ID: 1126742889

View in Genome Browser
Species Human (GRCh38)
Location 15:51796050-51796072
Sequence GTTGGTTTTCTTAAAATGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 392
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 355}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126742887_1126742889 7 Left 1126742887 15:51796020-51796042 CCTGCTTGGTCAACTTTATTCTT 0: 1
1: 1
2: 5
3: 105
4: 821
Right 1126742889 15:51796050-51796072 GTTGGTTTTCTTAAAATGTCTGG 0: 1
1: 0
2: 2
3: 34
4: 355

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126742889 Original CRISPR GTTGGTTTTCTTAAAATGTC TGG Intronic
901394368 1:8970236-8970258 TTTGTTTTTCTGAAAATGTCAGG - Intronic
901720145 1:11190734-11190756 TTTGGTTTTCTGAAATTATCAGG + Intronic
902987316 1:20162753-20162775 GTTTGTTTTCTTTAAATATCTGG + Intronic
903199177 1:21719386-21719408 GTTGGTTTTCCCAAAAAGTAAGG + Intronic
903523208 1:23971069-23971091 TTTGGTTTACTTAAATTATCAGG - Exonic
907147757 1:52251765-52251787 ATTGGTGTTCTTTAAATGTTTGG + Intronic
909833019 1:80217683-80217705 GTTGGTTGTCTGAACATGGCCGG - Intergenic
909840625 1:80317728-80317750 TTTGATTTTTTTTAAATGTCTGG - Intergenic
911519105 1:98907626-98907648 GTTGATTTTCCTAAAATGAATGG + Intronic
912538074 1:110390814-110390836 GTTGGTTTTCTAACAACGACTGG - Intronic
913353771 1:117894783-117894805 ATTATTTTTCTTGAAATGTCAGG - Intronic
917178950 1:172272002-172272024 GTTGTTTTCCTTTAAATGACAGG + Intronic
917702609 1:177596572-177596594 CTTGGAATCCTTAAAATGTCTGG + Intergenic
918019139 1:180667672-180667694 GTTGATATTCTTTAAATGTTGGG + Intronic
918443103 1:184588212-184588234 GTTATTTTTCTTGAAGTGTCAGG - Intronic
918617588 1:186563847-186563869 CTTTGCTTTCTTAAAATATCTGG + Intergenic
919338827 1:196276570-196276592 GCTGGTTTCCATAAAACGTCTGG + Intronic
919969203 1:202562251-202562273 GTTGGTATCCCTAAAATGTTTGG + Intronic
922086334 1:222351537-222351559 TTTGCTTTTCTTGAAATGTTTGG - Intergenic
922392122 1:225155646-225155668 CTTGATTTTCTTCAAATGACAGG + Intronic
924178710 1:241419461-241419483 ATTGGTTTTTTAAAAATTTCAGG - Intergenic
924350023 1:243105999-243106021 GTTAGTTATCTTACATTGTCAGG + Intergenic
1064834152 10:19506264-19506286 ATTGGTTGTCTTCAAATGTGTGG - Intronic
1065037000 10:21649593-21649615 GTTGGTCTTATTCACATGTCTGG + Intronic
1065112070 10:22449970-22449992 TTTTATTTTCTTAAAATGTTCGG + Intronic
1065282660 10:24155516-24155538 TTTGCTTTTCAAAAAATGTCAGG + Intronic
1065471326 10:26084843-26084865 ATTGATTTTCTTCAAATGTTTGG + Intronic
1067072939 10:43149649-43149671 TATGGTTTTCTTTTAATGTCTGG + Intronic
1067341625 10:45410386-45410408 GAAGGTTTTCTTAAAATCTGAGG + Intronic
1067812928 10:49444396-49444418 GTTGGTTTTCTTCAGATCTTGGG - Intergenic
1068330062 10:55552843-55552865 TTTTGTTTTCTTAAAATGCAGGG + Intronic
1068747911 10:60556102-60556124 GTTGATTCTCTTTTAATGTCTGG - Intronic
1068951153 10:62778948-62778970 GTTGGTTGTCTTCAAATATTTGG + Intergenic
1069132609 10:64725812-64725834 CTTGGTTTTCTTCAAATGTTTGG + Intergenic
1070523215 10:77272771-77272793 GTTGGTTTTCTTTAATTATATGG + Intronic
1072448808 10:95522367-95522389 GGTTGTGTTCATAAAATGTCAGG - Intronic
1072771968 10:98148943-98148965 ATTGGTATTCTTTGAATGTCTGG + Intronic
1075232539 10:120693258-120693280 GTTGGTTTTCTTATAAATTCAGG - Intergenic
1075497106 10:122931720-122931742 AGAGGTTTTCTTAAACTGTCTGG + Exonic
1075899304 10:126026365-126026387 GTTGATTTTCTAATATTGTCAGG - Intronic
1075965441 10:126607475-126607497 GTTGTTTTCCTTAAAGTGACAGG - Intronic
