ID: 1126746942

View in Genome Browser
Species Human (GRCh38)
Location 15:51835764-51835786
Sequence CTACATAAGAATAATGAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 227}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126746942_1126746944 8 Left 1126746942 15:51835764-51835786 CCAACCTCATTATTCTTATGTAG 0: 1
1: 0
2: 0
3: 19
4: 227
Right 1126746944 15:51835795-51835817 ACTTTTCCTCATTTCTTTCCAGG 0: 1
1: 0
2: 5
3: 47
4: 507

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126746942 Original CRISPR CTACATAAGAATAATGAGGT TGG (reversed) Intronic
903249638 1:22043435-22043457 CTAGACAAGCATAATGATGTGGG + Intergenic
904687643 1:32272422-32272444 CTACAAAAAAATAATCAGCTGGG + Intronic
907191676 1:52654342-52654364 CTGAAAAAGAATAATGAAGTTGG + Intronic
907593925 1:55702520-55702542 TTACATAATAATGATGATGTAGG + Intergenic
907957749 1:59247101-59247123 CTTTATAACAATTATGAGGTAGG + Intergenic
908917886 1:69153148-69153170 CTACATATGAAAAATGACATTGG + Intergenic
909773076 1:79450292-79450314 TTAACTAAGAATAATGTGGTTGG + Intergenic
911445199 1:97983987-97984009 CTACAACAGTTTAATGAGGTGGG - Intergenic
914757219 1:150570077-150570099 CTTCATAAGAAATGTGAGGTTGG - Intergenic
915881675 1:159679193-159679215 CTACAAAAGATTACAGAGGTGGG - Intergenic
917841262 1:178981033-178981055 CTACAAAAAAATAATTAGCTGGG - Intergenic
918804035 1:189016120-189016142 CTTCATAAGATTAGTGAGGGAGG + Intergenic
919018956 1:192078343-192078365 GTACATAAGACTAGTGAGTTAGG - Intergenic
919533077 1:198749632-198749654 TTATAAAAGAATAATGAGCTTGG + Intronic
922369867 1:224898701-224898723 CTAGATAAAAATAATGACGGTGG + Intronic
923850164 1:237785632-237785654 TTAGATAAGAATGAAGAGGTAGG + Intronic
924257739 1:242199028-242199050 ATACAAAACAATAATGAGGCAGG - Intronic
924336264 1:242989437-242989459 CTACATAAAAATAATAAAGTGGG - Intergenic
1065720856 10:28627705-28627727 CTACATAACTATAATAAGCTGGG + Intergenic
1067108332 10:43380488-43380510 CTACATAAAAAAAATTAGCTGGG - Intergenic
1069007393 10:63333716-63333738 TTACAGAAGAATAATTATGTGGG - Intronic
1069466368 10:68642959-68642981 CTCAATAAGAAAAATTAGGTTGG + Intronic
1071185418 10:83038286-83038308 CTTCATAACAACAGTGAGGTAGG + Intergenic
1074088264 10:110225226-110225248 ATACATAAGGAAAATGAGGCTGG + Intronic
1074200764 10:111233184-111233206 CTACATAAGAATAGTGACAGAGG - Intergenic
1076391281 10:130104691-130104713 TTACCAAAGAATAATGAGTTGGG - Intergenic
1077679865 11:4228860-4228882 CTACAGAAGAAGAATGATGCTGG + Intergenic
1081379483 11:42397158-42397180 CTACAGAATAAGAATGTGGTTGG - Intergenic
1081952514 11:47056858-47056880 CTGCAGAAGAATAATGCAGTAGG - Intronic
1082016968 11:47496800-47496822 CTGACTAAGAATAAAGAGGTAGG + Intronic
1083563242 11:63691415-63691437 CAAAATAAAAATAATTAGGTCGG - Intronic
1086591392 11:88519054-88519076 ATACATTAGAATTATGAAGTTGG + Intronic
1088280235 11:108127710-108127732 GTAAATATGACTAATGAGGTAGG + Intronic
1089848135 11:121474468-121474490 CTACGTAATAATAAAGAGGAGGG - Intronic
