ID: 1126745353

View in Genome Browser
Species Human (GRCh38)
Location 15:51820415-51820437
Sequence AATCTGCTCTATAGGCCAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126745348_1126745353 19 Left 1126745348 15:51820373-51820395 CCCATCTTCCAGAGAGAAAATCA No data
Right 1126745353 15:51820415-51820437 AATCTGCTCTATAGGCCAAATGG No data
1126745349_1126745353 18 Left 1126745349 15:51820374-51820396 CCATCTTCCAGAGAGAAAATCAA No data
Right 1126745353 15:51820415-51820437 AATCTGCTCTATAGGCCAAATGG No data
1126745350_1126745353 11 Left 1126745350 15:51820381-51820403 CCAGAGAGAAAATCAACAAAGAA 0: 20
1: 425
2: 618
3: 661
4: 1438
Right 1126745353 15:51820415-51820437 AATCTGCTCTATAGGCCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126745353 Original CRISPR AATCTGCTCTATAGGCCAAA TGG Intergenic
No off target data available for this crispr