1076214533 10:128682387-128682409 CTTAGCTTTCTTAAGATGTCTGG + Intergenic
1077509959 11:2953809-2953831 GTTTCTTTTCTTAGAAGGTCTGG - Intronic
1078671102 11:13366456-13366478 GTTGGTTTTGATAACATGACGGG - Intronic
1079572179 11:21956983-21957005 GTAGGATTTCTTTAAATGTTTGG - Intergenic
1080022722 11:27580313-27580335 ATTGGTTTTCTTTGAAAGTCAGG + Intergenic
1080294987 11:30716194-30716216 GTTGCTTTTCTTATAATTCCAGG - Intergenic
1082701213 11:56433389-56433411 ATTTGTTTTCTTACACTGTCAGG - Intergenic
1085244395 11:75087942-75087964 GATAGTTTGCTTAAAATTTCAGG - Intergenic
1087217580 11:95510777-95510799 GTAGGTTTTCCTCAAGTGTCTGG + Intergenic
1088383282 11:109220923-109220945 TTTGTTTTTCTTTCAATGTCAGG + Intergenic
1088446852 11:109940134-109940156 TTAGGTTATGTTAAAATGTCTGG - Intergenic
1088747188 11:112813989-112814011 TTTGGCTTCCTTCAAATGTCTGG - Intergenic
1089031604 11:115335925-115335947 ATTGTTTCTCTTAAAATGACAGG + Intronic
1089112768 11:116070387-116070409 GTAGGTTTTCAAAAAATGTTTGG - Intergenic
1089947489 11:122492488-122492510 GTAGGTGTTATTAAAATGTAAGG - Intergenic
1090150679 11:124380388-124380410 ATTGGTTTTGTTATAAAGTCAGG - Intergenic
1090695108 11:129232450-129232472 GTTGTTTTCCTTGAAATGACTGG - Intronic
1090999970 11:131902319-131902341 GTTTATCTTCTTAAAATGTGTGG + Intronic
1092945812 12:13453021-13453043 AGTGGCTTTCTTAAAATGTCAGG - Intergenic
1093133984 12:15427901-15427923 GTTGATTTTCCTCAAATATCTGG + Intronic
1095859057 12:46894334-46894356 GTTGGTTTTTCTCAAATGACTGG - Intergenic
1096311737 12:50527018-50527040 TTTGGTTTTATTACAATGTCTGG - Intronic
1097401324 12:59131498-59131520 GTTTGTTTTTTTAAAAGGTAGGG + Intergenic
1098456253 12:70677973-70677995 ATTGGTATTCTTTAAATGTTTGG + Intronic
1098711230 12:73764976-73764998 GTGTGTTTTCTTAAATTGCCAGG - Intergenic
1098778327 12:74652038-74652060 GTTTGTTTTCATAAATTATCTGG - Intergenic
1098834515 12:75406093-75406115 CTTGGTTTTCTTAAATAATCAGG - Intronic
1098937387 12:76496304-76496326 GTTGGTTTTCCTCAAGTATCTGG + Intronic
1099197448 12:79634647-79634669 GTTCTTTTTCTTAAAAATTCTGG - Intronic
1099960626 12:89393579-89393601 ACTGGTTGTCTTAAAATGTGGGG - Intergenic
1101981212 12:109408498-109408520 GTTGAAATTTTTAAAATGTCAGG - Intronic
1104788103 12:131464006-131464028 TTTGGCTTTCAAAAAATGTCAGG + Intergenic
1105653193 13:22403073-22403095 GTTGTTTTTGTTGGAATGTCTGG + Intergenic
1106228622 13:27803966-27803988 GTTGTTTTTCTTAAAGTAACAGG - Intergenic
1106498035 13:30299595-30299617 CTAGGTCTTTTTAAAATGTCAGG + Intronic
1106877062 13:34085718-34085740 GTTGGTTTGGTTAAAATTTTGGG - Intergenic
1106944552 13:34812183-34812205 CTTGGCTTTCTTTAAATCTCTGG + Intergenic
1108151568 13:47541338-47541360 CTTGGTCTTCTTCAAATGTTAGG - Intergenic
1108218764 13:48211706-48211728 GTTGGTTTTCCTTAAAAGTCTGG + Intergenic
1108230192 13:48330720-48330742 ATTGGTATTCTTCAAATGTCTGG - Intronic
1109066234 13:57696399-57696421 GATGGTTTTCTTAAAATATTGGG - Intronic
1109295576 13:60526373-60526395 GCTGCTTTTATAAAAATGTCTGG + Intronic
1109579951 13:64317187-64317209 TTTGTTTTTCTTAAACTGTGAGG + Intergenic
1109815172 13:67572643-67572665 CCTGGTTCTTTTAAAATGTCAGG - Intergenic
1110211286 13:72976550-72976572 GTTGCTTTTCTTTAGATGTTTGG - Intronic
1110868219 13:80421230-80421252 ATTGGTTCACTTAAACTGTCAGG + Intergenic
1112291247 13:98145032-98145054 GTTTGTGTTTTTAGAATGTCTGG + Intronic
1112875919 13:104038332-104038354 GTTGTTTTTCATTAAATGTTTGG - Intergenic
1112893452 13:104267810-104267832 GATGTTTTTCTTAAAGTGGCAGG - Intergenic
1113659906 13:112099245-112099267 GTTGGTTTTCTTAGATTGATAGG + Intergenic
