ID: 1126743211

View in Genome Browser
Species Human (GRCh38)
Location 15:51799148-51799170
Sequence ATGGGGAAGGGTCTGTGATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 459
Summary {0: 1, 1: 0, 2: 5, 3: 22, 4: 431}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126743198_1126743211 6 Left 1126743198 15:51799119-51799141 CCATGATGTAGAGCCCTGCTCCT 0: 1
1: 0
2: 2
3: 22
4: 211
Right 1126743211 15:51799148-51799170 ATGGGGAAGGGTCTGTGATGGGG 0: 1
1: 0
2: 5
3: 22
4: 431
1126743204_1126743211 -8 Left 1126743204 15:51799133-51799155 CCTGCTCCTCTGGCCATGGGGAA 0: 1
1: 0
2: 1
3: 26
4: 356
Right 1126743211 15:51799148-51799170 ATGGGGAAGGGTCTGTGATGGGG 0: 1
1: 0
2: 5
3: 22
4: 431
1126743203_1126743211 -7 Left 1126743203 15:51799132-51799154 CCCTGCTCCTCTGGCCATGGGGA 0: 1
1: 0
2: 2
3: 32
4: 287
Right 1126743211 15:51799148-51799170 ATGGGGAAGGGTCTGTGATGGGG 0: 1
1: 0
2: 5
3: 22
4: 431

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126743211 Original CRISPR ATGGGGAAGGGTCTGTGATG GGG Intronic
900438848 1:2643523-2643545 AGGAGGAGGGGTCTGTGCTGGGG - Intronic
900546160 1:3230431-3230453 ATGGGGAAGGGTCTCTTCTCTGG - Intronic
900581787 1:3413136-3413158 GTGGGGAAGGGTGTGGGTTGGGG - Intronic
900779176 1:4606404-4606426 ATGTGGATGGGTCTCTGCTGGGG + Intergenic
900910399 1:5593396-5593418 TTGGGGAAGGGTGGGTGGTGGGG - Intergenic
900914911 1:5630083-5630105 ATGCAGATGGGTCTGGGATGCGG - Intergenic
900926877 1:5711481-5711503 AAGGGGATGGGACTCTGATGAGG - Intergenic
901514385 1:9735188-9735210 ATGGGGAAGGGTCAGGGCTTTGG + Intronic
901808360 1:11751611-11751633 GTGGGGAAGGGGCTGTGCTCCGG + Intronic
903021241 1:20396747-20396769 ATGGGAAAGGGTCAGGGCTGAGG + Intergenic
903068684 1:20715840-20715862 ATGGGGAAGAGCCTGAGCTGTGG + Intronic
903376694 1:22870765-22870787 AGTGGGAAGGGTCTGTGCTTTGG + Intronic
903681576 1:25100938-25100960 GTGGGGGAGGGCCTTTGATGTGG - Intergenic
904897025 1:33825047-33825069 CTGGGGAATGGTCTGGAATGTGG - Intronic
904947979 1:34213258-34213280 GCAGGGAAGGTTCTGTGATGGGG - Intronic
905250676 1:36646367-36646389 ATGGGGCAAGGTCTGTGCAGAGG - Intergenic
905865195 1:41372623-41372645 ATGAAGGAGGGTCTGTGAAGGGG + Intronic
906144838 1:43553816-43553838 ATGGGGCAGGGTCAGTGCTTCGG + Exonic
906480179 1:46194510-46194532 ATGGGGCAGGGCCTGGGCTGGGG - Intronic
906783071 1:48589886-48589908 CTGGGGAAAGGTCTGACATGTGG + Intronic
907480255 1:54740858-54740880 TTGGGGAAGGGGTGGTGATGGGG - Intronic
908082314 1:60594265-60594287 ATGGGGAACAGTTTGTGATGGGG + Intergenic
909331822 1:74422536-74422558 ATGAGTAAGGGACTGTGAAGTGG - Intronic
909827464 1:80143507-80143529 CTGGGGAAGTGGGTGTGATGTGG - Intergenic
910198992 1:84678416-84678438 TTGGAGAAGGTTATGTGATGGGG - Intronic
911293448 1:96084752-96084774 ATGGGGACAGGTTTGGGATGAGG - Intergenic
912504471 1:110146673-110146695 GGGGGGAAGGGTGTGAGATGAGG + Intergenic
912631974 1:111254200-111254222 AAGGGGAATGGGCTGGGATGAGG + Intergenic
912669962 1:111616474-111616496 ATGGGGAAGGGTGAGTAAGGCGG - Intronic
915332952 1:155124995-155125017 ATGAGGAAGGGACTGGGAGGGGG + Intergenic
915524506 1:156467672-156467694 ATGGAGAAGGGGGTGTGAGGGGG + Intronic
916568864 1:166008021-166008043 AGGATGAAGGGTCTGTGCTGTGG + Intergenic
917210074 1:172622137-172622159 ATGGGGATGAATCTGTGAGGTGG + Intergenic
917575413 1:176316264-176316286 ATGGGATGGGGTCTGTGAGGAGG - Intergenic
918107625 1:181427432-181427454 ATGAGGAAGAGGCTGAGATGAGG - Intronic
918733426 1:188027406-188027428 ATAGGGAAGAGTGTGTGATGTGG - Intergenic
920367416 1:205455489-205455511 ATGAGGAAGGGGCTGTAAAGGGG - Intronic
920786985 1:209051202-209051224 AGGATGAAGGGTCTGTGCTGTGG - Intergenic
920910186 1:210209237-210209259 GTAAGGAAGGGTCTCTGATGTGG - Intergenic
921035316 1:211372374-211372396 ATGGGGATGGGTCAGGGAGGGGG + Exonic
922161700 1:223083004-223083026 CTGGGGAGGAGTTTGTGATGAGG - Intergenic
923199428 1:231697056-231697078 AGTGGGAATTGTCTGTGATGAGG + Intronic
924384294 1:243487886-243487908 CTGGGGAAGGGTCAGGGCTGGGG + Intronic
924459513 1:244246208-244246230 AGGGGGAAGGTGCTCTGATGAGG - Intergenic
924592934 1:245420848-245420870 ATGGGGAAGGGGCTCTGATTAGG + Intronic
