ID: 1126744234

View in Genome Browser
Species Human (GRCh38)
Location 15:51809530-51809552
Sequence CTGTGAAAGTACAAGTGAGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 247}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126744232_1126744234 6 Left 1126744232 15:51809501-51809523 CCAGATGCATGTCATCTCAAGGA 0: 1
1: 1
2: 0
3: 2
4: 98
Right 1126744234 15:51809530-51809552 CTGTGAAAGTACAAGTGAGATGG 0: 1
1: 0
2: 1
3: 22
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126744234 Original CRISPR CTGTGAAAGTACAAGTGAGA TGG Exonic
900272222 1:1796865-1796887 CTGTTAAAGTCCAGGAGAGAGGG + Intronic
901689555 1:10963909-10963931 CTGAGCAAGGACGAGTGAGATGG - Intronic
902197201 1:14806461-14806483 CTGAGAAAGCCCAAATGAGAAGG - Intronic
904345490 1:29865939-29865961 CTTTGATAGTACAAGAGGGAAGG - Intergenic
906785331 1:48610723-48610745 CTGGGAAAGTAAAAGTTAGAGGG - Intronic
906826094 1:48982125-48982147 TTGGTAAAGTACAAGGGAGAAGG + Intronic
909611096 1:77552557-77552579 CTGTGATAGTAAAAGGCAGAAGG + Intronic
910231719 1:84994749-84994771 CAGTGAAAATACAAATGATAAGG - Intronic
910927612 1:92412717-92412739 GTGAGAAAGAACAAATGAGAAGG - Intergenic
911369446 1:96979093-96979115 CTTTGCAAGCACAAGTGAGCAGG + Intergenic
913457054 1:119043765-119043787 CCTTGAAATTACAAGGGAGAGGG + Intronic
914916827 1:151824207-151824229 CTGTAAATGTCCAAGTGAGAAGG + Intronic
916260597 1:162838487-162838509 TTGTGAGATTACAAGTCAGATGG - Intronic
916429786 1:164716565-164716587 CTGTGAAAGGCCAAGTGTGGTGG + Intronic
917489230 1:175483540-175483562 CTGTGTAAATACAAGCCAGAAGG + Intronic
918648938 1:186935680-186935702 CTTAAAAAGTACAGGTGAGAAGG + Intronic
918688455 1:187448717-187448739 CTGTGAAAGACCAAGTGACCTGG + Intergenic
921155954 1:212438969-212438991 CTGGGAAATGACAACTGAGAAGG - Intronic
921734122 1:218607419-218607441 CTGTGAAAGTTCAACTGCCAAGG - Intergenic
1063877054 10:10490916-10490938 ATGTCAAACTACAAATGAGAAGG + Intergenic
1067307483 10:45078512-45078534 CTTTGGGAGTCCAAGTGAGAAGG + Intergenic
1068559152 10:58493703-58493725 TAGTGAAAGTACAAATGATAAGG + Intergenic
1069314866 10:67085387-67085409 CTGTGAAAAAAAAAATGAGAGGG + Intronic
1073625586 10:105092586-105092608 TTGTGAATGCACAAGTGTGAGGG - Intronic
1075129227 10:119724768-119724790 CTGCTCAAGTAAAAGTGAGAGGG - Intergenic
1075243520 10:120799651-120799673 CTGTGAGGTTAGAAGTGAGATGG - Intergenic
1078715672 11:13836863-13836885 CATTGAAAGTACATGTGGGAAGG + Intergenic
1080514210 11:33004975-33004997 CTGCCAAACTACAAGTGAAAAGG + Intergenic
1083587381 11:63870117-63870139 CTGGGAAAGGACAAGTGGAAGGG + Intronic
1084386866 11:68848872-68848894 CTGTGAAGTTACATGTGAGCTGG + Intergenic
1084817664 11:71659019-71659041 CTGTAAAAGTGTAAGTGAGGGGG + Intergenic
1085602600 11:77868757-77868779 CTGTGTAAGAACCAGTGGGAAGG - Intronic