1114128659 14:19762368-19762390 GTTGTTTATCTTAAAAAATCAGG - Intronic
1114362880 14:21994961-21994983 GTTGTTTTCCTCAAAATGGCAGG + Intergenic
1114513867 14:23285388-23285410 GTTGGTTCTCTTAGTATGGCTGG + Intronic
1115448549 14:33519775-33519797 GTTTGTTATTTTAAAATGTACGG - Intronic
1115877205 14:37874366-37874388 GTTGGTTTTGTTTGAAAGTCAGG - Intronic
1116192895 14:41682871-41682893 TTAGGTCTTCTTTAAATGTCTGG - Intronic
1116221149 14:42089071-42089093 GATGGTTTTCTTAAAATTCCTGG - Intergenic
1117052916 14:51880084-51880106 TTTGGTTTTCTTGAAGTGTCTGG + Intronic
1117113854 14:52489262-52489284 TTTGGTATTCTTAAAATAACTGG - Intronic
1118352850 14:64986194-64986216 GTCGATTTTCTTAGAATGTAAGG + Intronic
1118649925 14:67880254-67880276 CTTGTTTTTCTTGAAGTGTCGGG + Intronic
1118670000 14:68114867-68114889 CTAGGTTTTCTTAAAAAGTCAGG + Intronic
1120214160 14:81663947-81663969 GTTGGTTTTCTTAAAATATTAGG + Intergenic
1120273676 14:82346135-82346157 TTTTGTTTTCTTAAAGTGTTTGG + Intergenic
1120431152 14:84417886-84417908 GTTGGATTACTTTAAAAGTCCGG + Intergenic
1120930545 14:89843970-89843992 GTTGTTTTCCTTGAAATGACAGG + Intronic
1202871507 14_GL000225v1_random:169119-169141 TTTTGTTCTCTTAAAATTTCTGG - Intergenic
1124456913 15:29851533-29851555 GTTGTTCTTCTTTAAATGTTTGG - Intronic
1124612872 15:31220785-31220807 GTTGGTTTCCTTCAAATGTCTGG + Intergenic
1125155690 15:36582124-36582146 GTTGTTTTCCTTGAAATGACAGG + Intronic
1125775233 15:42206937-42206959 ATTGGTTTTCTTGAGATGTCTGG + Intronic
1126742889 15:51796050-51796072 GTTGGTTTTCTTAAAATGTCTGG + Intronic
1127704051 15:61529805-61529827 ATTGGTGTCCTTAAAATGTGAGG - Intergenic
1127986522 15:64076513-64076535 GTAGGTTGTCTTAAAAGCTCTGG - Intronic
1128931355 15:71707421-71707443 GTTGGTTTAATTAAAATATTTGG - Intronic
1130290810 15:82598848-82598870 CTTGGTTTTCTGAAAATATTTGG - Intronic
1130950442 15:88582471-88582493 GTTTTCTTTCTTATAATGTCTGG - Intergenic
1132911090 16:2312211-2312233 GTTGTTTTCCTTAAAAAGACAGG + Intronic
1133942196 16:10318859-10318881 GGCCATTTTCTTAAAATGTCAGG - Intergenic
1136352612 16:29720986-29721008 TTTGGGTTGATTAAAATGTCTGG - Intergenic
1137048244 16:35687711-35687733 GTCTGTCTTATTAAAATGTCTGG + Intergenic
1137050727 16:35711430-35711452 GTTTCTTTTATTAGAATGTCTGG + Intergenic
1137664724 16:50243354-50243376 GTTTGTTTTTTTAAAAAGACAGG + Intergenic
1138315387 16:56065126-56065148 GTTGGTTTTAATAAGATGACAGG - Intergenic
1139829416 16:69784870-69784892 GTTGTTTTCCTTGAAGTGTCGGG - Intronic
1140818929 16:78645630-78645652 GTTGGTTCTTTTAAAGTCTCTGG - Intronic
1140999285 16:80293070-80293092 ATTGTTTTCCTTAAAATGACAGG + Intergenic
1141842916 16:86585727-86585749 GTTGATGTTTGTAAAATGTCTGG + Intergenic
1143843582 17:9754592-9754614 TTTTGTTGTCATAAAATGTCAGG - Intergenic
1144251590 17:13422016-13422038 GTTGTTTTCCTTAAAGTGCCAGG - Intergenic
1144514960 17:15910973-15910995 GTTGGTTGACTCAGAATGTCTGG + Intergenic
1146388448 17:32398706-32398728 GTTGTTTTTCTTGAAGTGACAGG + Intergenic
1149299986 17:55296175-55296197 GTTGGTTTCCTTACAAGGTAGGG + Intronic
1150690166 17:67359019-67359041 TTTGGTTTTATCAAAATGTGTGG - Intronic
1153390587 18:4553432-4553454 ATTGGATTTCTTTAAATGTTTGG + Intergenic
1154183380 18:12157684-12157706 GTTGGATTTCCTTAAATGACTGG + Intergenic
1154982497 18:21514910-21514932 GTCGGACTTCTTAAAATGTTTGG - Intronic
1155602660 18:27567646-27567668 GTAGGTTTTCTTACAAAGTAAGG - Intergenic
1157210432 18:45737433-45737455 TTTGGTTTTCTTCTAATTTCAGG - Intronic
1157552101 18:48589038-48589060 CCTGGTTTTCTTAAAAAGTTGGG - Intronic