1062800858 10:379252-379274 ATGGGGAAGGGGTTGGGGTGGGG - Intronic
1062821164 10:535433-535455 CTGGGGAAGGATCTGTTCTGTGG - Intronic
1063042754 10:2359762-2359784 AAGGGGAAGGTGGTGTGATGGGG + Intergenic
1064464064 10:15562164-15562186 GTGGGGAGGGGTTTGGGATGGGG + Intronic
1066178397 10:32935693-32935715 ATGGGCGAGGGTCTGTGGAGAGG - Intronic
1067054298 10:43042189-43042211 ACGGGGAAGGGCCTGCCATGAGG - Intergenic
1067081918 10:43216952-43216974 ATGGGGAAGGGTGTGTAAGATGG - Intronic
1067538788 10:47136659-47136681 CTGCAGAAGGGTCAGTGATGAGG - Intergenic
1069224959 10:65931642-65931664 TTGGAGAAGTGTCTGTGATCGGG + Intronic
1069533637 10:69237078-69237100 AAGGGGAAGGCTGTGTGAGGAGG + Intronic
1070503026 10:77089384-77089406 ATGGAGATGGGGCTGTCATGGGG - Intronic
1070800252 10:79241060-79241082 ATGGGGAAGGGTTTGTGTTCTGG + Intronic
1070870624 10:79748473-79748495 AGGATGAAGGGTCTGTGCTGTGG - Intergenic
1070923309 10:80202677-80202699 ATGGGGAAGCGTCTGTGTAAGGG - Intronic
1071479782 10:86056539-86056561 ATGGGGAAGGGTTTGGGAATGGG - Intronic
1071637543 10:87270685-87270707 AGGATGAAGGGTCTGTGCTGTGG - Intergenic
1071657702 10:87467266-87467288 AGGATGAAGGGTCTGTGCTGTGG + Intergenic
1072263207 10:93702362-93702384 AAGGGAAAGGGTGTGTGAGGAGG - Exonic
1072451202 10:95541105-95541127 AAGGGGAAGGGTCTAGGCTGAGG - Intronic
1072638499 10:97193210-97193232 ATGGAGAAGTGGGTGTGATGGGG - Intronic
1072638515 10:97193278-97193300 GTGGAGAAGGGGGTGTGATGGGG - Intronic
1072900797 10:99404772-99404794 TAGGGGCAGGGTCTGTGCTGAGG - Intronic
1073328793 10:102657604-102657626 ATGGGAAAGTGTCTGTGTCGAGG + Exonic
1073546644 10:104354644-104354666 ATGGGGGAAGGGCTCTGATGGGG - Intronic
1074408534 10:113202085-113202107 ATGGGAAGGACTCTGTGATGTGG + Intergenic
1076100626 10:127774812-127774834 CTGGGAAAGGGTGTGTAATGAGG - Intergenic
1076191528 10:128486815-128486837 TTGGAGAAGGGTATGTGATATGG - Intergenic
1076584027 10:131533155-131533177 ATGGGGAAGCGCCTGTGCAGAGG - Intergenic
1076614058 10:131744755-131744777 AAGGTGAAGCGTCTGTGACGAGG - Intergenic
1076921850 10:133458421-133458443 CTGGGGCACCGTCTGTGATGCGG + Intergenic
1077187879 11:1243555-1243577 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188300 11:1245226-1245248 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188835 11:1247326-1247348 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077189254 11:1248997-1249019 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077239445 11:1502899-1502921 AAGGGGAAGGGCGTGGGATGAGG + Intergenic
1077411206 11:2404779-2404801 TTGGGTGAGGGTCTGTGGTGAGG + Exonic
1077870886 11:6260335-6260357 TTGGGGAAGGGGCTGTGCTTTGG - Intronic
1078428947 11:11272514-11272536 CTGGGGAAGGATCAGAGATGAGG - Intronic
1078860078 11:15238864-15238886 ATGGGGAAGGCTCCATGCTGGGG + Intronic
1079464914 11:20720662-20720684 TGAGGGAAGGGTCTGTTATGGGG + Intronic
1081908165 11:46682267-46682289 GTGGGGAAGGGGCTGTGACGTGG - Intronic
1082000199 11:47389947-47389969 CAGGGGAAGGGTCTGGGGTGGGG - Intergenic
1083302083 11:61744707-61744729 ATGGGGAAGGGTGTGGAGTGGGG + Exonic
1083717254 11:64584601-64584623 ATGGGGAAGCGTGGGTGCTGGGG - Intergenic
1083895346 11:65617016-65617038 GTGGGGTAGGGGCTGTGCTGGGG + Intronic
1084092716 11:66889172-66889194 GTGGGGCAGGGTTTGAGATGGGG + Intronic
1084592180 11:70097206-70097228 ATGGGGCAGGGACTGGGCTGTGG - Intronic
1084661746 11:70550266-70550288 ATGGGGAAAGGGCTGTAAGGAGG - Intronic
1085532543 11:77200599-77200621 ACGGGGCATGGTCTGTGATATGG - Intronic
1086949125 11:92873291-92873313 TCGGGGAAGTGGCTGTGATGTGG - Intronic
1087686857 11:101274749-101274771 CTGGTGGAGGGTCTGTGAGGAGG + Intergenic
1088884280 11:113994773-113994795 ATGGGCACAGGTGTGTGATGGGG - Intergenic
1090431823 11:126652701-126652723 AAGGGTAAGGGTAGGTGATGGGG - Intronic
1090532530 11:127605932-127605954 ATGGTAAATGGTCTGTAATGAGG - Intergenic
1090964113 11:131583281-131583303 ATGGGGAAGGTACTGCTATGAGG - Intronic
1091615924 12:2051743-2051765 ATGGGGAAGGCTGTGTGAGGAGG + Intronic
1091709946 12:2732620-2732642 ATGGTGCAGGGTCTCTGAGGAGG - Intergenic
1092260869 12:6952661-6952683 GTGGGGATGGGTCTGTCCTGTGG + Intronic
1092766326 12:11856083-11856105 AAGAGGAAGGATCTGTGAGGAGG - Intronic