1090466648 11:126940760-126940782 CTACAGAGGAGTAAAGAGGTAGG - Intronic
1093741627 12:22695009-22695031 ATACATAAAAATAATTATGTAGG - Intergenic
1093873153 12:24316642-24316664 GTACATAGGAATAATGAAATAGG + Intergenic
1094399789 12:30049933-30049955 CTCCATAAGAATTAAGAAGTAGG - Intergenic
1094659977 12:32460004-32460026 CTAAATAATAATAATCAAGTAGG - Intronic
1095395579 12:41758604-41758626 CAACATAACCACAATGAGGTGGG - Intergenic
1096217406 12:49805574-49805596 CCACAAAAGAAAAATGGGGTTGG + Intronic
1097649075 12:62273401-62273423 CTTCATATGAATAAAGTGGTTGG - Intronic
1097951822 12:65438460-65438482 CTACATAGGATTAATGAGGAAGG + Intronic
1099305170 12:80945142-80945164 CTAAATAAAAATATTCAGGTTGG - Intronic
1099402628 12:82218868-82218890 CCACATAATAATAATGAGGGAGG - Intergenic
1099695916 12:86019247-86019269 CTCCATAAAACTCATGAGGTAGG + Intronic
1100171025 12:91975359-91975381 TTACATAATAATAATAAAGTAGG + Intergenic
1101085441 12:101230864-101230886 CTTCATAAGATTAATGAGTCAGG + Intergenic
1101551895 12:105771088-105771110 CAACATAAGAATCATGAATTTGG + Intergenic
1102919007 12:116777871-116777893 CTACATAAGCATAAAGGCGTTGG - Intronic
1103691258 12:122775907-122775929 ATAAACAAGAATAATGAGGTTGG - Intronic
1105548381 13:21368703-21368725 CTACAGAAAAAAAATGAGCTGGG + Intergenic
1105838041 13:24227864-24227886 CTATATAAGAATTCTGAGGCCGG - Intronic
1106014974 13:25860335-25860357 ATAAATAATAATAATGAGGAAGG - Intronic
1106306188 13:28512540-28512562 TTACATAATAATAAAGAGATTGG - Intergenic
1108639582 13:52370540-52370562 CTACCTAAGAATAGTGTGCTTGG + Intergenic
1108845059 13:54668167-54668189 ATAAATAAGAATAGTGAGGAAGG - Intergenic
1108856843 13:54803156-54803178 TCATATAAGAATAATGATGTTGG + Intergenic
1109585437 13:64396114-64396136 CTACATCAGTAGAATGAGCTAGG - Intergenic
1110345433 13:74442209-74442231 CTACATACAAACAATGAGATTGG - Intergenic
1110387478 13:74930733-74930755 CTATAGCAGAATAATGACGTTGG - Intergenic
1111855329 13:93630375-93630397 CTTCATCTGAATAATGAGCTAGG + Intronic
1112393696 13:99008913-99008935 CAACATATGAATAGGGAGGTAGG + Intronic
1112667920 13:101598099-101598121 GTACATAAAGATAATGAAGTTGG - Intronic
1112829020 13:103425786-103425808 GTACTTAAGTAGAATGAGGTGGG + Intergenic
1114724693 14:24923155-24923177 CTAAATATGAATAATGACATGGG - Intronic
1115957257 14:38795128-38795150 CTAGATAAAAATAAGGGGGTAGG - Intergenic
1117739653 14:58803859-58803881 CTACTGAAGAAAAATGAGGATGG + Intergenic
1118469303 14:66060174-66060196 TTAAATAAAAATAGTGAGGTGGG + Intergenic
1118647839 14:67857404-67857426 GTACATAAAAATAATGAAGTAGG + Intronic
1119250242 14:73146347-73146369 CTACAAAAAAATAATTAGCTGGG - Intronic
1120444246 14:84573885-84573907 TTGCATAATAATAATAAGGTGGG - Intergenic
1120574626 14:86167236-86167258 GTACATAAGAATTATGACTTTGG + Intergenic
1126746942 15:51835764-51835786 CTACATAAGAATAATGAGGTTGG - Intronic
1126980742 15:54239748-54239770 ACAGATAAGAATAAGGAGGTGGG - Intronic
1128784933 15:70387981-70388003 CTAAATGAGAATATTGAGGAAGG + Intergenic
