ID: 1126743558

View in Genome Browser
Species Human (GRCh38)
Location 15:51802082-51802104
Sequence CCTCAGCCTGCATCTTTTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 218}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126743558 Original CRISPR CCTCAGCCTGCATCTTTTTT TGG (reversed) Intronic
900575762 1:3381807-3381829 TCTCAGCATGCGTCTCTTTTGGG - Intronic
901905247 1:12403355-12403377 CCGCAGCCTGATTCTTTTTCAGG + Intronic
903332007 1:22601227-22601249 CCTCAGCCTGCTTCTTCTGGGGG + Intronic
903542064 1:24102125-24102147 CCTCAGCCTGCATCCTTCCCTGG + Intronic
904175595 1:28626276-28626298 CCTCAGCCTAAATTTTTTTTAGG + Intronic
904452851 1:30627460-30627482 CCTCAGCCTGTAACTTTTTGCGG - Intergenic
905067436 1:35195261-35195283 CATCTGCCTGGATCTTTTTTTGG - Intergenic
905430982 1:37923370-37923392 CCTCAGCCTGCTTCTCTGTCTGG - Intronic
907763855 1:57388963-57388985 GCTCTGCCTGCCTCCTTTTTAGG + Intronic
907917982 1:58888160-58888182 CCTAAACCTGCTTCTTTTTTTGG + Intergenic
908122223 1:60996986-60997008 TCTCAGCCTGCATCTCTCTGGGG - Intronic
909918700 1:81353460-81353482 CCTGAATCTGCATCTTTTCTAGG - Intronic
910160322 1:84265426-84265448 CCAGAGCCTGCATCTTCTTTAGG + Intergenic
910686080 1:89917867-89917889 CCTCAGCCTGTACCTCTTGTTGG + Intronic
910988265 1:93027640-93027662 CCTCAGCCAGCATGATTTTCTGG - Intergenic
911986581 1:104633181-104633203 CATAAGCATGCTTCTTTTTTAGG + Intergenic
911998838 1:104803567-104803589 CCTTAGACTGTATATTTTTTTGG + Intergenic
913083101 1:115408371-115408393 CCTCAAAATGCATCTTTTCTAGG - Intergenic
913297579 1:117336832-117336854 CCCCAACCTGCATTTTTTGTGGG + Intergenic
916011461 1:160710005-160710027 CCTCTCCCTGCCTCTCTTTTAGG - Intronic
916419877 1:164627035-164627057 CCTCCTCCTGCATCTCCTTTTGG + Intronic
917930344 1:179818402-179818424 CCTCTGCCTCCAACTTTTTTGGG - Intergenic
918550114 1:185733236-185733258 CCTCAGGCTGCATCTCCGTTGGG + Intergenic
923035700 1:230283716-230283738 CCTCAGCCTGGGTCTTCTTTGGG - Intergenic
923066317 1:230520448-230520470 CCTCAGCCTCCAAATTTTTGAGG + Intergenic
924769427 1:247066208-247066230 TTTCAGCCTGCATCCTTTCTCGG - Intronic
1064266780 10:13831776-13831798 CCTTATCCTGCTTCCTTTTTGGG + Intronic
1068199175 10:53760986-53761008 CCTCAGCCTGCTTCCACTTTTGG + Intergenic
1068570256 10:58620060-58620082 ACTCAGACTGCATCTTTCTAAGG - Intronic
1071158495 10:82719233-82719255 CCTCTGCATCCATCTTCTTTTGG - Intronic
1073082566 10:100869169-100869191 CCTCTGCCTGCTTCTTTCTGTGG - Intergenic
1077206195 11:1345910-1345932 CCTCAGCCTGCATCGTTCAAGGG + Intergenic
1077563365 11:3280312-3280334 TCTCAGGCTGTATCTTTGTTTGG + Intergenic
1077569257 11:3326127-3326149 TCTCAGGCTGTATCTTTGTTTGG + Intergenic
1077602830 11:3585445-3585467 CCTCAGCCTCCTGCATTTTTAGG - Intergenic
1077896824 11:6459151-6459173 CCTCTGCCTGCACCATTCTTTGG - Intronic
1077933267 11:6755260-6755282 CCTCAGCTTGTAGCTTTTCTTGG + Intergenic