1092927105 12:13281307-13281329 ATGGTGAGGGCTCTGAGATGGGG - Intergenic
1093109560 12:15132991-15133013 ATGGGGGAGGCTGTGTGTTGGGG - Intronic
1093121111 12:15272851-15272873 GTGGGGAAGGGAATGTGATCAGG - Intronic
1093454088 12:19347551-19347573 ATGGTAAAGGGGCTGGGATGTGG + Intronic
1093518932 12:20025154-20025176 ATGGGGAGGGGGGTGTGAAGGGG + Intergenic
1093818152 12:23575755-23575777 ATGGGGAGAGGTGGGTGATGTGG + Exonic
1094091476 12:26654908-26654930 CTGGCTCAGGGTCTGTGATGGGG - Intronic
1094626011 12:32124861-32124883 ATGGGGAAAGCTGTGTTATGGGG + Intronic
1095956887 12:47812098-47812120 CTTGGGGAGGGTCTGGGATGGGG - Intronic
1096562283 12:52444797-52444819 ATGGGAAAGAGTCTCTGCTGTGG + Intergenic
1096794972 12:54071028-54071050 ATGGGGCATGGTGTATGATGAGG + Intergenic
1099977417 12:89560421-89560443 ATGGGGATGGGGTTGGGATGCGG - Intergenic
1101575110 12:105990155-105990177 AGAGGGAAGGGGCTGTGGTGAGG - Intergenic
1101795190 12:107966553-107966575 ATGCGGATTGGTGTGTGATGCGG + Intergenic
1101989356 12:109471732-109471754 ATGGGTGAGGGTGTGTGTTGAGG + Intronic
1102212841 12:111139340-111139362 AAGGAGAGGGGTATGTGATGGGG + Intronic
1103738242 12:123074241-123074263 TTGGGAAAGTGTCTGTGAAGTGG + Intronic
1104050361 12:125190376-125190398 ATGGGAAAGGGGTGGTGATGGGG + Intronic
1104050447 12:125190658-125190680 ATGGGGAAGGGGTGGTGATGGGG + Intronic
1104050542 12:125190934-125190956 ACGGGGAAGGGGTGGTGATGGGG + Intronic
1104237889 12:126957211-126957233 AAGGGGAGGGGTGAGTGATGAGG - Intergenic
1104602046 12:130161261-130161283 ATTGGGGCGGGTCTGTGACGGGG - Intergenic
1104637148 12:130445020-130445042 GTGGGGAAGGGTCAGAGAGGAGG + Intronic
1108072551 13:46643128-46643150 ATGGGCAAGGGGCTGTGAAAAGG - Intronic
1108269510 13:48745868-48745890 AGGGTGAAGGGTCTGTGAAAGGG + Intergenic
1108555675 13:51589315-51589337 AGTGGGAAGGGGCTGGGATGAGG + Intronic
1108640261 13:52377145-52377167 ATGGGGCTTGGTCTGTCATGTGG - Intronic
1109527804 13:63599158-63599180 ATGGACAAAGGTCTGTGATCTGG - Intergenic
1110228720 13:73146531-73146553 ATGGGCAAGGCTCTGTGGTAGGG + Intergenic
1110832305 13:80045422-80045444 AGGATGATGGGTCTGTGATGAGG - Intergenic
1112090491 13:96078220-96078242 ATGGGGAAGGGTCAGTCTTTGGG - Intergenic
1112371006 13:98793251-98793273 TTGGGGAAGTTTCTGTGATACGG - Intergenic
1113626999 13:111854860-111854882 ATGCTGAAGGGCCTGTGATCTGG + Intergenic
1113966642 13:114156347-114156369 GTGGGGAAGGGTGGGTGCTGGGG + Intergenic
1114356441 14:21914510-21914532 GTGGGGAAAGGTCTGGGAAGAGG + Intergenic
1116431782 14:44854386-44854408 ATGGGGATAGGTGTGTGTTGGGG - Intergenic
1117677667 14:58170976-58170998 ATGGGGAAGGGTATGGGAATGGG + Intronic
1118619190 14:67599468-67599490 TTGGGGAAGGGTTTGGGAGGAGG + Intronic
1118910764 14:70060310-70060332 ATGTGGGGGGGTCTGGGATGGGG - Intronic
1121631294 14:95423513-95423535 ATGGGGATGGGGATTTGATGGGG + Intronic
1121631320 14:95423598-95423620 ATGGGGATGGGGATTTGATGGGG + Intronic
1121631326 14:95423615-95423637 ATGGGGATGGGGATTTGATGGGG + Intronic
1121631332 14:95423632-95423654 ATGGGGATGGGGTTTTGATGGGG + Intronic
1121631338 14:95423649-95423671 ATGGGGATGGGGATTTGATGGGG + Intronic
1121631344 14:95423666-95423688 ATGGGGATGGGGATTTGATGGGG + Intronic
1121631354 14:95423700-95423722 ATGGGGATGGGGATTTGATGGGG + Intronic
1121631360 14:95423717-95423739 ATGGGGATGGGGATTTGATGGGG + Intronic
1121631366 14:95423734-95423756 ATGGGGATGGGGATTTGATGGGG + Intronic
1121631372 14:95423751-95423773 ATGGGGATGGGGTTTTGATGGGG + Intronic
1121631378 14:95423768-95423790 ATGGGGATGGGGATTTGATGGGG + Intronic
1121631384 14:95423785-95423807 ATGGGGATGGGGATTTGATGGGG + Intronic
1121631403 14:95423853-95423875 ATGGGGATGGGGATTTGATGGGG + Intronic
1121631409 14:95423870-95423892 ATGGGGATGGGGTTTTGATGGGG + Intronic
1121631415 14:95423887-95423909 ATGGGGATGGGGATTTGATGGGG + Intronic
1121631425 14:95423921-95423943 ATGGGGATGGGGATTTGATGGGG + Intronic
1121631431 14:95423938-95423960 ATGGGGATGGGGATTTGATGGGG + Intronic
1121631437 14:95423955-95423977 ATGGGGATGGGGATTTGATGGGG + Intronic
1122054819 14:99088223-99088245 AAGGGGATGGGTTTGTGATCAGG - Intergenic
1122297578 14:100713955-100713977 AGGTGGCAGGGTCTGGGATGGGG + Intergenic