1128820032 15:70643513-70643535 CTTCATAAGACTCATAAGGTGGG - Intergenic
1130877775 15:88029137-88029159 CTATACAAAAATAATGAGGGGGG + Intronic
1130907413 15:88250470-88250492 CTACACAAGGATAAGAAGGTAGG + Intronic
1132396187 15:101476433-101476455 CTATTTAAAAAGAATGAGGTAGG + Intronic
1134373730 16:13650233-13650255 TTACATAAGCAAAATGAGGTGGG + Intergenic
1135087969 16:19489947-19489969 CTACAAAAAAATAATTAGCTGGG - Intronic
1136475193 16:30508507-30508529 CTGTATAAGAATAATTCGGTTGG - Intronic
1137690860 16:50426410-50426432 CTACAAAAAAATAATTAGCTTGG - Intergenic
1137691026 16:50427820-50427842 CTACAAAAAAATAATTAGCTTGG + Intergenic
1140028517 16:71313963-71313985 CTACATAAGAACAAAGAGTGTGG + Intergenic
1140075598 16:71695869-71695891 CTATATAAAAATAATCAAGTTGG + Intronic
1146028824 17:29346808-29346830 CTACAAAAGAAAAATGAGCTGGG - Intergenic
1147032610 17:37652235-37652257 CTGTATAAAAATAATGGGGTAGG - Intergenic
1149975475 17:61261504-61261526 TAACAGAAGAGTAATGAGGTTGG - Intronic
1153350457 18:4075512-4075534 TTACATAGGAAAAATGTGGTTGG + Intronic
1153599649 18:6767406-6767428 CTACAAAAGAATAAAAATGTGGG - Intronic
1153734707 18:8053598-8053620 CTCCGTAGGAAGAATGAGGTAGG - Intronic
1154095567 18:11411859-11411881 GTACATAAAAGTAAAGAGGTTGG - Intergenic
1155932550 18:31722960-31722982 TTACATACTAATCATGAGGTTGG + Intergenic
1158150683 18:54365804-54365826 CTAAATAATGATAATCAGGTGGG + Exonic
1161784453 19:6315050-6315072 CTACAAAAAAATAATTAGCTGGG - Intronic
1162953246 19:14084231-14084253 CTACACAAAAATAATTAGCTGGG + Intronic
1163560298 19:18015261-18015283 CTACAAAAAAATAATTAGCTGGG - Intergenic
1164185453 19:22863724-22863746 GTAAATAAAAATAATGTGGTAGG - Intergenic
1166581487 19:43903798-43903820 CCACCTAATAATAATGAGGCAGG + Intergenic
1166845705 19:45726955-45726977 TTACATGAGAATACTGAGGCTGG + Intronic
1167518115 19:49935158-49935180 CTACAAAAAAAAAATTAGGTGGG + Intronic
925523621 2:4775686-4775708 CCACATAATAATCAAGAGGTTGG + Intergenic
925721592 2:6833631-6833653 CAACATAAGAATTTGGAGGTGGG + Intergenic
928543876 2:32310712-32310734 CTACAAAAGAAAAATTAGCTGGG + Exonic
928703067 2:33918672-33918694 CTTCAAAATAATAATGAGGGGGG + Intergenic
929299727 2:40289180-40289202 CTACAAAAGAATAAAAAAGTAGG + Intronic
932044523 2:68334586-68334608 CCAAATAACAATAATGAAGTTGG - Intergenic
933364639 2:81334965-81334987 GGATATAAGAATTATGAGGTAGG + Intergenic
934562844 2:95322062-95322084 GGCCATAAGAATAATGAGGTTGG + Intronic
935446703 2:103164990-103165012 CTACATAAGAATTGTCAGGCTGG + Intergenic
936094312 2:109520300-109520322 CTGCTTAAGAATTATGATGTTGG + Intergenic
936105199 2:109617092-109617114 TTACATAAGAATCATTAAGTTGG - Exonic
939047506 2:137267339-137267361 CTTCATAGGCCTAATGAGGTTGG + Intronic
939319384 2:140597327-140597349 ATACATAAGAATAAATGGGTGGG + Intronic
943210362 2:184956624-184956646 CTACATGATTCTAATGAGGTAGG - Intergenic
945599351 2:211839392-211839414 CTACATAACACTTATGAGATGGG + Intronic
947171229 2:227313978-227314000 GTACATCAGAATCATGTGGTGGG - Exonic