1078315167 11:10288792-10288814 GCTGAGCCTGCAACTTTTATGGG + Intronic
1079054489 11:17194010-17194032 CCAAAGCCTGCATCTTCTTTAGG - Intronic
1082048784 11:47753059-47753081 CCTCAGCCTGCAGCTCCTGTAGG - Exonic
1084258715 11:67959979-67960001 CCTCAGCCTCCTGCATTTTTAGG - Intergenic
1084814031 11:71635200-71635222 CCTCAGCCTCCTGCATTTTTAGG + Intergenic
1087113620 11:94498854-94498876 CCACATCCTGGATCTTTGTTGGG + Exonic
1087992117 11:104758074-104758096 CAGCAGCCTGCATCTTGTTCTGG + Intergenic
1091280418 11:134378746-134378768 CTGCAGCCTTCATCTTTATTGGG - Intronic
1092114635 12:5990942-5990964 CCTTTTGCTGCATCTTTTTTGGG - Intronic
1092788167 12:12048595-12048617 CATCAGCCTGACTCCTTTTTTGG - Intergenic
1092854710 12:12662230-12662252 CCACAGCCAGCATCTTCTTTGGG - Exonic
1094094485 12:26688481-26688503 CCTCATCTTTCATCTTTTTTAGG - Intronic
1094266381 12:28564955-28564977 TGTTAGCCTGCATCTTCTTTAGG + Intronic
1095270744 12:40215649-40215671 CCTCAGCTGTCATCTGTTTTCGG + Intronic
1095629999 12:44365167-44365189 TCTCAGCCTGCATATTTTGTAGG + Intronic
1097965699 12:65578407-65578429 GCTCAACCTGGATCTTCTTTGGG - Intergenic
1098823804 12:75268217-75268239 CCTCAGAATGCAACTTTATTTGG - Intergenic
1098971650 12:76863424-76863446 CCTCAGCCTTCACCATTTGTAGG - Intronic
1099425167 12:82514882-82514904 CATCAGTCTGCATCAGTTTTAGG + Intergenic
1100304076 12:93334444-93334466 GCCCAGCCTCCATCTTTTTAAGG + Intergenic
1100990711 12:100248526-100248548 CCCTTGCCTGCTTCTTTTTTAGG - Intronic
1103384698 12:120522937-120522959 TGTTGGCCTGCATCTTTTTTAGG + Intronic
1103578086 12:121893658-121893680 CCTCTGCCTGCATCTTCATGTGG + Intronic
1105061714 12:133158563-133158585 CCTCTTCCTGAATCTTTTGTGGG - Exonic
1108278310 13:48834621-48834643 TCTCAACCAGCATCATTTTTGGG - Intergenic
1110170668 13:72496779-72496801 GCTGAGCCTGCATCTCTCTTAGG - Intergenic
1110199393 13:72830893-72830915 TCTCATCCTGGATTTTTTTTTGG + Intronic
1112129438 13:96505201-96505223 CCGCAGCCTGCCTATCTTTTGGG - Intronic
1112440565 13:99421858-99421880 CCACACCCTGCATCTCATTTTGG + Intergenic
1117679071 14:58184744-58184766 CTTCAGCCTGGATCTTCTTCAGG - Intronic
1117708282 14:58496575-58496597 CCTTAGCCTGACTCTTCTTTAGG - Intronic
1118684458 14:68277402-68277424 CGTCAGTCTGCCTCTTTTTCTGG + Intronic
1120932154 14:89859686-89859708 CCTCAGGCTACCTGTTTTTTTGG - Intronic
1121011866 14:90524491-90524513 CCACAGCCTGATTCCTTTTTAGG - Intergenic
1123768952 15:23509994-23510016 CCTAAGCTTCCTTCTTTTTTTGG + Intergenic
1124928918 15:34100088-34100110 CCTCAGCCTGTCACATTTTTGGG - Intronic
1125077063 15:35631970-35631992 CCTCTGCCTGGAACTTCTTTTGG + Intergenic
1126743558 15:51802082-51802104 CCTCAGCCTGCATCTTTTTTTGG - Intronic
1127972690 15:63973904-63973926 GCTCAGTCTGCTTCTTTTGTAGG - Intronic
1128373657 15:67059734-67059756 CCTAAGCCTGCATGTTTTAGGGG + Intergenic
1128866520 15:71118786-71118808 CGTCAGCCTGCATCATGTGTTGG - Intronic