1122548482 14:102537964-102537986 CTGGGGCAGGGTCAGGGATGTGG - Intergenic
1126544047 15:49853258-49853280 ATGGGGAAGGGCATGTTAGGTGG + Intergenic
1126743211 15:51799148-51799170 ATGGGGAAGGGTCTGTGATGGGG + Intronic
1127368194 15:58310770-58310792 TTGGGGAAGTGGCTGTGCTGTGG - Intronic
1127847911 15:62887541-62887563 AAGGGGAAGAGTCCGTGATAAGG + Intergenic
1128457253 15:67838570-67838592 ATGTGGAAGGGGGTGTTATGGGG - Intergenic
1128886164 15:71290003-71290025 CTGGGGAAGGGTAGGTGAGGAGG - Intronic
1130866057 15:87934149-87934171 ATGGAAAATGGTCTGTGAAGAGG + Intronic
1131265516 15:90913005-90913027 ATGAGGAAGGGTCTGGAAGGAGG + Intronic
1132480288 16:163657-163679 ATGGGGAGGGGACAGTGAGGAGG + Intronic
1132532989 16:462765-462787 CTGGGGAAGGGACGGTGCTGGGG - Intronic
1132533001 16:462799-462821 CTGGGGAAGGGACGGTGCTGGGG - Intronic
1132634635 16:937618-937640 AAGGGGCAGGGCCTGTGCTGGGG - Intronic
1132729324 16:1353304-1353326 ATGTGTTAGGGTCTGTGCTGGGG + Intronic
1133751554 16:8729959-8729981 ATGGGGAAGTATCTGAGAAGGGG + Intronic
1134048992 16:11123814-11123836 ATGGGGAAGGGCTTGGAATGGGG - Exonic
1135047605 16:19168192-19168214 ATGGGGAAGGGGGTGGGAGGGGG - Intronic
1135359172 16:21796767-21796789 ATGGGGATGGGGATGCGATGGGG + Intergenic
1135457724 16:22613204-22613226 ATGGGGATGGGGATGCGATGGGG + Intergenic
1135978284 16:27125793-27125815 GTGGGGAAGAGTCTGGAATGTGG - Intergenic
1136070521 16:27784519-27784541 ATGGGAGAAGCTCTGTGATGGGG - Intergenic
1136233974 16:28903473-28903495 ATGGGGAAGGGGCTGTGGTGGGG - Intronic
1136272042 16:29154028-29154050 CTGGGAAAGGCTCTTTGATGAGG + Intergenic
1137376980 16:47960205-47960227 ATGTGGGAGGGTATGGGATGGGG + Intergenic
1137581295 16:49635040-49635062 ATGTGGAAGGCCCTTTGATGTGG - Intronic
1137584920 16:49658608-49658630 CTGGGGAAGGCTCTGGGATATGG + Intronic
1138309912 16:56014702-56014724 ATGGGGCAGGAGCTGTGAGGGGG + Intergenic
1138454895 16:57115588-57115610 ATGGGGGAGGGTGTGGGGTGGGG - Intronic
1139317120 16:66082263-66082285 CTGGGGAGGGGTCTGAGATTCGG - Intergenic
1140447038 16:75037907-75037929 ATGTGGAAAAGTCTATGATGAGG + Intronic
1140995423 16:80254172-80254194 TTGGGGCAGGGGCAGTGATGTGG + Intergenic
1141782602 16:86173816-86173838 GTGGGGCAGGGTCGGGGATGAGG + Intergenic
1142075641 16:88116009-88116031 CTGGGAAAGGCTCTTTGATGAGG + Intronic
1142274132 16:89107052-89107074 ATCTGGCAGGGTCTGTGCTGTGG + Intronic
1143265361 17:5632736-5632758 ATGGGGAAGGTGCTCTGAGGAGG + Intergenic
1146183847 17:30712462-30712484 AAGGGGAAGTGTCTGGCATGTGG - Intergenic
1146657837 17:34645485-34645507 ATGTGGAAGGGTCTGTCAGGTGG - Intergenic
1146790254 17:35746991-35747013 ATGGGGAAGAGACAGGGATGGGG - Intronic
1148070954 17:44908221-44908243 ATGGGGAGGGGGGTGCGATGGGG - Intronic
1148200391 17:45746381-45746403 ATGGGCCAGGGTCAGTGCTGGGG + Intergenic
1148977759 17:51544554-51544576 CTGGGGAGAGGTGTGTGATGAGG - Intergenic
1150223709 17:63511284-63511306 ATGGCCAGGGGTCAGTGATGAGG - Intronic
1150495799 17:65607057-65607079 ATGAGGAAGAGTCTGGGTTGTGG + Intronic
1151141369 17:71995660-71995682 GTGGGGAAGGGTCAGTGATGTGG - Intergenic
1151142907 17:72012095-72012117 ATGGGGATGGATCTGTGGTCGGG - Intergenic
1151870547 17:76833673-76833695 ATGGTGGAGGGTCTGTTGTGAGG + Intergenic
1152677732 17:81650416-81650438 ATGGGACAGGGCCTGTGGTGGGG - Intergenic
1153439291 18:5099358-5099380 AGTGGAAAGGGTCTGAGATGAGG - Intergenic
1153737012 18:8081731-8081753 CTGTGGATGGGTCTGAGATGGGG + Intronic
1154199485 18:12289360-12289382 ATGGGGAAGGGGCTGGAAGGAGG + Intergenic
1155509276 18:26560634-26560656 GTGGGGAAGGGTGTGTTCTGGGG + Intronic
1157279220 18:46334607-46334629 TAGGGGAAGGGGCTGTGATTTGG - Intronic
1157442658 18:47722435-47722457 CTGGGGAAGAGACAGTGATGGGG - Intergenic
1157504862 18:48219052-48219074 ATGGGAAGGGGCTTGTGATGGGG - Intronic
1157590114 18:48831416-48831438 ATGGGGAAGGGATTGTTGTGGGG + Intronic
1158342464 18:56481298-56481320 ATGGGCAGGGGTTTGTTATGTGG - Intergenic
1158429250 18:57369411-57369433 TTGGGGAAGGTTCTATGAGGAGG - Intronic
1158793101 18:60806099-60806121 ATGGGGAAAAGTATATGATGGGG - Intergenic
1158793107 18:60806134-60806156 ATGGGGAAAAGTATATGATGGGG - Intergenic