947174620 2:227351994-227352016 CTACTCAAAATTAATGAGGTGGG + Intronic
1168907669 20:1419097-1419119 CTAAGAAAGAATAATGAGGTAGG + Intergenic
1176940917 21:14924629-14924651 CTAGAGAAGAATATTGAAGTTGG + Intergenic
1177622438 21:23613554-23613576 ATTAATAAGTATAATGAGGTTGG - Intergenic
1183410503 22:37652370-37652392 CTACAAAAAATAAATGAGGTCGG + Intronic
949237860 3:1832215-1832237 CAACATATGAATTTTGAGGTGGG + Intergenic
949798494 3:7877670-7877692 CTACTCAAGAACACTGAGGTGGG + Intergenic
958438591 3:94128303-94128325 ATACAGAAGAATAATGATGGTGG + Exonic
958863590 3:99473217-99473239 CCACACAGGAATAATGAGGGTGG + Intergenic
960346902 3:116544442-116544464 AGCCATAAAAATAATGAGGTCGG + Intronic
960427547 3:117527366-117527388 CAACATATGAATTATGAGGAGGG - Intergenic
961269370 3:125677606-125677628 CCACAGAAGAAAGATGAGGTTGG + Intergenic
962584904 3:136832307-136832329 CTAGATTAGAAGAATGAGCTGGG - Intronic
962592931 3:136909036-136909058 CTACATAACAACAAGGAGGAAGG - Intronic
964130070 3:153276739-153276761 CTCCATGAGAATAATCAGGGAGG - Intergenic
965911610 3:173784476-173784498 TTATATAAGAATCATGGGGTAGG - Intronic
966757332 3:183383651-183383673 CTACATGAGAATAATGAAAGAGG - Intronic
970482288 4:16488383-16488405 CTTCATAAGAGCAATGAGTTGGG - Intergenic
970698350 4:18704942-18704964 CTACAAAAGAAAAATGAGCTAGG - Intergenic
970739586 4:19219487-19219509 CTACATAAAAATAATGCAGCTGG - Intergenic
972801461 4:42479960-42479982 TTACATAATTCTAATGAGGTAGG - Intronic
972949227 4:44298412-44298434 ATACAGAAAAATAAAGAGGTGGG - Intronic
973254837 4:48099625-48099647 CTGAAAAAGAATAATGAGGGAGG + Intronic
974605230 4:64143174-64143196 CTGTATAGGAATAATTAGGTTGG + Intergenic
976224301 4:82782904-82782926 CCACACAACAATACTGAGGTGGG + Intronic
978297946 4:107230545-107230567 CTAAATTAGGAGAATGAGGTTGG - Intronic
979240861 4:118445873-118445895 CTACATAAAAATAATAAAGTGGG + Intergenic
979603283 4:122609290-122609312 CTACTCAAGAAGAATGAGGAGGG + Intergenic
983132660 4:164041771-164041793 CTACATCAGAATCATAAGGAGGG - Intronic
983166164 4:164479273-164479295 CTACATAAAATTTATGTGGTGGG - Intergenic
983891800 4:173037332-173037354 CTTCATCAGTAAAATGAGGTGGG - Intronic
984317906 4:178151630-178151652 CTACATAATAACATTGGGGTTGG + Intergenic
984399598 4:179244382-179244404 CAACATATGAATTCTGAGGTGGG + Intergenic
984879076 4:184394718-184394740 CCACAGTAGAATAATGGGGTGGG - Intronic
985198514 4:187459531-187459553 GGACACAAGAATAATGAGATTGG - Intergenic
985519389 5:365287-365309 ATATTGAAGAATAATGAGGTGGG + Intronic
987907151 5:24091493-24091515 CCACATAAGAAAACTGAGGCAGG + Intronic
989612213 5:43305471-43305493 CTATTTAAGAATAAAGAGGCCGG + Intronic
991438503 5:66621130-66621152 ATACTTAAGAAAAATGAAGTCGG + Intronic
992133027 5:73714004-73714026 CTAAATAAGAGGAATGAGCTGGG + Intronic
994201565 5:96982638-96982660 CTACATAAGAATGTTGGGGGTGG + Intronic
995301165 5:110585103-110585125 CTACTTAAGAAGAAGGAGCTGGG - Intronic
996801595 5:127409562-127409584 CTAGGTAAGACGAATGAGGTGGG - Intronic