1091798306 12:3309595-3309617 CTGTGTGGGTACAGGTGAGAGGG + Intergenic
1091947973 12:4565923-4565945 CTATGAAAGTACATGTGGGATGG - Intronic
1092425331 12:8371010-8371032 CTGTAAAAGTGTAAGTGAGGAGG - Intergenic
1093938234 12:25024046-25024068 TTGTCAAATTACAAGTGAGGAGG + Intronic
1094863857 12:34504669-34504691 CTGTGAAAGGACATTTGGGAGGG - Intergenic
1095084015 12:38040451-38040473 CTGTGAAAGGACATTTGGGAGGG + Intergenic
1095135790 12:38600942-38600964 TTGGGAAAGTAAAAATGAGATGG + Intergenic
1095527064 12:43139865-43139887 ATGTGAAAGTTATAGTGAGAAGG + Intergenic
1099739280 12:86610801-86610823 CTGTAAAAGTAAATGAGAGACGG + Intronic
1102746657 12:115255031-115255053 TTGTGAATGGACAAGTCAGAGGG - Intergenic
1103698806 12:122836723-122836745 CTCTGCAAGGACAAGTGGGACGG - Intronic
1105543890 13:21338006-21338028 CTGTGTAAGTAGAAGTATGAAGG + Intergenic
1106965169 13:35055847-35055869 CTGTGAAATGAGAAATGAGAGGG + Intronic
1107568382 13:41630174-41630196 TTGTGATAATACAGGTGAGAAGG + Intronic
1108402069 13:50055648-50055670 CAGTGAAAGTAAAAATGAAAGGG - Intergenic
1112233620 13:97614212-97614234 CTTTTAAAGGAAAAGTGAGAAGG + Intergenic
1113028477 13:105967591-105967613 CTGTGAATATACAGGTGAGGAGG - Intergenic
1113039860 13:106092741-106092763 CTGTGAAAGAATAAGGTAGAGGG - Intergenic
1116099911 14:40420616-40420638 CAGTCAAAGTAGAGGTGAGAAGG + Intergenic
1116868085 14:50047547-50047569 CTGTGAAAGCCCAGGGGAGATGG + Intergenic
1117093916 14:52277962-52277984 CTGTGGAAGTTCAGGTGTGAGGG - Intergenic
1117294131 14:54363602-54363624 CTGTGAAGGTAAAAGTGATATGG + Intergenic
1117932904 14:60864669-60864691 ATGTGAAATTTCAGGTGAGAAGG + Intronic
1117959852 14:61152062-61152084 CTGTGAAAGGACAGGAGGGAAGG + Intergenic
1118541041 14:66825894-66825916 CTGAAAAAGTACAATTGGGAAGG + Intronic
1118569738 14:67181988-67182010 GTGTGAAAATACAGATGAGAAGG + Intergenic
1118646819 14:67848467-67848489 CTGTGGGATTACATGTGAGATGG + Intronic
1119079879 14:71682855-71682877 CTATGAAAGTACTTGTGAGCTGG + Intronic
1119816889 14:77577554-77577576 CTGTGAATATACACATGAGAAGG + Intronic
1119868140 14:77991199-77991221 CTTAGAAAGGACAAGTGACAAGG - Intergenic
1120015538 14:79469100-79469122 CTGTGGAAATGCAAGTGAGCTGG - Intronic
1123766128 15:23480193-23480215 CTCAGAAAGAACAAGAGAGATGG + Intergenic
1124889539 15:33719584-33719606 GTGAGAAATTACAACTGAGAGGG + Intronic
1126744234 15:51809530-51809552 CTGTGAAAGTACAAGTGAGATGG + Exonic
1126980826 15:54240822-54240844 CTGTGAAACTAAAACAGAGATGG - Intronic
1127793376 15:62417872-62417894 CTCTGAAAGTGAATGTGAGATGG - Intronic
1128010952 15:64295488-64295510 CTCTGAAAATGGAAGTGAGATGG - Intronic
1128409298 15:67377993-67378015 CTGTGAAAGTACACATGAGCTGG - Intronic
1129156418 15:73721169-73721191 CTGTGTAAGTGCAGGTGAGGTGG - Intergenic
1129375907 15:75131458-75131480 CTGTAAAACCAGAAGTGAGATGG + Intergenic