1128866973 15:71121395-71121417 CCTGAGCCTGCATCTCCTTTGGG + Intronic
1129419800 15:75415555-75415577 GCCCAGCCTGCATCCTTTTTAGG - Intronic
1133366149 16:5211912-5211934 CCTCAGCCTCCTGCATTTTTAGG + Intergenic
1134029582 16:10981065-10981087 ACTCACCCTCCCTCTTTTTTGGG + Intronic
1134491993 16:14702618-14702640 CCGCAGCATGCACCTTTTTAAGG + Intergenic
1134497374 16:14741740-14741762 CCGCAGCATGCACCTTTTTAAGG + Intronic
1135132553 16:19864741-19864763 CCTCAGCCAGCTTGTATTTTAGG - Intronic
1136067264 16:27767557-27767579 ACTAAGCCTGCCTATTTTTTTGG - Intronic
1136605784 16:31332356-31332378 CCTCAGTGGGCATCTTTATTGGG - Exonic
1136617521 16:31407697-31407719 GCTCAGCCTGCATCTCCTTCAGG + Intronic
1137454301 16:48606419-48606441 CCTCAGCCTTCATCTTTCCCAGG + Intronic
1138293772 16:55869685-55869707 GCTCAGCCTCCATCTTTGATGGG - Exonic
1138785149 16:59836847-59836869 CCCCAGCCTATTTCTTTTTTTGG + Intergenic
1140438713 16:74969900-74969922 CCTCAGCCTGCTAATTTTTGTGG + Intronic
1141808449 16:86357867-86357889 CCTCAGCCTTCATCTTCATGTGG - Intergenic
1142431828 16:90032765-90032787 CCTCAGCCTTCATCTCTGTCAGG - Exonic
1143045055 17:4071562-4071584 CCTCTGTCTGCATCTTTATCCGG - Intronic
1144818934 17:18057620-18057642 CCTCTTCCTGAATCTCTTTTGGG + Intronic
1148125759 17:45235989-45236011 CCTCAGCCAGCCTCTTTGGTTGG + Intronic
1149371045 17:55993501-55993523 CCTCAGGCTGCACATTTTCTGGG + Intergenic
1150494279 17:65595258-65595280 CCTCAGCCCTCATTTCTTTTAGG + Intronic
1150622734 17:66820643-66820665 CCTCAGCCTCTTTCTCTTTTTGG + Intergenic
1151338098 17:73452137-73452159 CCCCAGCATGCATCTTTATGAGG + Intronic
1152366858 17:79861419-79861441 TCTCAGCCTTCATCTTCATTTGG - Intergenic
1152968849 18:142134-142156 CCTCTGCCTGCTTCTATTTTTGG - Intergenic
1153031275 18:714937-714959 CTTCAGCCTTGTTCTTTTTTAGG - Intergenic
1154973691 18:21436307-21436329 CCTCAGCCTACATCTCTCCTTGG - Intronic
1157761753 18:50270446-50270468 CCTCAGCCTGAATGTGTTCTAGG - Intronic
1158465169 18:57683544-57683566 CCTCAGCCTGGATCTCTTTAAGG - Intronic
1159460948 18:68722175-68722197 ACTCATCCCGCATCCTTTTTTGG + Intronic
1161327368 19:3670262-3670284 CCTCAGCCTGCAACCGTATTTGG + Intronic
1162728282 19:12702656-12702678 CCTGAGGCTGCATCTTTCTTGGG + Intronic
1166206864 19:41275779-41275801 CCTCTGCCTGCTTCTTTCTTAGG + Intronic
1166875682 19:45895848-45895870 CATCAGCTTGGATGTTTTTTTGG + Intronic
926336460 2:11866180-11866202 GCTGAGCCTGCATCTTTGCTTGG + Intergenic
927231343 2:20826911-20826933 CCTCAGGCTGCTTCTATTTATGG - Intergenic
927457625 2:23270374-23270396 CCCCACCCTGCTTCTTTTATGGG + Intergenic
928675508 2:33647244-33647266 TCTCTTCCTGCTTCTTTTTTGGG + Intergenic
929113885 2:38428308-38428330 ACTGAGCCTTCACCTTTTTTAGG + Intergenic
931331377 2:61288077-61288099 TTTCAGCCTTCAGCTTTTTTAGG + Intronic
932217785 2:69978039-69978061 CCCCAGCCTGCTTCCTTTATGGG - Intergenic