997060660 5:130498529-130498551 CAGCTGAAGAATAATGAGGTTGG - Intergenic
997125046 5:131217876-131217898 ATACATTAGAAAAATGAGGCTGG + Intergenic
997782245 5:136671232-136671254 TTACAAAAGAATAGTGAGGTTGG - Intergenic
999627902 5:153539579-153539601 GTACATATGTAGAATGAGGTTGG + Intronic
1000414499 5:160969381-160969403 CTCCATAATAATAATGAGAGGGG + Intergenic
1003337518 6:5187948-5187970 CTACATAAGAATCTTTATGTGGG + Intronic
1003640843 6:7873946-7873968 CTTCACAAGCAGAATGAGGTTGG + Intronic
1003650967 6:7959800-7959822 CAATATAAGAAAAATGAGCTGGG + Intronic
1004090754 6:12498240-12498262 ATAAATAATAATAATGAGGAAGG + Intergenic
1004361823 6:14978028-14978050 CACTATAAGAATAATGAGGTTGG - Intergenic
1005874152 6:29998612-29998634 CTACACAATAATGATGAGGTTGG + Intergenic
1006290092 6:33128204-33128226 CTATAGAAGAAAAATGGGGTCGG - Intergenic
1007020236 6:38512438-38512460 CTATTTAAGAATAAGGATGTGGG + Intronic
1008674349 6:53803657-53803679 CTAGATCAAAATAATGAGGAGGG - Intronic
1008695579 6:54032451-54032473 ATACACAATAATGATGAGGTAGG + Intronic
1010261012 6:73816836-73816858 AAACATGAGAAAAATGAGGTGGG + Intronic
1010396149 6:75394489-75394511 CAAAATAAAAATAATGAGATAGG + Intronic
1010429119 6:75758619-75758641 CTAAATAAGAAAAATTAGCTGGG - Intronic
1011765335 6:90613391-90613413 AAAAATAAGAATAATCAGGTGGG - Intergenic
1012265671 6:97138856-97138878 CTTCAGAACAATTATGAGGTAGG - Intronic
1013128852 6:107212434-107212456 CTACCTAAAAAGAATGTGGTGGG + Intronic
1013523880 6:110957007-110957029 ATAAATAAGAAAACTGAGGTTGG + Intergenic
1014066150 6:117128540-117128562 CTAGCTAAGTATAATGTGGTTGG + Intergenic
1014236719 6:118965342-118965364 GTACTGAAGAATAATGAGGCCGG - Intronic
1014266056 6:119278987-119279009 CTATAAAAGAATACTGAGGCTGG - Intronic
1014429500 6:121350831-121350853 CTACATAAGCAGAATGAAGAGGG + Intergenic
1015557295 6:134476402-134476424 CTGCATCAGAATAATGAGGAAGG - Intergenic
1016163633 6:140911859-140911881 ATACTTAAAAATAATGAGGCAGG + Intergenic
1016308142 6:142704892-142704914 TTACATGAAAAAAATGAGGTTGG + Intergenic
1018301440 6:162406861-162406883 CTAAATAAAAATACTGGGGTGGG - Intronic
1023308474 7:38856372-38856394 CAACATATGAATTAGGAGGTGGG + Intronic
1026001175 7:66559687-66559709 CTTAATAAGAATAAATAGGTCGG + Intergenic
1026056423 7:66988204-66988226 CTACATAAGTATAATAATGTGGG - Exonic
1026288732 7:68986838-68986860 CTACAAAGGAATATTGAGGCTGG - Intergenic
1026721671 7:72836849-72836871 CTACATAAGTATAATAATGTGGG + Intergenic
1026989291 7:74574296-74574318 TTAAATAAGAATAATGAGGCCGG - Intronic
1027111874 7:75446479-75446501 CTACAAAAAAATAAAGAGGCTGG - Intronic
1027284104 7:76631010-76631032 CTACAAAAAAATAAAGAGGCTGG - Intergenic
1027627924 7:80566374-80566396 CAACATAATAATAGTGGGGTTGG - Intronic
1028032870 7:85939410-85939432 CTACAGAAGAATTATGAGTGAGG + Intergenic
1029887369 7:103887544-103887566 ATTCAAAAGAAAAATGAGGTGGG + Intronic
1030284730 7:107814212-107814234 CTACATTTAAATAATGAGCTTGG + Intergenic
1030464901 7:109888815-109888837 TTACTTAATAATAATGAGGATGG - Intergenic