1157580158 18:48769413-48769435 GCTGTTTTTCTAAAAATGGCTGG + Intronic
1157862990 18:51158205-51158227 TTTGGTTTACTTAAATTATCAGG - Intergenic
1158948702 18:62471468-62471490 ATTGGTATTCTTTAAATGTTTGG + Intergenic
1159091800 18:63858196-63858218 GTAGGTTTTTTTAAAATTTGAGG + Intergenic
1160068519 18:75602622-75602644 GTAGTTTTTCTTTAAATGTTTGG - Intergenic
1160277975 18:77456771-77456793 GTTGGATATTTTAAGATGTCAGG - Intergenic
1161713787 19:5864317-5864339 GTCGGTTTTCTGAAGATCTCAGG - Intergenic
1161716230 19:5877558-5877580 GTCGGTTTTCTGAAGATCTCAGG - Intronic
1161742426 19:6031095-6031117 GCTGTTTTTCTTAATATGTCAGG + Intronic
1162177482 19:8841884-8841906 TTTGGGTTGCTGAAAATGTCTGG + Intronic
924975842 2:174161-174183 ATTGGTTTCCCTGAAATGTCTGG - Intergenic
926488404 2:13492072-13492094 TTTTGTCTTCTGAAAATGTCTGG - Intergenic
926892471 2:17650120-17650142 CTTGGTTTTCTTCTAATGCCCGG + Intronic
926898044 2:17716952-17716974 GTTTGTGTTCTTTAAATGTTAGG - Intronic
927050546 2:19323918-19323940 GTTGGTTGTCTTAAAGTTGCAGG - Intergenic
927228684 2:20797698-20797720 TTTAGTTTTCCTCAAATGTCTGG - Intronic
928144737 2:28762974-28762996 GTTGTTTTCCTTGAAATGACAGG + Intronic
928763154 2:34608558-34608580 GTAGTTTTTCTTTAAATGTTTGG + Intergenic
928841859 2:35617118-35617140 TTTGTTTTTCTTTAAATGTTTGG + Intergenic
929837791 2:45423614-45423636 ATTGGTGTTCTTCAAATGTTTGG - Intronic
930542004 2:52718323-52718345 GTAGGTTTTCATCAAATATCAGG - Intergenic
932120363 2:69093762-69093784 TTAGATTTTCTTAAAATCTCTGG + Intronic
932242273 2:70166753-70166775 GTTGGTCTTTTTAAAATTTGCGG - Intronic
932559908 2:72857942-72857964 GGAGGGTTTCTTCAAATGTCTGG - Intergenic
932842316 2:75095138-75095160 GTAAGCTTTCTGAAAATGTCTGG + Intronic
933428807 2:82148298-82148320 TTTTTTTTTCTTAAAATTTCAGG + Intergenic
933610181 2:84425716-84425738 GTTGGTTTTCCTAAGATGAATGG - Intronic
935978482 2:108603211-108603233 GTAGTTCTTCTTTAAATGTCTGG + Intronic
936651486 2:114432052-114432074 GTTGTTTTCCTTAAAGTGTTAGG + Intergenic
936904156 2:117517382-117517404 GTTGTTTTTCTAAACATCTCAGG + Intergenic
939755994 2:146111957-146111979 GTTAGTTCTCTTTAAATTTCTGG - Intergenic
939826318 2:147019678-147019700 GTTGTTTTTCTTGAAATGGCAGG - Intergenic
941093983 2:161214187-161214209 GTTGCTTTCCTTAACATGACAGG + Intronic
941135342 2:161710379-161710401 TTTGGTTCTCTTGAAAGGTCAGG - Intronic
941737090 2:168990182-168990204 CTAGTTTTTCTTTAAATGTCTGG + Intronic
942584190 2:177456454-177456476 GTTTGTTTTCTTAAACTTTTTGG + Intronic
943128263 2:183823982-183824004 TTAGTTTTTCTTTAAATGTCTGG - Intergenic
943716123 2:191154056-191154078 GTTGTTTTCCTTAAAGTGACAGG + Intergenic
944198409 2:197079913-197079935 TTTGGTTTTTTTAAAATGTATGG - Intronic
945834356 2:214821418-214821440 GTTGGTTATCTGGAAATCTCTGG - Intergenic
946287532 2:218716216-218716238 GTTGGTTTCCTTGAAGTGACAGG + Intronic
947023370 2:225709132-225709154 GTTAGTTTTCATCAAATGTTTGG - Intergenic
947579461 2:231304877-231304899 GTTGTTTTCCTTAAAGTGACAGG + Intronic
1169908030 20:10623252-10623274 GTTATTTTTCATAAGATGTCTGG - Exonic
1174370530 20:50084236-50084258 TTCGGTTTTCATAAATTGTCTGG + Exonic
1176158276 20:63634421-63634443 GTTGCTTTCCTTAAAGTGTATGG - Intergenic
1176676127 21:9779120-9779142 GTAAGTTTTACTAAAATGTCAGG + Intergenic
1177398559 21:20570527-20570549 GTTAATTTTCTTGAAATGTTTGG - Intergenic
1177439772 21:21107104-21107126 ATTGGAGTTCTTAAAACGTCTGG + Intronic
1177559269 21:22729510-22729532 GTTGGGTTGCTTAAGATGCCGGG + Intergenic