1160797901 19:954202-954224 GTGGGGAAGGGTCTGGCAGGAGG + Intronic
1161512646 19:4679958-4679980 ATGGGGAAGGGTCTGAGGCCAGG + Intronic
1162096855 19:8315263-8315285 CCGGTAAAGGGTCTGTGATGAGG + Intronic
1163481697 19:17560323-17560345 ATGGGGAGGCAGCTGTGATGTGG - Intronic
1163584560 19:18156795-18156817 ATGGCCAAGGGTCTTTGAAGAGG - Intronic
1164945098 19:32286724-32286746 ATGGGGCAGAGTGTGTGAGGGGG + Intergenic
1165191535 19:34067890-34067912 AAGGGAAAGGGCCAGTGATGTGG - Intergenic
1165782236 19:38441417-38441439 ATGGGACAGGGCCTGAGATGCGG + Intronic
1165810300 19:38607948-38607970 ATGGGGAGGGGGCTGGAATGTGG - Intronic
1165894606 19:39133975-39133997 CTGGGGACGGGTCTGTGGAGGGG - Intronic
1166487524 19:43225954-43225976 ATGGGGAAGGGTATGTGTCCTGG + Intronic
1166494370 19:43287843-43287865 ATGGGGAAGGGTATGTGTCCTGG + Intergenic
1166983828 19:46648408-46648430 ATGTGGAAGGGTCAGTGGTTGGG + Exonic
1167602099 19:50460200-50460222 ATGGGGAAGAGCCGGTGAGGTGG + Intronic
1167644103 19:50696416-50696438 GTGGGGATGGGTCGGGGATGGGG - Intronic
1167780815 19:51597800-51597822 GAGGGGAGGGGTCAGTGATGGGG - Intergenic
1168411236 19:56141504-56141526 ATGGGGAAGGGGCTGGGAGAGGG + Intronic
926710071 2:15872175-15872197 ATGTGGCAGGTTCTGTGCTGAGG + Intergenic
926761720 2:16284138-16284160 ATGAGGCAGGTTCTGGGATGTGG - Intergenic
926885773 2:17597217-17597239 CTGGGGAAGGGTTTGTGCTTAGG - Intronic
927981106 2:27375725-27375747 AGGGGGAAGGGCCTGGGTTGGGG + Intronic
929928899 2:46237068-46237090 CTGGGGAAGGGTGTGGGGTGAGG - Intergenic
930182969 2:48383257-48383279 GTGTGGAAGGGACAGTGATGCGG + Intergenic
931063230 2:58554807-58554829 AAGGGGAAGGGTCTGTGGTGTGG - Intergenic
931635010 2:64332975-64332997 AAGGGGGAGAGTTTGTGATGGGG - Intergenic
933733133 2:85473252-85473274 ATGGTGAAGGGGCTGGGATCAGG - Intergenic
935292246 2:101620533-101620555 CTGGGGAAGGCTCTGTGTGGAGG - Intergenic
939027510 2:137031769-137031791 ATGGATAAGGGAATGTGATGAGG - Intronic
942181959 2:173388636-173388658 ATGGGCCAGGGCCTGTGCTGAGG - Intergenic
943956682 2:194200614-194200636 ATGGGGAAGGGCTTGGGAAGTGG - Intergenic
946640895 2:221782557-221782579 CTGGGAAGGGGTGTGTGATGTGG - Intergenic
947619094 2:231577190-231577212 CCCGGGAAGGGTCTGTGCTGAGG + Intergenic
948035266 2:234853203-234853225 ATGGGGAAGTGTCTGCTCTGGGG + Intergenic
948261148 2:236605352-236605374 ATGGTGAAGAGTACGTGATGTGG - Intergenic
948330536 2:237160866-237160888 ATGCGGAGGGGGCTGTGGTGTGG + Intergenic
948519330 2:238525462-238525484 AGGGGCATGGGACTGTGATGGGG - Intergenic
948856562 2:240732937-240732959 ATGGGGAAGGGTAAGAGATGAGG + Intronic
949052606 2:241905209-241905231 CCGGGGAAGGGACTGTGACGAGG - Intergenic
1169109573 20:3023323-3023345 GAAGGGAAGGGTCTGTGCTGAGG + Intronic
1169329129 20:4702966-4702988 ATGGGGAAGTGCCTCTGGTGGGG + Intergenic
1169649979 20:7856193-7856215 ATGGGGATGGGTCTGTTGTTTGG - Intergenic
1170587053 20:17742708-17742730 ACAGAGAAGGGTCTGTGATAGGG + Intergenic
1171029234 20:21662511-21662533 TTGGGGAAGGGTCTCTGAGCAGG + Intergenic
1171230720 20:23482048-23482070 ATGGGGAGGGGGCTGTGGTGAGG - Intergenic
1171416140 20:24981942-24981964 ATGGGGCATGGCCTGTGTTGTGG + Intronic
1172353208 20:34260196-34260218 ATGGGGAAGGGGAATTGATGAGG - Intronic
1173185346 20:40836149-40836171 ATGGGGTAGGGTCTGGAAGGAGG - Intergenic
1174151869 20:48491746-48491768 GTGGGGAGGGGTCTGTGACTGGG - Intergenic
1174583857 20:51592525-51592547 GTGGGAAAGGGTCGGTGAGGCGG + Intergenic
1175627294 20:60500256-60500278 ATGGGGATGGGGATGGGATGAGG + Intergenic
1175627496 20:60501162-60501184 ATGGGGATGGGGATGGGATGAGG + Intergenic
1175627526 20:60501287-60501309 ATGGGGATGGGGATGTGCTGAGG + Intergenic
1175627558 20:60501412-60501434 ATGGGGATGGGGATGTGCTGAGG + Intergenic
1175627616 20:60501610-60501632 ATGGGGATGGGGATGTGCTGAGG + Intergenic
1175902083 20:62363914-62363936 CTGGGGCAAGGTCTGAGATGGGG - Intronic
1175932238 20:62498422-62498444 GTTGGGATGGGTCTGTGTTGGGG + Intergenic
1175979992 20:62733841-62733863 AGAGGGAAGGCTCTGTGCTGGGG + Intronic
1176185771 20:63778026-63778048 CTGGGGAGGGGTCTCGGATGAGG + Intronic
1176218260 20:63958213-63958235 ATGGGGGAGGGTGGGTGCTGGGG + Exonic
