic
1182475856 22:30575894-30575916 GGGTGAGTGCTGTCGAGGGTTGG - Intergenic
1184345888 22:43912489-43912511 GGGGCAGTTCCCTCATGGGTTGG + Intergenic
1185021887 22:48381420-48381442 GGGTCGATCCTCTCCTGGGTTGG - Intergenic
952967885 3:38632301-38632323 GGGGCAGTTACCTCTTGGGTCGG + Intronic
953353948 3:42238512-42238534 GTGTCAGTGCTCTCCTGGAGTGG - Intergenic
956734091 3:72223399-72223421 GTGTCAGCTCTCTCTTGGATGGG - Intergenic
956740067 3:72268845-72268867 GGGTCAGTTCTCTGATTGGTTGG - Intergenic
958696102 3:97528580-97528602 GCTTCAATGCTCTCTAGGGTTGG + Intronic
961464854 3:127075146-127075168 TGGGCTGTGCTCTGTTGGGTTGG + Intergenic
964883142 3:161446453-161446475 GGGTCAGTGCTGACTGGGATGGG + Intergenic
968348937 3:198036042-198036064 TGGTGAGTGCTCTCTATGGTTGG + Exonic
968481532 4:835156-835178 GGGTCAGAGCTGTCCTGGGTGGG - Intergenic
970111276 4:12640416-12640438 GGGTCAGTGCCCTCCTAGTTGGG + Intergenic
973339781 4:48992406-48992428 TGGTCAGAGCTCTCTAGGATGGG + Intronic
973971193 4:56215346-56215368 AGGGCAGTGCTCTCATGGATGGG - Intronic
974543664 4:63272267-63272289 GGTTCAGGGCTTTTTTGGGTTGG + Intergenic
979018775 4:115468211-115468233 GAGTGAGTGCTCTCTGTGGTAGG - Intergenic
980717849 4:136651521-136651543 GAGTCAGTGCTCTGATGTGTAGG - Intergenic
986597604 5:9439832-9439854 AGGACAGAGCTCTCTTGGCTTGG + Intronic
996716609 5:126593145-126593167 GAGACTGTCCTCTCTTGGGTGGG - Intronic
996966237 5:129309419-129309441 TGGTCAGTGCTTTCTTAGTTGGG + Intergenic
997385046 5:133465760-133465782 GGGTCAGTGCTGTCTAAGGTGGG + Intronic
1000380759 5:160627275-160627297 GGGACAATGCTCTCTGGGCTGGG - Intronic
1001086064 5:168700832-168700854 GGGTTAGGGCTCCCATGGGTGGG - Intronic
1001595068 5:172893108-172893130 AGGTCAGTGCTAACTTGGATGGG - Intronic
1002573234 5:180155891-180155913 GGGACAGTGCCCTCTTGGCCAGG - Intronic
1010040473 6:71377034-71377056 CGCTCAGTGCTCTCTAGGATGGG + Intergenic
1014018692 6:116564211-116564233 GAATCTGTGCTCTCTTGGGCTGG + Intergenic
1018837990 6:167499477-167499499 AGGGCAGTGCTGTCTTAGGTTGG + Intergenic
1019922047 7:4169277-4169299 GGGTCATTCCCCACTTGGGTGGG - Intronic
1021477946 7:21084141-21084163 GTGCCATTGCTCTCTTGGGAGGG - Intergenic
1022816988 7:33923372-33923394 GGGTCTGTGCCCTCTTCTGTGGG + Intronic
1023196124 7:37641668-37641690 AGGTCAGTGCACTGCTGGGTTGG - Intergenic
1027954078 7:84857495-84857517 GTGTGAGTCCTCTCCTGGGTGGG - Intergenic
1029421325 7:100473157-100473179 GGGACAGTGCTCTGTTGGGTGGG - Intronic
1029515118 7:101018991-101019013 GGGTCAGAGCCCTCCTGGGATGG + Intergenic
1032071439 7:128809946-128809968 GTGGCAGTGGTCTCTTGTGTTGG - Intronic
1035519748 8:266662-266684 GGGTCAGTGCTCACCTGGGAGGG + Intergenic
1036629033 8:10497323-10497345 GGCTCAGAGCTATCTTGGGATGG + Intergenic
1036651893 8:10649546-10649568 AGCTCAGTGTTCTCTTGGGAAGG + Intronic
1038525782 8:28271981-28272003 GTCTCAGTGGTCTTTTGGGTAGG - Intergenic
1039637039 8:39178915-39178937 AGGTCAGTGCCCTCCTGGGATGG - Intronic
1039943877 8:42113908-42113930 GGATCAGTGCCCTCGTGGGACGG - Intergenic
1048963851 8:139601044-139601066 GGGTCAGTGCTCCCTGGGGCGGG - Intronic
1052880684 9:33599512-33599534 GGGACAGTGCTCCCCAGGGTGGG + Intergenic
1053004766 9:34597147-34597169 GGATCAGTGCCCACTGGGGTGGG - Intergenic
1053256739 9:36623647-36623669 GGGGCAGTGCTCCATTGGGAAGG + Intronic
1053345706 9:37376809-37376831 GGCTCAGTTCTGACTTGGGTTGG + Intergenic
1053474138 9:38369956-38369978 TGGTCAGTGCTCTCAGGGGTGGG - Intergenic
1057399674 9:94712016-94712038 GGGTAAGAGCTGTCTTGGTTTGG + Intergenic
1058953283 9:109923338-109923360 GAGTAAGTGCTCTCTCAGGTTGG - Intronic
1060822522 9:126669766-126669788 GGGTCAGTTGTCTCTAGGGCAGG + Intronic
1062186686 9:135222115-135222137 GGGTCAGCGCTCTCCTGGGGAGG - Intergenic
1189159768 X:38800270-38800292 GGATCTCTGCTATCTTGGGTTGG + Intergenic
1194728727 X:97429304-97429326 GAGTCAGTGGTTTCTTGGTTAGG + Intronic
1195330206 X:103791184-103791206 GGGTCAGTGCTCTCTTTCTGTGG - Exonic
1196324233 X:114383460-114383482 GTGTCAGTGATCAATTGGGTGGG - Intergenic