1177716929 21:24851086-24851108 CTTGGTTTTCCTAAAATATCAGG + Intergenic
1178017751 21:28370140-28370162 ATTGGTATTCTTTAAATGTTAGG + Intergenic
1178448583 21:32669285-32669307 GTTGTTTTTCTTAAAGAGACAGG - Intronic
1182248566 22:28980980-28981002 GTTTATTTTCTTAAAATATTTGG - Intronic
949163007 3:904205-904227 ATTAGTCTTCTTAAAATGTTTGG - Intergenic
950130844 3:10545583-10545605 TTTGCTTTTCTTAAAATGGTTGG - Intronic
951148386 3:19256839-19256861 ATTAGTTTTCTTAGAATGTCAGG - Intronic
952531673 3:34268695-34268717 CTTGGTTTTCCTTAAACGTCTGG - Intergenic
952875377 3:37940580-37940602 GCTGGGTTTCTTAACATGGCAGG - Intronic
953036505 3:39216222-39216244 GTTGGTTTTGCAGAAATGTCTGG - Intergenic
953946597 3:47154040-47154062 TTTGATTTTCTTAAGATGTCTGG - Intronic
953966973 3:47315702-47315724 AGAGGTTTTCTTTAAATGTCTGG - Intronic
954835466 3:53463207-53463229 CTTTGTTGTCTTAAAATCTCTGG + Intergenic
954851910 3:53608936-53608958 GTTTTCTTTCTTTAAATGTCTGG + Intronic
955013461 3:55044200-55044222 CTTGGTTGTGTTAAGATGTCAGG - Intronic
956574021 3:70731295-70731317 GTTTGTTTCCTTAAAAAGTATGG + Intergenic
957112218 3:75977571-75977593 TTGGGTTTTCTTAAAATATAAGG + Intronic
957138643 3:76323553-76323575 GTTGGATTTCTTAAAATAGAGGG - Intronic
958840264 3:99195351-99195373 CTTGTTTTTCTTTAAATGTTTGG - Intergenic
959132741 3:102377980-102378002 CTGGGTTTTCTTCCAATGTCTGG - Intronic
959509845 3:107198435-107198457 GATGTTTTTCTAAGAATGTCTGG - Intergenic
959552355 3:107676499-107676521 GTTTGTTTTCATAAAATGTAGGG + Intronic
960662400 3:120074828-120074850 ATTGGTATTCTTAAAAAGTTTGG - Intronic
960742051 3:120845277-120845299 GAAGGTTTTCTTCAACTGTCTGG + Intergenic
961274032 3:125712758-125712780 TTTGGTTTTCTTCAGATCTCGGG + Intergenic
962024265 3:131530568-131530590 GTTGTTTTTCTTGAAGTGACAGG - Intergenic
962422218 3:135238804-135238826 TTTGGTTTTCTCAAAATACCTGG - Intronic
962468004 3:135678518-135678540 GTTTGTTTTCTTTAAATGTTTGG + Intergenic
963217197 3:142761650-142761672 ATTAGTTTTCTTGAAATGTTTGG + Intronic
965302982 3:167026897-167026919 GTAGGTATTTTTAAAATATCTGG + Intergenic
965414825 3:168380132-168380154 ATTGGTATTCTTTAAATGTTTGG + Intergenic
965438640 3:168685040-168685062 GTAGTTTTTCTTAAAATATTAGG + Intergenic
965808839 3:172571560-172571582 TTAGGTCTTCTTAAAATGTTTGG + Intergenic
965957847 3:174392284-174392306 TTTCTTTTTCTTAAAATCTCAGG + Intergenic
966064626 3:175803920-175803942 GTTGATTTTCTAAGAATTTCAGG + Exonic
966483374 3:180438422-180438444 GTGGATTTTCTGAAGATGTCTGG - Intergenic
966517246 3:180831429-180831451 GTTGTTTTTCTTGAAACGACAGG - Intronic
966710290 3:182965652-182965674 GTTGTCTTTCTCAAAATGACTGG - Exonic
966952131 3:184830675-184830697 TTTGATTTTCTTAAAAAGCCTGG - Intronic
972098554 4:35381476-35381498 GATGGTATTCTTAAAAATTCAGG - Intergenic
972982698 4:44725585-44725607 TTTTGTTTTCTTAAACTCTCTGG + Intronic
974588563 4:63914805-63914827 TTAGGTTTTCTTTAAATGTTTGG + Intergenic
974800895 4:66816485-66816507 GTTGTTTTTCTTATAATGACAGG + Intergenic
975338919 4:73215109-73215131 ATTGTTTTTCTTGAAATGACAGG - Intronic
976601193 4:86938891-86938913 GCTGATTTTCTTAAATTATCTGG + Intronic
977200654 4:94111735-94111757 ATTAGTTTTCTTAAAATGAGGGG + Intergenic
977378448 4:96238310-96238332 TTTGGTTGTCTAAAAATGTGAGG + Intergenic
977923917 4:102677233-102677255 GTTGTTTTTCTTGAAATGATAGG - Intronic
978229647 4:106383885-106383907 TTTGATATTCTTAAAATGACTGG + Intergenic
979251919 4:118574548-118574570 GTTAGTTATCTTACATTGTCAGG - Intergenic
980589358 4:134864191-134864213 GTTGGCTTCTTCAAAATGTCAGG - Intergenic