1176938354 21:14893585-14893607 CTGGGGAAGGGACTGTGATGAGG - Intergenic
1176960479 21:15153755-15153777 ATGTGCAAGGGTGGGTGATGGGG + Intergenic
1179914149 21:44465323-44465345 ATGGGACAGGGGCTGTGGTGTGG + Intergenic
1180883149 22:19220921-19220943 ATGGGGAAGGGCTTGTGTAGAGG + Intronic
1181430363 22:22877812-22877834 AAAGGGAAGGGGCTGAGATGGGG - Intronic
1181751030 22:24989390-24989412 ATGGGGAGGGCTCTCTGAGGAGG - Intronic
1182485303 22:30635569-30635591 ATGGGGGAGGGGCTGTGAGCGGG + Intergenic
1182553897 22:31118375-31118397 TTGGGGATTAGTCTGTGATGGGG + Intronic
1183094538 22:35544232-35544254 TTGGGGAGGGGGCTGTCATGGGG + Intronic
1183593924 22:38798314-38798336 ATGGAGATGGGACTGTGGTGTGG - Intergenic
1184291727 22:43500945-43500967 ATGGGGGAGGGTGTGGGGTGAGG + Intronic
1184468040 22:44680401-44680423 ATGGGGAAGGATGGGGGATGGGG + Intronic
949225152 3:1685056-1685078 TTGGGAAAGGGTATGTGTTGAGG - Intergenic
949857230 3:8472897-8472919 CTGGGGAAGGGTCTCACATGGGG - Intergenic
951134086 3:19083460-19083482 AAAGGGAAGGGTCTCTGGTGAGG + Intergenic
952204073 3:31162215-31162237 ATGGGGAAGGGGCAATGAGGAGG - Intergenic
952205877 3:31181290-31181312 ATGGGGCAGGGACAGTGGTGAGG - Intergenic
953733670 3:45472330-45472352 GTGGGGAAGGGAGTGGGATGTGG + Intronic
958706431 3:97662424-97662446 ATGGGACAGGGTCTGTGACTGGG - Intronic
959657526 3:108826313-108826335 TTGGGGAGTGGGCTGTGATGGGG - Intronic
960342963 3:116497494-116497516 AGGGTGGAGGGTCTGTGCTGTGG - Intronic
961093487 3:124135739-124135761 GTGGGGAAGGGTCCTTGATGAGG + Intronic
961373959 3:126450247-126450269 ATGCGTAAGGGTCAGTGGTGTGG + Intronic
961826446 3:129601678-129601700 ATGGGGTGGGGCATGTGATGGGG - Intronic
963850669 3:150207486-150207508 ATGGGGAAGAGGCTGGGAAGGGG - Intergenic
964289136 3:155156145-155156167 ATTGGGAAGAGCCTGTGCTGTGG + Intronic
964650386 3:159004882-159004904 ATGGGGATGCGTATGAGATGGGG + Intronic
965719606 3:171647173-171647195 ATGTGCAAGGGTCTTTGATTGGG - Intronic
965824432 3:172716593-172716615 ATGGGGAAGGGTCTAGGGTTGGG + Intergenic
966669006 3:182506102-182506124 ATGTGAAAGGCTCTGTGGTGGGG - Intergenic
967864814 3:194181346-194181368 ATGGGTATGGGTCGGGGATGGGG + Intergenic
968240651 3:197080877-197080899 ATTTGGAAGGGTCTGTGAAATGG + Intronic
968830325 4:2930313-2930335 ATGGGGAGGGCTCTGTGCTGGGG + Intergenic
969447784 4:7255483-7255505 CTGGGGAGGCGGCTGTGATGGGG + Intronic
969598996 4:8164779-8164801 AAGGGGCAAGGTCTGAGATGAGG + Intergenic
970031981 4:11686237-11686259 TGGGGGAAAGGTCTGTGATATGG - Intergenic
972387087 4:38577627-38577649 ATGAGGAAGTGTGTGGGATGGGG - Intergenic
972914743 4:43861700-43861722 ATGGGTAAGGATCTGTGCTAGGG + Intergenic
975077291 4:70226856-70226878 ATCTGGAAGAGTCTGTAATGTGG + Intronic
975106138 4:70571340-70571362 AGGATGAAGGGTCTGTGATGTGG + Intergenic
976072799 4:81260801-81260823 CTGGGGAAGGTGCTGTGGTGGGG + Intergenic
977345756 4:95814143-95814165 ATGGGCATGGGTCAGTGATGAGG + Intergenic
977923044 4:102666874-102666896 AGGAGGAAGGGGCTGTGATTAGG - Intronic
979414037 4:120414847-120414869 ATTGGGAAGAGTTTGGGATGAGG - Intergenic
979483799 4:121247960-121247982 ATGGGGAAGCCTATGTGAGGAGG + Intergenic
980714679 4:136614325-136614347 ATGGGGCATGGTTTGTGATCTGG - Intergenic
980845197 4:138315939-138315961 AGAGGGAAGGGACTGTGATTAGG - Intergenic
981880486 4:149605360-149605382 ATGTGGGTGGGACTGTGATGTGG + Intergenic
982088239 4:151858038-151858060 AAGGAGAAGGGGCTGTGTTGGGG - Intergenic
982229074 4:153192122-153192144 CTGGGGAAGGGTGTGGGGTGAGG - Intronic
982646240 4:158027615-158027637 AGGAAGAAGGGTCTGTGTTGTGG - Intergenic
984392600 4:179155929-179155951 GTGGGAATGGGTCAGTGATGGGG + Intergenic
984519735 4:180787300-180787322 ATTGGGAAGGCTCTCTGAGGAGG + Intergenic
985124856 4:186683066-186683088 ATGGTGGAAGGTCTGGGATGAGG - Intronic
987547770 5:19335226-19335248 ATGGGCAAAAGTCTGTGATGAGG - Intergenic
989694953 5:44189566-44189588 ATGGGGAGAGTCCTGTGATGGGG - Intergenic
990470669 5:56112310-56112332 ATGGGGAGGGGTCTCTGAGGGGG - Intronic
990830951 5:59956277-59956299 AGGGGGAAGGGGCTGTGTTCAGG - Intronic
991015456 5:61927256-61927278 ATGGGTAGGATTCTGTGATGTGG - Intergenic
991084965 5:62640269-62640291 ATGGCAAAGTTTCTGTGATGTGG + Intergenic