932818766 2:74882004-74882026 CCTGAGCCTGCATTTCTTCTGGG + Intronic
933688142 2:85159340-85159362 GCTCAGCCTGCAGCTTCTGTAGG + Intronic
936086623 2:109473820-109473842 CCGCAGGCTGTCTCTTTTTTGGG + Intronic
937952500 2:127399228-127399250 CCTCAGTCTGCAGGTTTTTAAGG - Intergenic
942129779 2:172866672-172866694 CCTCAGACTGCACCATTTTGGGG - Intronic
945049801 2:205812858-205812880 TCTCATCCTGCAGCTTTTTTTGG - Intergenic
946444133 2:219723628-219723650 CCCCAGCCTGTACCTTGTTTGGG + Intergenic
946777985 2:223163840-223163862 CCTGTGCCTGCATCTTATTCTGG + Intronic
946846235 2:223861187-223861209 CCTCACCCTACATTCTTTTTAGG + Intronic
1168930336 20:1618417-1618439 CCTCTGCCTGAGTCTTTGTTTGG + Intronic
1169982640 20:11403850-11403872 TCTCAGCCAGAAGCTTTTTTTGG + Intergenic
1170374720 20:15687849-15687871 CTTCAGCTTTCCTCTTTTTTTGG + Intronic
1171079812 20:22167996-22168018 CCCCAGCCTACAGCTTCTTTAGG - Intergenic
1172730984 20:37087331-37087353 CCTCAGCCTTTTTTTTTTTTGGG - Intronic
1172976832 20:38912415-38912437 CCTCAGCCTCCCTCAGTTTTGGG - Intronic
1173277237 20:41595789-41595811 CCTCAGTTTGCTTTTTTTTTTGG + Intronic
1175171347 20:57083748-57083770 CCTGAGCCTGCATCTGATCTTGG - Intergenic
1175179601 20:57136133-57136155 CCTCAGCCCACATCTCTCTTTGG - Intergenic
1178026213 21:28471084-28471106 TCTCAGCTTGAATGTTTTTTGGG - Intergenic
1180408425 22:12579550-12579572 CCTCACCCTATATTTTTTTTTGG + Intergenic
1182560697 22:31156742-31156764 CCTCAGCTTGCATTGTTTCTGGG - Intergenic
1183109330 22:35637552-35637574 TCTGAGCCAGCATCTTTTCTAGG - Intronic
1184474723 22:44714308-44714330 CCTCAGCCAGCTTCCTTTCTGGG - Intronic
1184965296 22:47967061-47967083 CCTCAGCATGGAACTTTATTTGG + Intergenic
949748437 3:7323257-7323279 CCACATAGTGCATCTTTTTTAGG + Intronic
950025631 3:9818084-9818106 CCAAAGCCTGCAGCCTTTTTTGG - Intronic
950270229 3:11608858-11608880 CTTCAACCTCCATTTTTTTTTGG + Intronic
951302808 3:21018933-21018955 CTTCACCCTGCATGTTCTTTGGG + Intergenic
952353158 3:32560182-32560204 CCTCAGCCTCCATAAGTTTTGGG - Intronic
953718088 3:45333061-45333083 TCTGAGCCAGCACCTTTTTTAGG - Intergenic
956321168 3:67998410-67998432 CCACTGCATGCATCTCTTTTGGG + Intergenic
957073668 3:75584495-75584517 CCTCAGCCTCCTGCATTTTTAGG - Intergenic
958985211 3:100772782-100772804 GCCCAGCCTGCATTTTATTTTGG - Intronic
961280409 3:125762231-125762253 CCTCAGCCTCCTGCATTTTTAGG + Intergenic
961873987 3:130007301-130007323 CCTCAGCCTCCTGCATTTTTAGG - Intergenic
962105761 3:132387241-132387263 TCTCAGGATGCATCTTTTTCAGG - Intergenic
963510980 3:146249121-146249143 CCGCAGTTTGTATCTTTTTTGGG + Intronic
964760383 3:160130159-160130181 CCTCAGACTGCATATTTTGGAGG + Intergenic
966437401 3:179904247-179904269 CTTCAGCCATCATCTTTTCTAGG + Intronic
968072734 3:195796723-195796745 TCTTAGCCTGCATTTTTTTGTGG - Intronic
969017263 4:4111807-4111829 CCTCAGCCTCCTGCATTTTTAGG - Intergenic
969736690 4:8996492-8996514 CCTCAGCCTCCTGCATTTTTAGG + Intergenic