1129909966 15:79219155-79219177 CTGTGAAAGTCTCAGTGACAGGG - Intergenic
1131856172 15:96598153-96598175 CTGTGAAAGCTCAAGTCAGGAGG - Intergenic
1132193722 15:99893344-99893366 ATTTGAAAGTACAAGAGAAAAGG + Intergenic
1133373013 16:5259899-5259921 CTGTAAAAGTGTAAGTGAGGAGG + Intergenic
1134407640 16:13975910-13975932 CTATGAAAGTAGACGTGGGAAGG + Intergenic
1136742172 16:32545210-32545232 CTATGAAAGGACATTTGAGAGGG + Intergenic
1138729488 16:59178971-59178993 CTGGGAAAATACGAGTGAGAAGG - Intergenic
1139381904 16:66537795-66537817 CTTTCAGAGTACATGTGAGAAGG + Intronic
1140094281 16:71861637-71861659 CCTTGGAAGTACAAGTAAGAAGG - Intronic
1140164373 16:72534175-72534197 CTATGTAAGTACAAATGAGTTGG - Intergenic
1141001079 16:80308633-80308655 ATGAGAAAGTAGAAGTGAAAGGG - Intergenic
1141045192 16:80709707-80709729 CTGTGGAAGTAGATGTGAGAAGG - Intronic
1141477007 16:84280794-84280816 CTGTGAAAGCAGAAGGGAAAAGG - Intergenic
1203027426 16_KI270728v1_random:530023-530045 CTATGAAAGGACATTTGAGAGGG - Intergenic
1203044295 16_KI270728v1_random:804408-804430 CTATGAAAGGACATTTGAGAGGG + Intergenic
1148435745 17:47683277-47683299 CTGTGAATGTAGAAGTGGGGGGG + Exonic
1149226350 17:54475959-54475981 CTTTGAAAGAACAAGAAAGATGG - Intergenic
1149340274 17:55678724-55678746 ATGTGAAATTAAAAGGGAGATGG - Intergenic
1149623969 17:58066689-58066711 CTGTGAAAGGAAAAGAAAGAAGG + Intergenic
1151842570 17:76628467-76628489 CTCTGCAAGGACAGGTGAGAAGG + Intronic
1152796735 17:82311278-82311300 CTGAGAAAGTACGAGAAAGAAGG + Intergenic
1153206025 18:2702403-2702425 CAGTCAAAGTACAATTCAGAAGG - Intronic
1155713795 18:28914075-28914097 GAGTGAAAGTTCAGGTGAGATGG - Intergenic
1157166750 18:45364421-45364443 CTGTGAGAGTAGAAGAGAAAAGG + Intronic
1157500753 18:48188908-48188930 CAGAGAAAGTACAACTGGGAGGG - Intronic
1159311024 18:66709213-66709235 CTGTTAAAAAATAAGTGAGATGG - Intergenic
1159620881 18:70636990-70637012 ATGTGAAAGTGCAGATGAGAAGG - Intronic
1160115649 18:76076736-76076758 CTGAGAAAGCAGAAGTGAGGAGG + Intergenic
1160656342 19:273088-273110 CTATGAAAGTCCTAGTAAGAAGG - Intergenic
1162268369 19:9594592-9594614 CTTAGAAAGTACATGTGAAACGG - Intergenic
925662678 2:6219551-6219573 CAGTGAATGTTCAAGAGAGAAGG - Intergenic
925723698 2:6852916-6852938 ATTTGAAAGTACAAATGAGGAGG - Intronic
927041236 2:19232447-19232469 CTGTGAAGCTAAAAGTGAAAAGG - Intergenic
927051121 2:19330492-19330514 CTATGACTGTGCAAGTGAGAGGG + Intergenic
928933016 2:36645085-36645107 CTGTGAGTCTACAAGGGAGATGG + Intronic
930968122 2:57357453-57357475 CTTTTAAATTACAATTGAGATGG + Intergenic
931672027 2:64655536-64655558 CACTGAAAGTATAAGTGAGTGGG - Intronic
932667631 2:73709777-73709799 CTGTGATGGGTCAAGTGAGATGG + Intergenic
932839017 2:75064374-75064396 CTGAGAGAGGACAAGTTAGACGG + Intronic