1031821214 7:126504086-126504108 CTCCATGAGAAAAATGAGATGGG - Intronic
1031883167 7:127219597-127219619 CTACAAAAAAATAATTAGCTGGG - Intronic
1032605782 7:133350369-133350391 CTACATACAAAAAATGAAGTTGG - Intronic
1032684324 7:134216120-134216142 CCCCATAAAAATACTGAGGTAGG - Intronic
1035715709 8:1753229-1753251 CCTAATAAAAATAATGAGGTGGG - Intergenic
1035851031 8:2919480-2919502 TTACAAAATAATAATGAGTTTGG - Intergenic
1035885075 8:3282819-3282841 TTACATAAGAAAATTGAGTTAGG - Intronic
1037221077 8:16522334-16522356 CTACAGAAGAATGACTAGGTTGG - Intronic
1038708544 8:29920036-29920058 CTAGAAAAGAGTTATGAGGTTGG - Intergenic
1039525269 8:38209027-38209049 CTCCATAAGGATAATGGGGCAGG - Exonic
1039638129 8:39188422-39188444 CAACATAAGAATAATTATTTTGG + Intronic
1040664519 8:49617502-49617524 CCACCTAAAAAGAATGAGGTAGG - Intergenic
1041490476 8:58427079-58427101 CTATATAAAATTAATGAGGATGG + Intronic
1042536015 8:69859983-69860005 CTCCATAAGGATAATGGGGCAGG + Intergenic
1043965497 8:86470276-86470298 CCACACAAGAACAATCAGGTGGG + Intronic
1044457733 8:92407580-92407602 CTACATATGCAAAATGATGTGGG - Intergenic
1045131287 8:99156707-99156729 GTACATAACAATAATGAAGCAGG - Exonic
1045746897 8:105432939-105432961 AAACATAAAAATAATTAGGTGGG + Intronic
1046486535 8:114895117-114895139 CTAGATGAGTATAATGAGGGTGG + Intergenic
1046540395 8:115573502-115573524 CTACACTAGGATAATGATGTTGG - Intronic
1047412516 8:124635878-124635900 CTAAATGAGAATATTGAGGCAGG - Intronic
1048112151 8:131480190-131480212 CTTCAGAAAAATAATGAGATTGG + Intergenic
1049962245 9:747973-747995 CTACAAAAGAAAAATTAGCTGGG + Intergenic
1052243495 9:26304500-26304522 CTTCATAAGTATAATGAATTTGG - Intergenic
1052555147 9:30003294-30003316 CTAAATAACAATAATTAGGAAGG + Intergenic
1054838189 9:69702650-69702672 CCACATAAATATAATGAAGTGGG - Intergenic
1055224432 9:73977188-73977210 CTACATAAGTAGAAAGAGGAAGG + Intergenic
1056667811 9:88595634-88595656 TGACACAAGAATAATGAGCTGGG + Intergenic
1187227203 X:17384997-17385019 GGAAATAAAAATAATGAGGTAGG + Intronic
1189612220 X:42749351-42749373 CTACAAAACAATAATGATTTTGG + Intergenic
1194662677 X:96644117-96644139 TTACATGAGAGTAATGAGATAGG - Intergenic
1194946266 X:100071909-100071931 CTACAAAAGAAAAATGATGATGG + Intergenic
1195116640 X:101706011-101706033 CTGCATAATAATTATGAGTTTGG - Intergenic
1195418286 X:104643906-104643928 TTACACAAGGGTAATGAGGTTGG + Intronic
1195837904 X:109139696-109139718 CAACATAAAAATAATGAATTTGG + Intergenic
1196203923 X:112917474-112917496 CTACGTGGGAGTAATGAGGTTGG + Intergenic
1196414973 X:115461551-115461573 CTACAAAAGAAAAATTAGCTGGG + Intergenic
1197055814 X:122117023-122117045 CTACATAAGCAGTATGAGCTTGG + Intergenic
1198104827 X:133452208-133452230 CTACATAAAAATAATAAGAGAGG + Intergenic
1198712060 X:139515215-139515237 ATACTTAAGAAGAATGAAGTTGG - Intergenic
1199478437 X:148272230-148272252 CAACATAAGAGTAATGATGTAGG - Intergenic
1200789009 Y:7283319-7283341 CGACATAAGAATCTTGGGGTGGG - Intergenic