969795882 4:9528069-9528091 CCTCAGCCTCCTGCATTTTTAGG + Intergenic
970313182 4:14804256-14804278 CCTCAGCCTGCCTCTTGGTGTGG - Intergenic
970962045 4:21883693-21883715 CCACATTCTGTATCTTTTTTCGG + Intronic
971530710 4:27685087-27685109 CTTCCCCCTGCATATTTTTTTGG + Intergenic
974528708 4:63079618-63079640 CCTCAGTCTGCATCTTTCCCTGG - Intergenic
974777712 4:66508261-66508283 ATTCAGTCAGCATCTTTTTTAGG + Intergenic
975723317 4:77268964-77268986 CAACAGCCTGCATCTATGTTTGG - Intronic
976058509 4:81098281-81098303 CCTCAGCCTGCAGCCTATTGTGG + Intronic
977437406 4:97016281-97016303 TCTCAGCCAACATATTTTTTAGG - Intergenic
978610519 4:110533584-110533606 TCTCAGCCTAGATATTTTTTAGG - Intronic
979374590 4:119931465-119931487 TCTCAGCCTGTACCTTTTTCTGG + Intergenic
979856496 4:125639313-125639335 CCTCTGCCTGCAGCCTTGTTTGG - Intergenic
980530255 4:134044065-134044087 CCTCAGCCTCCAGCTTATCTGGG + Intergenic
988917159 5:35906008-35906030 CACCAGCCTGCAACTTTTTGAGG - Intronic
989768532 5:45115227-45115249 TCCCAGCCTACATCTTTTTCTGG + Intergenic
992715815 5:79510592-79510614 TGTTAGCCTGCATCTTCTTTAGG - Intronic
992902259 5:81309382-81309404 CCTCAGCCAGCATATCATTTTGG + Intronic
996776761 5:127141002-127141024 CCTCAGCATGCTTCTTTTGACGG - Intergenic
997339302 5:133130300-133130322 CCTCAGCCTTCATCTTTCAGAGG - Intergenic
997357671 5:133274231-133274253 CCTCAGCCTGTGTCCTATTTGGG + Intronic
1004885009 6:20042760-20042782 TGTCGGCCTGCATCTTCTTTAGG + Intergenic
1006412176 6:33880324-33880346 CCTCAGCCTGAATCTGCCTTTGG + Intergenic
1006690429 6:35879162-35879184 GCTCAGTCTGCATCTTTTCCTGG - Intronic
1007663035 6:43498002-43498024 CCTCAGCCTGGCTCTCTTCTGGG + Intronic
1007754394 6:44089528-44089550 TGTTGGCCTGCATCTTTTTTAGG + Intergenic
1008081880 6:47203685-47203707 CATCATCCTGCATCTTGTTAAGG - Intergenic
1008714250 6:54269140-54269162 ACTGAGACTGCATCTTTATTTGG + Intergenic
1008935725 6:56990216-56990238 CATCTGCATGCATCTATTTTGGG + Intronic
1009439103 6:63655007-63655029 CCTCAGCCTGCCTAGTTGTTGGG + Intronic
1010769605 6:79813054-79813076 TCTCAGCATGCTTTTTTTTTAGG - Intergenic
1011344790 6:86357423-86357445 CCTCAGCCTGCATCAAATTCTGG + Intergenic
1011614743 6:89187171-89187193 CCTCAGCCTGGCTCTTTCTGTGG + Intronic
1012608074 6:101182813-101182835 CCAGAGCCTGCTCCTTTTTTTGG + Intergenic
1012946310 6:105469540-105469562 CGTCAGCCTTCATCTCTTTAGGG - Intergenic
1014654098 6:124077710-124077732 CCTCAGCCTGCCTCCCTTGTGGG + Intronic
1015328715 6:131952483-131952505 CCTCAGGCTGCATGTTCCTTGGG - Intergenic
1015779864 6:136854029-136854051 CCCAAGCCTGCATCCTTCTTTGG + Intronic
1020889180 7:13857463-13857485 TCCCAGCCTACATCTTTCTTCGG - Intergenic
1022053940 7:26709444-26709466 CCTCAGCCTTCCTCTTTTTGAGG + Intronic
1022164023 7:27740314-27740336 CCTCCAGCTGCATCTCTTTTAGG + Intronic
1022419724 7:30209233-30209255 CCTCACCCTGCCTTTTTATTAGG - Intergenic