933218416 2:79658326-79658348 TATTGAAAGGACAAGTGAGATGG + Intronic
934812334 2:97291081-97291103 CAGTGAAAATATAAGTAAGATGG + Intergenic
934825360 2:97416842-97416864 CAGTGAAAATATAAGTAAGATGG - Intergenic
934853478 2:97715421-97715443 CTGTGACTGTAAAAGGGAGATGG - Intronic
939875673 2:147574568-147574590 ATATGGAAGCACAAGTGAGAAGG - Intergenic
942170680 2:173286768-173286790 CTGTGAAAGTAAAAATTCGATGG - Intergenic
942297126 2:174528454-174528476 CTGTGAATGTACAAGTGCCATGG + Intergenic
942902491 2:181138400-181138422 CTTGGAAAGAACAAGAGAGAGGG - Intergenic
944702719 2:202260182-202260204 CTCTGAAAGAACAAATTAGAAGG + Intergenic
944943219 2:204652865-204652887 ATGAGAGAGTACAAGTGAAAGGG + Intronic
945355102 2:208831123-208831145 CAGTGAAAATACAAATGAAAAGG + Intronic
945747732 2:213739240-213739262 CTGTTGAAGTACAAGTAATAGGG - Intronic
946813334 2:223550288-223550310 CTGTGAAGGTCCAAGTGACAGGG + Intergenic
947301042 2:228688975-228688997 CTGGGAAAGTAAAAATGGGAGGG + Intergenic
948307146 2:236956769-236956791 CTGTGAAAGGAAAAGGGAGGAGG - Intergenic
1168922633 20:1553102-1553124 CTGGGAAAGTTCAAGTGTCAGGG + Intronic
1170615625 20:17947338-17947360 CTGTGCATGTGCAAGTGATAAGG + Intronic
1170760702 20:19248240-19248262 CTTTGAAAGTAGAAGAGAAATGG - Intronic
1171266186 20:23773821-23773843 CTGTGCATGTACATGTGAGTAGG - Intergenic
1175032157 20:55965422-55965444 GTATGAAAATACAAATGAGATGG - Intergenic
1177549429 21:22600644-22600666 CTGTGAGACTACAAGCAAGATGG + Intergenic
1177856864 21:26409255-26409277 ATGGGAAAGTACAAATGGGAGGG + Intergenic
1178053998 21:28778892-28778914 CTGTGAAAGCCCATGTGAAAAGG - Intergenic
1178092608 21:29180440-29180462 CTGGGAAAGTAAGAGAGAGAGGG - Intergenic
1179303100 21:40130022-40130044 CTCTGAAGGTACATGTGAGAGGG - Intronic
1179804041 21:43826025-43826047 CTGTGAGAGGACACGTGAGAGGG - Intergenic
949704225 3:6797508-6797530 CTGTAAGACTTCAAGTGAGATGG + Intronic
949829519 3:8198987-8199009 CTGAGGAAGGATAAGTGAGAGGG - Intergenic
950936141 3:16841494-16841516 AAGTGAAAGTGCAGGTGAGAAGG + Intronic
953423853 3:42776504-42776526 CTGTGAAAGCCCAAGTGAAGAGG - Intronic
954402952 3:50328547-50328569 CTGTGAAAATAGAAGCCAGATGG - Intergenic
955324681 3:58000844-58000866 GTGTAAAATTACAACTGAGAAGG + Intergenic
956097915 3:65736896-65736918 CTTTGAAATTAATAGTGAGATGG - Intronic
957070037 3:75560518-75560540 CTGTAAAAGTGTAAGTGAGGAGG - Intergenic
960370730 3:116835050-116835072 CTGTGACATTAAATGTGAGATGG - Intronic
961582347 3:127893039-127893061 CTCAGAAAGTATACGTGAGAAGG + Intergenic
961584432 3:127910485-127910507 CAGTGAATGAACAAGTGAGTGGG - Intergenic
962198681 3:133383970-133383992 CTGTGAAGGCTCCAGTGAGAGGG + Intronic
963415572 3:144991789-144991811 CTGTGAAAATACAGGTTTGAAGG - Intergenic
963538887 3:146562113-146562135 CTGTGAAAGTAGCTGTGAGGGGG - Intergenic