980775671 4:137432840-137432862 TTTGTTTTTCTTTAAATTTCTGG - Intergenic
980810335 4:137869381-137869403 GTTGATTTTATTAAATTTTCTGG - Intergenic
980838954 4:138233563-138233585 GTTGGTTTTCTGATAATCTATGG - Intronic
981222102 4:142248738-142248760 CTTGGTTCTCTTGAAATCTCAGG + Intronic
981895501 4:149794579-149794601 ATTGATTTTCCTCAAATGTCTGG - Intergenic
982986647 4:162217056-162217078 GTAGGTTTTGATAAAATTTCAGG + Intergenic
983553982 4:169043634-169043656 TTTGCTTTAGTTAAAATGTCAGG - Intergenic
983680341 4:170346060-170346082 TTTGTTTTTCTTTATATGTCTGG + Intergenic
984186885 4:176555126-176555148 GTTGATTTTCTCAAATTTTCAGG + Intergenic
984205759 4:176786082-176786104 GCAGGGTTTCTTAAAGTGTCTGG - Intronic
984221217 4:176979236-176979258 GTTGATTTTCTTAAAATAATAGG + Intergenic
985399402 4:189579626-189579648 GTAAGTTTTACTAAAATGTCAGG - Intergenic
986108413 5:4685094-4685116 GTTGTTTTCCTTGAAGTGTCAGG + Intergenic
987642632 5:20631948-20631970 GTTAGTTTGCTGAAAATGACTGG + Intergenic
988119555 5:26943097-26943119 CTTAGTTTTCTTAAAGTATCTGG - Intronic
988324548 5:29745784-29745806 ATTGATTTTCCTAAAATTTCTGG - Intergenic
989271686 5:39540780-39540802 CTTGGTTTTCTGAATATGCCTGG + Intergenic
989485834 5:41991024-41991046 GATGGGTTGCTTAGAATGTCAGG + Intergenic
993019294 5:82572026-82572048 GTTGGCTTGTTTAAAAGGTCAGG + Intergenic
993840503 5:92872316-92872338 ATTGGTCTTCTTTAAATGTTTGG + Intergenic
994214418 5:97121750-97121772 TTTGGTTTTCCTTAAATGTTTGG + Intronic
994402590 5:99299994-99300016 TTTGGTATTCTTTAAATGTTTGG - Intergenic
994563655 5:101411745-101411767 GTTGTGTTTCTTAAAGTATCAGG - Intergenic
995199612 5:109411204-109411226 ATTGGATTTCACAAAATGTCTGG - Intergenic
995265889 5:110160253-110160275 GCTGGTTTTATTAAAATTTGAGG - Intergenic
995921276 5:117316860-117316882 GTTTGTTTTCTTACAATTTCAGG + Intergenic
995958786 5:117813779-117813801 GTTGTTTTTCTTTAAACGGCAGG - Intergenic
996066719 5:119087639-119087661 GTGGGTGTTCTTTAAATGTCAGG + Intronic
996544767 5:124666495-124666517 GTAGTTTCTTTTAAAATGTCAGG + Intronic
996663686 5:126033261-126033283 GTTGGTTTAATTAAAATGCAGGG - Intergenic
996888724 5:128390801-128390823 GTTCCTTTTCTTAAAGTGACAGG - Intronic
998539092 5:142962624-142962646 GTTTGTTTGTTTTAAATGTCTGG + Intronic
998632138 5:143910911-143910933 GTTGGTTTTATTAATTGGTCTGG - Intergenic
999357387 5:150948119-150948141 CTTGGTGTTCTTTAAATGTTTGG + Intergenic
1000059746 5:157643518-157643540 GTTAATTTTCTAAAAATCTCTGG - Intronic
1002422615 5:179156911-179156933 TTTGGTTTTTTTAAAATATCTGG + Intronic
1004668719 6:17774931-17774953 CTTGGTGTTTTTAAAATCTCTGG - Intronic
1005464357 6:26097600-26097622 GTTTGTTTTCTCAAATTTTCAGG - Exonic
1007823629 6:44580779-44580801 GTTTGTTTGCTTAAAATCTTAGG + Intergenic
1008245569 6:49167731-49167753 GCTGATTTTCTTAATATGGCAGG + Intergenic
1009507600 6:64504320-64504342 GTAAGTTTTCCTAAAATGTTAGG - Intronic
1010152112 6:72745076-72745098 GTTATTTTTCCTAAAATATCAGG + Intronic
1010890956 6:81309826-81309848 CTTGGTTTTCTTAGGATGTAGGG - Intergenic
1010899517 6:81408811-81408833 GCTGGCTTTCTTCAAATATCTGG - Intergenic
1011481006 6:87793642-87793664 GTTGTTTTTCTTGAAGTGACAGG - Intergenic
1011716464 6:90110650-90110672 GTTGTTTTTCTTGAAGTATCAGG + Intronic
1012117461 6:95320943-95320965 ATTTGTCTTTTTAAAATGTCAGG - Intergenic
1013400036 6:109784904-109784926 GTTGGTTTTCTAAAATTTACTGG - Intronic
1015171324 6:130257495-130257517 ATGGGTTTTCTTATACTGTCAGG - Intronic
1016366922 6:143329149-143329171 TTTGGTTTTCTTAACTTGTTAGG - Intronic