991157867 5:63459478-63459500 AGGATGAAGGGTCTGTGCTGTGG - Intergenic
992994314 5:82317517-82317539 ATGAGGAAGAGTCTTTGAAGGGG - Intronic
996638270 5:125721637-125721659 ATGGGGATGGGGCAGTGAAGAGG - Intergenic
997373677 5:133382024-133382046 ATGGGGAAGGGGATGTGAAGAGG - Intronic
997901867 5:137774141-137774163 GTGGGAACGGGTCTGTGAGGGGG - Intergenic
998091090 5:139370122-139370144 ATGGGGGAGGTTCTTTGGTGTGG + Intronic
998394704 5:141811380-141811402 ATGGAGAAGAGGCTGGGATGGGG - Intergenic
998533266 5:142904643-142904665 TGGGGAAAGGCTCTGTGATGGGG + Intronic
998596158 5:143532620-143532642 ATGGGGAAGGGATTAGGATGAGG + Intergenic
999074554 5:148781731-148781753 AGGAGGGAGGGTCTGTGTTGTGG - Intergenic
999454713 5:151705604-151705626 CTGGGAAAAGGTATGTGATGGGG + Intergenic
999782283 5:154858867-154858889 AAGGGGCAGGGTGTGTGAGGAGG + Intronic
1000485753 5:161841359-161841381 ATGAGGAAGGGACTGTTATTTGG + Intergenic
1001486640 5:172124324-172124346 TGGGGGAAAGGTCTGGGATGTGG - Intronic
1002136705 5:177112273-177112295 ATGGGGAAGGGTTTGAGCAGGGG - Intergenic
1002604373 5:180373465-180373487 ATGGGGCAGGCTCTGTGGTCAGG + Intergenic
1003390492 6:5708922-5708944 AAGGGAAAGGGTCTCTGATTTGG - Intronic
1003511380 6:6783716-6783738 ATGGTGAAGGGTCTGGGGTGTGG + Intergenic
1003522092 6:6867021-6867043 ATGGGGAAGGCTGTGTGGGGTGG - Intergenic
1003544994 6:7051804-7051826 GTGGGGAAGGGACTGGGCTGGGG - Intergenic
1003960345 6:11203397-11203419 AGGGGAAAGGGACTGTGAAGAGG + Intronic
1004572018 6:16855581-16855603 ATGGGTAAGGCTCTGTAATAGGG + Intergenic
1005750767 6:28880395-28880417 ATGAGGAAGGGACATTGATGAGG - Intergenic
1005812845 6:29529862-29529884 TTGGGGAAGGGTCTGCAGTGGGG + Intergenic
1006964395 6:37967840-37967862 AAGGGGAAGTGTCTGGAATGTGG - Intronic
1007382465 6:41499608-41499630 AAGAGGAGGGGTCTGTGTTGGGG - Intergenic
1007408877 6:41650108-41650130 ATGGGGAGGGGTTTGGGGTGGGG - Intronic
1007523981 6:42474902-42474924 CTGTGCTAGGGTCTGTGATGAGG - Intergenic
1008133848 6:47750190-47750212 ATTGGGCAGGGTCTGTTATGTGG + Intergenic
1009888910 6:69656635-69656657 AGGATGAAGGGTCTGTGCTGAGG - Intergenic
1010007803 6:71014680-71014702 TTGGGGAAGGGGCTGTGATGGGG - Intergenic
1010108693 6:72198490-72198512 ATGGGGAAGGGTGTGTTGAGGGG + Intronic
1010198147 6:73260272-73260294 AAGGGGAAGGCTCTGGGCTGGGG + Intronic
1011118765 6:83926757-83926779 GTGGGGAAGTGTCAGTCATGTGG + Intronic
1011125891 6:84007223-84007245 ATGTGGAAGTCACTGTGATGTGG + Intergenic
1011361751 6:86533537-86533559 ATGGGGAAGGGAACCTGATGTGG + Intergenic
1014637617 6:123867763-123867785 AAGGGGAAGGAGCTGGGATGAGG - Intronic
1015266310 6:131295214-131295236 ATGGGGAATGCGCTCTGATGTGG + Intergenic
1016057669 6:139595515-139595537 ATGGGGGAGGGTTGGTAATGGGG + Intergenic
1018083206 6:160276639-160276661 AATGGGAAGGCTCTGTGGTGTGG - Intronic
1018641745 6:165909959-165909981 ATGGGGACAGGTGTTTGATGTGG - Intronic
1019088455 6:169502836-169502858 ATGGGTCAGTGTCTGTGGTGAGG - Intronic
1019121300 6:169806893-169806915 ATGTGGAGAGCTCTGTGATGTGG - Intergenic
1019121329 6:169807374-169807396 ATGTGGAGAGTTCTGTGATGTGG - Intergenic
1019483890 7:1279127-1279149 ATGGTGAATTGTATGTGATGTGG + Intergenic
1021695105 7:23268850-23268872 ATGGGGCGGGGCCTGGGATGGGG - Intronic
1024788637 7:52937012-52937034 GCGAGGAAGAGTCTGTGATGTGG - Intergenic
1026047355 7:66915915-66915937 ATGGGGAAGCCACTGTGATAGGG - Intergenic
1026120653 7:67534104-67534126 ATGGGGAAAGATATGTGATATGG + Intergenic
1028188420 7:87817307-87817329 ATGGAGAATGGACTGTGAGGGGG - Intronic
1028780983 7:94736212-94736234 ATGGGTAAGCTTCTGTCATGGGG - Intergenic
1028947079 7:96592221-96592243 AAGAGGAGGGGTCTGTGAGGAGG + Intronic
1029155437 7:98514257-98514279 GTGGGGAAAGGTCGGTGTTGTGG - Intergenic
1031614376 7:123864018-123864040 AGGAGGAAGGGGCAGTGATGAGG + Intronic
1032284593 7:130531045-130531067 GTGGGGAAGGGTGGGTGGTGGGG + Intronic
1032799010 7:135303206-135303228 ATGGGGCAGGGGCTGGGGTGGGG + Intergenic
1033414257 7:141148287-141148309 ATGGCTGAGGGTCTGTGATGAGG - Intronic
1033573241 7:142655138-142655160 ATGAGGGAGGGTCAGTGATATGG + Intergenic
1034593216 7:152162294-152162316 ATGGGGAGGACTCTGTGCTGAGG + Exonic