964698468 3:159536609-159536631 CTGTGAAAGTTCTAAGGAGAAGG + Intronic
965028009 3:163327756-163327778 CTCAGAAAGTACAAGAGAAATGG + Intergenic
965430029 3:168574855-168574877 CTGTGGAAGTAGATTTGAGAAGG + Intergenic
969013626 4:4087979-4088001 CTGTAAAAGTGTAAGTGAGGGGG - Intergenic
969172467 4:5375233-5375255 CTGTGAAATTGCAAGTGAGCTGG - Intronic
969684336 4:8661885-8661907 CTCTGAAAGTTTAAGTGAGGTGG - Intergenic
969799515 4:9551947-9551969 CTGTAAAAGTGTAAGTGAGGAGG + Intergenic
970723969 4:19021020-19021042 CTGTAAAAGCAAAAGTGAGATGG - Intergenic
971952226 4:33367400-33367422 ATGTGAGGATACAAGTGAGAAGG - Intergenic
972323923 4:37997425-37997447 CTTTTAATGTACAAGTGAAACGG - Intronic
976220567 4:82753802-82753824 CTATGAAAATCCAACTGAGAGGG + Intronic
976895160 4:90100398-90100420 CTGTGAAATTAGAAGCAAGATGG + Intergenic
977531785 4:98208965-98208987 GAGTGGAAGTAGAAGTGAGACGG + Intergenic
977952786 4:102993484-102993506 CTGTGAAAGCACCAGAGAGTGGG - Intronic
978991294 4:115085006-115085028 CTGTGAAAGCAGATGTGAGGGGG + Intronic
979544667 4:121926342-121926364 CAGTGGAAATACAAGTGACATGG - Intronic
979770271 4:124515775-124515797 CTGTGACATTCCAAGTAAGATGG - Intergenic
980337277 4:131493096-131493118 CTTTGAAAGAACAAATCAGATGG - Intergenic
980573335 4:134652123-134652145 CTGTGAGAGGAAAAGTGATATGG + Intergenic
980654555 4:135765688-135765710 CAGTGAAAGTAGCAGTGAGGGGG - Intergenic
981215477 4:142160820-142160842 TTGTGAAACTAAAAGGGAGAAGG - Intronic
983332896 4:166354185-166354207 CTGTGTAAGTACATGTAGGATGG + Intergenic
984084008 4:175285827-175285849 CTGTGAAAATACAAGTGAATGGG - Intergenic
984428563 4:179619563-179619585 CAGTAAAAGAAAAAGTGAGATGG - Intergenic
984548770 4:181136371-181136393 ATGTGGAAGTTCAAGTGAGAGGG - Intergenic
984855520 4:184192139-184192161 ATATGAAAGTACAAGTGACTTGG + Intronic
986507745 5:8470467-8470489 CAGTGAAAGCACATGGGAGAGGG - Intergenic
988923363 5:35964367-35964389 ATGTGGAGGTGCAAGTGAGATGG - Intronic
989282664 5:39663942-39663964 CTTTGAAAGGACCAGTGAGTTGG + Intergenic
990087971 5:52002503-52002525 CTGTGAAAGAATAAATCAGAGGG + Intergenic
990644070 5:57823585-57823607 CTGTGAAAGTACTTGTAAAAGGG - Intergenic
991139620 5:63224967-63224989 ATGTCAAATTACAAGTGAGGAGG + Intergenic
995458069 5:112372911-112372933 TTTTGAAAGTAAAAGTGACAGGG + Intronic
996065523 5:119074699-119074721 CTCTGAAAGCACAGGAGAGATGG - Intronic
997536373 5:134625395-134625417 TTTTGAGAGTACTAGTGAGAGGG + Intronic
999627517 5:153536108-153536130 GTGTGGAAGGACAATTGAGATGG - Intronic
999832781 5:155336751-155336773 CTGTTAAAGTACAAGTCTCATGG + Intergenic
1000146130 5:158454900-158454922 AAGGGAAAGTCCAAGTGAGAGGG + Intergenic
1000644769 5:163747875-163747897 GTCTGAAAATACTAGTGAGAAGG - Intergenic
1001671874 5:173480493-173480515 CTGTGAAACTATATGTCAGATGG - Intergenic