1022596480 7:31718212-31718234 CCACAGGCTGCATCTTTTTCTGG + Intergenic
1025792514 7:64702851-64702873 ACCCAGCCTACCTCTTTTTTTGG + Intronic
1026092012 7:67308175-67308197 GGCCAGCCTGCATCTTCTTTAGG + Intergenic
1026568480 7:71509628-71509650 CTAGAGCCTGTATCTTTTTTGGG + Intronic
1029075756 7:97932632-97932654 CCTCAGCCTCCTGCATTTTTAGG - Intergenic
1032811519 7:135423705-135423727 ATTAAGCCTGAATCTTTTTTGGG - Intronic
1033769967 7:144539099-144539121 CCTCAGCTAGCATCTATTTTAGG + Intronic
1034224482 7:149472097-149472119 CCTCTTCTTGCATCTTTTCTTGG - Intergenic
1035380210 7:158433406-158433428 CCTCAGTCTGCATTTCTGTTGGG + Intronic
1035971137 8:4250382-4250404 CCTCAACCAGCATCTTATCTTGG - Intronic
1036241769 8:7087702-7087724 CCTCAGCCTCCTGCATTTTTAGG + Intergenic
1036306551 8:7607119-7607141 CCTCAGCCTCCTGCATTTTTAGG + Intergenic
1036357396 8:8055107-8055129 CCTCAGCCTCCTGCATTTTTAGG + Intergenic
1036810939 8:11867550-11867572 CATCTGCCGGCATCTATTTTCGG - Intronic
1036830965 8:12019378-12019400 CCTCAGCCTCCTGCATTTTTAGG - Intergenic
1036901108 8:12669822-12669844 CCTCAGCCTCCTGCATTTTTAGG - Intergenic
1040276472 8:46016503-46016525 CCTCAGCCTGGCTGCTTTTTTGG + Intergenic
1042379942 8:68102190-68102212 TCTCATCCTGCCTCTTTCTTCGG + Intronic
1042691461 8:71504108-71504130 CTTCACCCTGCATCTCTTTCTGG + Intronic
1043449243 8:80349911-80349933 CATCAGGCCGCACCTTTTTTAGG - Intergenic
1047986549 8:130240863-130240885 CAGCAGCCTGCATCTTCTCTGGG - Intronic
1051453538 9:17225327-17225349 CCTCAGCCTGCATCTGGCTCTGG + Intronic
1051490379 9:17657447-17657469 CATCAGCCTGCCTCTGTTTGTGG - Intronic
1052523187 9:29577503-29577525 CCTCAGGCAGCAGCTTTATTAGG - Intergenic
1055404726 9:75962603-75962625 CTTCAGCCTGCCTCTTTTCAAGG - Intronic
1056228603 9:84521842-84521864 CCACAGCGTGCTGCTTTTTTGGG + Intergenic
1057102865 9:92379796-92379818 CCGAAGCCTGCATTTTTTTGTGG + Exonic
1062180815 9:135190009-135190031 CCTCAGCCTCCATCTTTTCAAGG + Intergenic
1062180821 9:135190054-135190076 GCTCAGCCTCCATCTTTTCAAGG + Intergenic
1062296701 9:135833975-135833997 CCTTAGCCTGCTTTTTATTTGGG - Intronic
1187068268 X:15862719-15862741 CCTCAGCCTAAACCTTCTTTTGG - Intergenic
1187792235 X:22963466-22963488 CCTCAGAATGCATGTTTATTAGG + Intergenic
1188089908 X:25952289-25952311 CTTCATCCTGCATCTTTTAGTGG + Intergenic
1190254603 X:48753206-48753228 CCACAGCCTGCCTCTTTTCATGG - Intergenic
1190325520 X:49204854-49204876 ACTCTGCCTCCAGCTTTTTTTGG + Intergenic
1193576455 X:83203814-83203836 TCTGAGCATGTATCTTTTTTGGG + Intergenic
1194320857 X:92444320-92444342 CCTCAGCTTGAATGTTTTTTTGG + Intronic
1195621806 X:106963782-106963804 TCTCAGCTTGCATTTTTTTCTGG - Intronic
1198751023 X:139936387-139936409 CCTCAGCCAGCATTTTCATTGGG + Intronic
1199024689 X:142922300-142922322 TCCCAGCCTGCATCTTTCTCTGG + Intergenic
1200628971 Y:5557456-5557478 CCTCAGCTTGAATGTTTTTTTGG + Intronic