1016636447 6:146297584-146297606 TTTGTTTTTCTTCAAATGGCAGG + Intronic
1017127295 6:151078135-151078157 GTAGATTTTTCTAAAATGTCTGG - Intronic
1017249822 6:152267992-152268014 TTTACTTTTCTTCAAATGTCAGG + Intronic
1017578968 6:155839434-155839456 TTTGGTGTTCTGATAATGTCTGG - Intergenic
1017851719 6:158309980-158310002 GTTGTTTTCCTTAAAGTGGCAGG + Intronic
1018841992 6:167524065-167524087 GATGGTTTACTTCAAATGTGGGG + Intergenic
1020240034 7:6387020-6387042 GTTTGTTTACTTTAAATTTCAGG + Intronic
1021675702 7:23078784-23078806 GTTGGATGACTTAAAATGTTTGG + Intergenic
1021929537 7:25565903-25565925 TATGCTTTTCTTAATATGTCTGG - Intergenic
1023335287 7:39162785-39162807 GTTTTATTTATTAAAATGTCTGG - Intronic
1023613738 7:41997250-41997272 GCTGGACTTCTCAAAATGTCAGG - Intronic
1023673740 7:42607582-42607604 TCTGGTTTTGTTAACATGTCAGG + Intergenic
1026057689 7:66998989-66999011 AGGGATTTTCTTAAAATGTCAGG - Intronic
1026660939 7:72301899-72301921 ACTGGTTTTCTTGAAGTGTCTGG - Intronic
1026720419 7:72826039-72826061 AGGGATTTTCTTAAAATGTCAGG + Intronic
1028626070 7:92879071-92879093 GTTGTTATTCTTTAAATGTTTGG - Intergenic
1028695262 7:93703062-93703084 GTTTGTTTCCTTGAAATGACAGG - Intronic
1029314433 7:99698505-99698527 GCAGGTTATCTTAAACTGTCAGG - Intronic
1029435404 7:100561527-100561549 GGAGGCTTTCTTAAAATGACAGG + Intronic
1029661952 7:101968363-101968385 GCTGCTTTTGTTAAAGTGTCTGG + Intronic
1029781545 7:102739461-102739483 ATTATTTCTCTTAAAATGTCTGG + Intergenic
1030391103 7:108930247-108930269 GTTTGTTTTCTTTCAATGTCAGG + Intergenic
1031396266 7:121278056-121278078 AGTGGTTTTGGTAAAATGTCGGG + Intronic
1031593983 7:123626598-123626620 GTTTGTTTTATTAAAATCTTTGG - Intronic
1031643316 7:124191926-124191948 ATTGAACTTCTTAAAATGTCAGG + Intergenic
1032605841 7:133351270-133351292 TTTGGTTTTCTTTAAATGTTTGG + Intronic
1033143140 7:138845835-138845857 GTTGTTTTTCTTGAAGTGACAGG + Intronic
1033356723 7:140606370-140606392 GTATGTTTTCTTAAAATTTTTGG - Intronic
1033532005 7:142273637-142273659 GCTGGATTTCCTAAAATGTTGGG - Intergenic
1035352757 7:158258080-158258102 TTTGGGTCTCTTAAACTGTCAGG - Intronic
1036591324 8:10171330-10171352 GATAGTGCTCTTAAAATGTCAGG - Intronic
1037009942 8:13829156-13829178 GTTCATTTTCTGAGAATGTCGGG + Intergenic
1037322978 8:17661305-17661327 CTTGCTTCTCTTAAAATTTCCGG + Intronic
1038973191 8:32660775-32660797 GTTGGTGTTCATAAAGTGTTTGG + Intronic
1039177060 8:34820738-34820760 GCTGGTTTCCTGAAAAGGTCAGG - Intergenic
1040322368 8:46323081-46323103 GTAGGTTTTATTAAGATGTTTGG - Intergenic
1040632417 8:49230666-49230688 TTTTGTCTTCTTAATATGTCTGG - Intergenic
1040790726 8:51225924-51225946 TTAAGTTTTCTTTAAATGTCTGG - Intergenic
1041216254 8:55604306-55604328 GTAGGTGTTCTTAAGGTGTCAGG - Intergenic
1042163034 8:65917027-65917049 ATTGGTATTCTTTAAATGTTTGG - Intergenic
1042801655 8:72724478-72724500 GCTGTTTGTCTTAAAATATCTGG - Intronic
1043791303 8:84470413-84470435 GGTGGTTTTCTTGAAAAGTGTGG + Intronic
1044105127 8:88195186-88195208 GTTTGTTTTCTGAAAGTGGCTGG - Intronic
1044776155 8:95690513-95690535 TTTGTTTTTCCTAAAATTTCTGG + Intergenic
1045188871 8:99864055-99864077 TTGGGTTATCTCAAAATGTCTGG + Intronic
1045219139 8:100179968-100179990 GTTGTTTTTCTTAAAGCGACAGG - Intronic
1045237280 8:100364342-100364364 GTTTGATTTCTTAAAAATTCAGG - Intronic
1045405577 8:101863548-101863570 GTTGGTATTCTTAAAATAACAGG + Intronic
1045892388 8:107172241-107172263 TTTTATTTTCTTAAAATATCTGG - Intergenic
1045984902 8:108238702-108238724 GTTGCTTTTCTAAAAATATCTGG + Intronic