1003408204 6:5840378-5840400 CTGTGTAAGTAGAAGTATGAAGG - Intergenic
1004032995 6:11890584-11890606 CTTTGAAACTACAAGAGAGTAGG - Intergenic
1004797473 6:19103620-19103642 CTGAGAAAGAACAAGAGAAATGG + Intergenic
1005098407 6:22143643-22143665 CGGTGAAAGGAAAATTGAGATGG - Intergenic
1006599447 6:35215762-35215784 CTGTGAAAGGACAGGTTGGAGGG - Intronic
1007165791 6:39828029-39828051 CTGTGGGAGCACAGGTGAGAGGG - Intronic
1007536363 6:42593678-42593700 CTTTGAAAGGACAAGTAATAGGG - Intronic
1008269823 6:49478070-49478092 CTGTGAAAGTAAAAATAAGGAGG - Intronic
1008307547 6:49922574-49922596 TTGTGACAGAACATGTGAGATGG + Intergenic
1013010595 6:106116520-106116542 CTGTGGAGTTAGAAGTGAGATGG - Intergenic
1014235037 6:118944370-118944392 CTGTGAAAGTAGTACTAAGAGGG + Intergenic
1014341845 6:120219197-120219219 CATTGAAAGTAGTAGTGAGAGGG - Intergenic
1014734341 6:125074627-125074649 CTGTGAAAGGAGAAATGAAAAGG - Intronic
1014829871 6:126090169-126090191 CTGTAAAAGAGCAAGTGATAAGG - Intergenic
1017847906 6:158275409-158275431 CTGTGAAAGACCATGGGAGATGG + Intronic
1021650144 7:22824976-22824998 CTGTAAAATTATAACTGAGACGG - Intergenic
1023564477 7:41509993-41510015 CTGTGAAGGTTCAATGGAGAGGG - Intergenic
1024188464 7:46980312-46980334 CTGTGAAAGCACAACTGAGAGGG + Intergenic
1024581978 7:50808044-50808066 CTGTAAAAATAGAAGTGAAATGG + Intergenic
1025532031 7:61899779-61899801 CTATGAAAGGACATTTGAGAGGG + Intergenic
1026421679 7:70243872-70243894 CTGTCAAGGTAAAAATGAGAGGG - Intronic
1026421689 7:70244025-70244047 CTGTCAAGGTAAAAATGAGAGGG + Intronic
1027710440 7:81594309-81594331 CTGGAAAAGTACTAGTGAGTTGG - Intergenic
1027865425 7:83640078-83640100 CTGGGAAAGAACAAGTCAGGAGG + Intronic
1029072276 7:97909606-97909628 CTGTAAAAGTGTAAGTGAGGGGG - Intergenic
1030470256 7:109954259-109954281 CTGTGAGCCTACAAGTGTGAAGG + Intergenic
1031325728 7:120394733-120394755 CTGTGAGACTAGAAGTAAGATGG + Intronic
1031554037 7:123149477-123149499 CTGTGATGGTACAAGTGGCAGGG + Intronic
1034206541 7:149320916-149320938 CTGTGAATGTAGAAGTGAGGGGG - Intergenic
1035445190 7:158936491-158936513 TTGTGAAAGTAAAATTGAGGTGG + Intronic
1035960566 8:4132453-4132475 CTGTTAAAGTAAAAGTTAAATGG - Intronic
1036172539 8:6503262-6503284 CTGTGAAAGTAAAACACAGAAGG + Intronic
1036438519 8:8758750-8758772 CTGTGAAAGTGGAAATGAGATGG - Intergenic
1036888846 8:12581633-12581655 CTGTAAAAGTGTAAGTGAGGGGG - Intergenic
1036896439 8:12639775-12639797 CTGTAAAAGTGTAAGTGAGGAGG - Intergenic
1038125789 8:24671408-24671430 CTGAGAAAGCAGATGTGAGAAGG + Intergenic
1038474817 8:27858139-27858161 CTGAGAAAGTCTAAGTGAGGTGG + Intergenic
1040901019 8:52417200-52417222 ATGGGAAAGTAGAAGTGAGTAGG - Intronic
1041148369 8:54904174-54904196 CTGTCAAGGCACAAGAGAGAAGG + Intergenic
1041225985 8:55698577-55698599 CTGAGAAAGTACAATTCAGGAGG + Intronic