1036008678 8:4695595-4695617 ATGGGGAAGGCTGTGTGGTGGGG - Intronic
1036679785 8:10863667-10863689 ATGGGAAAAGCTCAGTGATGTGG - Intergenic
1037702783 8:21290118-21290140 ATGGGGAAGGGGCGGTGAGGAGG + Intergenic
1037748137 8:21662665-21662687 CTGGGGAGGGGTCTGAGGTGAGG - Intergenic
1038435906 8:27535869-27535891 ATGGGGGAGGGGCTTGGATGAGG - Intronic
1038512965 8:28157829-28157851 ATGGCCAAGCATCTGTGATGTGG - Intronic
1038538843 8:28374344-28374366 CTGGGGAAGGGACTGGGATTAGG + Intronic
1040596626 8:48844435-48844457 ATGTGGAAATATCTGTGATGTGG + Intergenic
1041381362 8:57257674-57257696 ATGGGGATAGGTCTGAGCTGTGG - Intergenic
1041431919 8:57791675-57791697 ACTTGGAAGGGTGTGTGATGGGG + Intergenic
1041802576 8:61815791-61815813 ATGGGGTAGGGGCTGAGATTGGG - Intergenic
1043196055 8:77293043-77293065 ATGGGTATGGGTATGTGAGGGGG - Intergenic
1043312416 8:78876769-78876791 AGGAGGAAGGGCCTGTAATGGGG + Intergenic
1043965084 8:86465224-86465246 GTGGGGAGGGGGCTGTGGTGGGG - Intronic
1045343179 8:101272280-101272302 ATGAGAAAGAGTCTTTGATGAGG + Intergenic
1045758492 8:105573811-105573833 ATGGGAAAGAGCCCGTGATGGGG + Intronic
1047010243 8:120664447-120664469 ATGGAGAAAGGACTGTCATGGGG - Intronic
1047710232 8:127544143-127544165 GTGGGGAAGGGGGTGGGATGGGG + Intergenic
1047737552 8:127779861-127779883 ATGGGGAAGGGACTGAGGAGAGG + Intergenic
1047805304 8:128353232-128353254 GTAGGGAAGGGTCTCTGGTGTGG + Intergenic
1048993395 8:139774466-139774488 ATGGGGATGAGTTTGTGTTGGGG - Intronic
1049264248 8:141658832-141658854 ACGTGGATGGGTCAGTGATGGGG - Intergenic
1051347031 9:16161447-16161469 ATGGGGAAGGGTGGCTCATGGGG + Intergenic
1052548090 9:29906458-29906480 ATTAGGAAGGATCTCTGATGAGG - Intergenic
1052767035 9:32651380-32651402 ATGATGGAGGGTCTGTGCTGTGG - Intergenic
1053200968 9:36151434-36151456 GTGGGGAAGGGTGTGGGGTGTGG - Intronic
1053413417 9:37930310-37930332 ATGGGGCAGGGGCTGTATTGCGG - Intronic
1054946610 9:70803101-70803123 AAGGGCAAGTGTCTTTGATGGGG + Intronic
1055281280 9:74677202-74677224 AATGGGATGGGTGTGTGATGGGG - Intronic
1056278428 9:85015937-85015959 ATGGGGAAAGGTTTGGTATGTGG + Intronic
1057690508 9:97279511-97279533 ATGGGGCAGGGTTGGGGATGGGG + Intergenic
1058128368 9:101222348-101222370 ATGGGCAATTGTATGTGATGTGG + Intronic
1059328515 9:113519848-113519870 TTCTGGAAGGGGCTGTGATGAGG - Intronic
1059636596 9:116177574-116177596 ATGGTGAAGGGTCAGTCTTGGGG + Intronic
1059899423 9:118906621-118906643 ATGGACAAGGGTCAGTAATGTGG - Intergenic
1060309724 9:122448490-122448512 CCCGTGAAGGGTCTGTGATGAGG - Intergenic
1060766290 9:126296886-126296908 ATGGGGAAGGATCTGGGGTAGGG - Intergenic
1060827689 9:126696031-126696053 AGGGGGCAGGGGCTGTGCTGGGG - Intronic
1060845920 9:126837515-126837537 CTGGGGAAGGGGATGTGCTGCGG + Exonic
1061001913 9:127907390-127907412 CTGGGGAAGGGGCTGGGCTGGGG + Intergenic
1061491681 9:130948297-130948319 CTGGGGAAGAGGCTGTGAGGAGG + Intergenic
1061899309 9:133664959-133664981 ATGGGAAAGGCTCCGAGATGGGG - Intronic
1062057404 9:134475656-134475678 ATGGGGTGGGGGCTGTGCTGGGG + Intergenic
1062282739 9:135759253-135759275 AGGGGCAAGGCTCTGAGATGGGG + Intronic
1202630989 M:16173-16195 ATGGGGAGGGGGTTTTGATGTGG - Intergenic
1185736829 X:2501423-2501445 AGGGGGAAGGGTCCCTGCTGGGG - Intronic
1186237619 X:7530612-7530634 ATGGGTAAGTGTGTGTCATGGGG - Intergenic
1186252212 X:7680488-7680510 ATGAGGACGTGTCTGAGATGAGG + Intergenic
1188617768 X:32179738-32179760 ACGGGGATGGTTCTGTGCTGAGG + Intronic
1188791796 X:34414372-34414394 AGGGTGGAGGGTCTGTGCTGTGG - Intergenic
1190322755 X:49188161-49188183 GTGGGGAAGGGTGTGTGTGGTGG + Exonic
1190741502 X:53291838-53291860 ATGGGGCAGGGCCTGGGGTGGGG - Intronic
1192182353 X:68924114-68924136 GTGGGGGAGGGCATGTGATGGGG - Intergenic
1192183727 X:68931724-68931746 CTTGGGAAGGGTTTATGATGGGG + Intergenic
1196683998 X:118495620-118495642 ATGGGGAAGGGTGTGTAGAGGGG - Intergenic
1199666213 X:150098404-150098426 TGGGGGAAGGGTGTGTGGTGAGG + Intergenic
1199873248 X:151915227-151915249 ATGGGAAAGGGGACGTGATGGGG - Intronic
1199873775 X:151917271-151917293 ATGGGAAAGGGGACGTGATGGGG - Intronic
1200170187 X:154067150-154067172 ATGGAGAATGCTGTGTGATGAGG + Intronic