1047051000 8:121113402-121113424 GTTGGTTTGTATAAAAAGTCTGG - Intergenic
1047086317 8:121520027-121520049 TTCTGTTTTCTTATAATGTCTGG - Intergenic
1047313359 8:123710738-123710760 GCTGTCTTACTTAAAATGTCAGG + Intronic
1047432235 8:124802877-124802899 GATGGTTTTCTTGACATGGCAGG + Intergenic
1048569107 8:135636032-135636054 GTTGTTTTACTTAAAGTGACAGG + Intronic
1048762519 8:137811137-137811159 GTTGGTTTTCAAAACATGTTAGG - Intergenic
1048942576 8:139414460-139414482 GTGGGATTTCATTAAATGTCTGG - Intergenic
1050171297 9:2820858-2820880 GTAGGTGTTCTTTAAATGTTTGG - Intronic
1050412208 9:5378162-5378184 GTTGGTTTCCCTCAAATGTCTGG - Intronic
1050810809 9:9744842-9744864 GTTGGTATTATTAAAATTGCTGG - Intronic
1050881445 9:10704980-10705002 GTTGGTTTTGTGAAAGTGTTTGG + Intergenic
1051435794 9:17030039-17030061 GTTGTTTACCTTAAAATGACAGG + Intergenic
1051454515 9:17239439-17239461 GATGGTGTTCTTAAAATACCAGG + Intronic
1052602288 9:30649861-30649883 ATTTTTTTTCCTAAAATGTCTGG + Intergenic
1053122756 9:35558806-35558828 GTTGGGTTTCTTAATTTCTCTGG + Intronic
1053253735 9:36596950-36596972 GTTGTTTCTGTTAAAAAGTCCGG - Intronic
1054856470 9:69904993-69905015 GATGATTTGCTTAAAATCTCAGG - Intronic
1055423179 9:76165108-76165130 TTTGGTTTTCTTTAGATGTTTGG - Intronic
1055683923 9:78749491-78749513 ATAGGTTTTCTTTAAATGTTTGG + Intergenic
1058917607 9:109582678-109582700 GTTGTTTTTCTTGAAATGACAGG - Intergenic
1060407529 9:123380206-123380228 GGTTGTTTTCTTAAATGGTCGGG + Exonic
1060489957 9:124076277-124076299 GTTGATTTCCTTAAAGTGACAGG + Intergenic
1060774285 9:126359364-126359386 TGTGGTTTTCTTATAATATCTGG + Intronic
1203732940 Un_GL000216v2:107480-107502 TTTTGTTCTCTTAAAATTTCTGG + Intergenic
1187983100 X:24780263-24780285 ATTGCTGTTCTTTAAATGTCTGG + Intronic
1188635429 X:32424711-32424733 GCTGTTTTTCCCAAAATGTCAGG - Intronic
1188733747 X:33685447-33685469 TTTGTTTTTCTTAATAAGTCTGG + Intergenic
1188897200 X:35683944-35683966 TTTGTTTTTCAGAAAATGTCAGG - Intergenic
1189183346 X:39026396-39026418 TTTGTTCTTCTTAAAATGTTTGG + Intergenic
1190469939 X:50768923-50768945 GTTGGGTTTCTTGAACTCTCAGG + Intronic
1191230569 X:58090378-58090400 GTTTATTTTGTTAAAATGTCTGG - Intergenic
1191243388 X:58206852-58206874 GTCTGTCTTGTTAAAATGTCTGG - Intergenic
1191245897 X:58228097-58228119 GTTTCTTTTGTTAGAATGTCTGG - Intergenic
1191967261 X:66772980-66773002 ATTGGTATTCTTTAAATGTTTGG + Intergenic
1192354862 X:70392191-70392213 GTCGTTTCTCTTCAAATGTCTGG + Intronic
1194273684 X:91853226-91853248 GGTGGTTTTCTTCTAATTTCAGG + Intronic
1194491703 X:94558489-94558511 GTTGTTTTTCTTAACAAGCCTGG - Intergenic
1194614255 X:96082220-96082242 GTTGGGTTTTATAAAATGACAGG + Intergenic
1194747963 X:97650308-97650330 CATGGTTTTCTTAAGATTTCTGG + Intergenic
1194798850 X:98246090-98246112 TTTGGTTTCCTTAAAATTTTTGG + Intergenic
1195592157 X:106641930-106641952 TTTGGTTTCTTTAAAGTGTCAGG + Intronic
1196148038 X:112341522-112341544 GTTGGTTTTATTAAATTGACTGG + Intergenic
1196882993 X:120216277-120216299 GTTTATATTCTTAAAATGTTTGG - Intergenic
1198426448 X:136525651-136525673 GTCGGTTTTTCTTAAATGTCTGG + Intergenic
1198506351 X:137304844-137304866 GTTGCTTTTGTTAATATGTTGGG - Intergenic
1198654839 X:138902094-138902116 CTGGTTTTTCTTAAAATGTCAGG - Intronic
1198845950 X:140910820-140910842 GTAGATTTTCTTAACAAGTCTGG + Intergenic
1199232825 X:145458666-145458688 TTTGCTTTTCTTAATAAGTCAGG - Intergenic
1200590925 Y:5074650-5074672 GGTGGTTTTCTTCTAATTTCAGG + Intronic
1202628005 Y:56880189-56880211 TTTTGTTCTCTTAAAATTTCTGG - Intergenic