1041306011 8:56461735-56461757 CTGTGAAAGTAGAAGGAAGTGGG - Intergenic
1041685909 8:60644400-60644422 CTGTGAAAGTACCAGGGACTGGG - Intergenic
1042301815 8:67291154-67291176 CTGTGAAACTACCAGGGAGTTGG - Intronic
1042734049 8:71968028-71968050 TTGTGAAAGTAGGAGAGAGAAGG + Intronic
1043796770 8:84552234-84552256 CTGAGAAAATACAAATAAGATGG + Intronic
1045702187 8:104879959-104879981 CTGGGGAAATAAAAGTGAGATGG - Intronic
1045760990 8:105607430-105607452 GTGTGAGAGTGAAAGTGAGAGGG - Intronic
1046480918 8:114816969-114816991 CAGTAAAATTACAACTGAGAAGG - Intergenic
1046540785 8:115579826-115579848 ATATAAAATTACAAGTGAGAGGG + Intronic
1046624351 8:116560869-116560891 CTGTGAAAGGACAAATGGAAGGG + Intergenic
1048381821 8:133871970-133871992 CTTTCAAAGTGCAAGTCAGATGG - Intergenic
1051193818 9:14541925-14541947 CTGTAAAAATACAATTGACAGGG + Intergenic
1051725500 9:20084516-20084538 CTGTGAAAGAAAAAAGGAGAGGG - Intergenic
1053317190 9:37061925-37061947 TTGTGAAACTGCAAGTGAGCTGG - Intergenic
1053321710 9:37104618-37104640 TTGTGAAACTGCAAGTGAGCTGG - Intergenic
1054834360 9:69660851-69660873 TTTTGAAAGGACAAGAGAGATGG + Intronic
1055521105 9:77081844-77081866 CTTTGAAAGTATAAATCAGAAGG + Intergenic
1055812534 9:80165871-80165893 CTGGGAACCTACAAGTGGGATGG + Intergenic
1056221239 9:84452433-84452455 CTGTGACAGGAAAAGTGACAAGG - Intergenic
1056368346 9:85929076-85929098 CTTTGAAAGTACGAGACAGATGG + Intergenic
1056989888 9:91400885-91400907 CTTTGAAAGGACAAGGCAGAAGG - Intergenic
1058607563 9:106739691-106739713 CTTTAAAAGAACAAGTGACATGG - Intergenic
1059098705 9:111447871-111447893 CTGTGAAAGGACAAGGGAAAAGG - Intronic
1059817501 9:117934016-117934038 GTGAGAAAGTACAAGTGGGAAGG + Intergenic
1062134107 9:134915617-134915639 CAGTGAAAGTCCAAGTCATAGGG + Intronic
1187413203 X:19069405-19069427 CTGTAAAAGGATAAGTGATATGG + Intronic
1188574242 X:31627174-31627196 CTGTGAAAATAAGAATGAGATGG - Intronic
1188807175 X:34605505-34605527 CTGTAAATGTACAATTGAAATGG - Intergenic
1189592020 X:42523576-42523598 CTGGGCAAGTACAGGTGAGAGGG + Intergenic
1189847308 X:45149343-45149365 CTGTGACTGTGCAGGTGAGAAGG + Exonic
1194605039 X:95967905-95967927 ATGTGAAAGTAACAGTGAGGAGG - Intergenic
1194720083 X:97330015-97330037 CTGTGCAAGTTCAGGAGAGAGGG - Intronic
1195550574 X:106164953-106164975 TTGGGAAAGGACAAGTGGGAAGG + Intergenic
1196021530 X:110995930-110995952 CTGAGAAAGTATAATTGAAATGG - Intronic
1197362234 X:125519217-125519239 CTGTGAAAGTACATGGAAGAAGG - Intergenic
1198055154 X:132986816-132986838 CTGTGAAACTAAAAGTGAGGTGG + Intergenic
1198221592 X:134607566-134607588 CTGTGCAAGAACCAGTGGGAAGG + Intronic
1198520667 X:137449246-137449268 CAGTGAAAGGAAAAGGGAGAAGG - Intergenic
1200490606 Y:3818344-3818366 CTGTGTCAGTGCATGTGAGATGG - Intergenic
1201571795 Y:15423106-15423128 CTGGGAAAGTAGGAGTGATAAGG - Intergenic