ID: 1126751253

View in Genome Browser
Species Human (GRCh38)
Location 15:51878822-51878844
Sequence CTTCAATCTTTTCTGGAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 382
Summary {0: 1, 1: 0, 2: 11, 3: 59, 4: 311}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126751250_1126751253 6 Left 1126751250 15:51878793-51878815 CCTCTTGGAGATTATAGTGGAGT 0: 1
1: 0
2: 1
3: 15
4: 183
Right 1126751253 15:51878822-51878844 CTTCAATCTTTTCTGGAACAAGG 0: 1
1: 0
2: 11
3: 59
4: 311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126751253 Original CRISPR CTTCAATCTTTTCTGGAACA AGG Intronic
900306122 1:2009370-2009392 CTTCCATCTTCACTGGAGCATGG + Intergenic
900983870 1:6061784-6061806 CTACAATCCTTTTTGGAATAAGG - Intronic
902729646 1:18361074-18361096 CTTCCATCCTTTCTGGAAGTTGG - Intronic
903035227 1:20488548-20488570 CTTTAACCTTATTTGGAACAAGG - Intergenic
903305117 1:22407880-22407902 CTTCTCTCTTCTCTGGATCAGGG - Intergenic
903615473 1:24651520-24651542 TTTCCTTCTTTTCTGGAGCAGGG - Exonic
905517654 1:38573774-38573796 CTTAAATCTTTTATGGAACAAGG + Intergenic
905727171 1:40262583-40262605 CTTTAGTCTTTTTTGGACCAAGG - Intronic
907719439 1:56958038-56958060 TTTTAATGTTTTCTGGAACACGG - Intronic
907893132 1:58655512-58655534 CTTACATTTTTCCTGGAACAAGG - Exonic
907976092 1:59432811-59432833 TTTCAATCTCTTCTGAAACTAGG - Intronic
908021931 1:59907014-59907036 GTTCAAACTTTTCTGGAAGCTGG + Intronic
908038638 1:60083515-60083537 CTTCTCTCTTTTCAGGCACAGGG - Intergenic
909379218 1:74978292-74978314 TCTCAATCTTTACTGGAATAAGG + Intergenic
910208499 1:84771693-84771715 CTTAATTCCTTTATGGAACATGG + Intergenic
910306791 1:85773270-85773292 CTTCAAACTTTACTGCAAGACGG - Intronic
910801991 1:91156317-91156339 CTCACATCCTTTCTGGAACAAGG - Intergenic
910971609 1:92861786-92861808 TTTCAATCTTTTTTGAGACAGGG + Intronic
912566537 1:110591720-110591742 TTTCAACCTTTTCTGGCCCAAGG - Intergenic
912721148 1:112021294-112021316 CTCAAATCTTCTCTGGCACAAGG - Intergenic
912919911 1:113855968-113855990 CTTCAATCTATTCTATACCATGG - Intronic
912927713 1:113928467-113928489 GTTCCATTTTATCTGGAACAGGG - Intergenic
913522005 1:119653542-119653564 CTTTAGTCTTGTCTGGAAGAGGG + Intergenic
913530180 1:119728407-119728429 TTTAAATCTTTTCTGAAATATGG - Intronic
915003331 1:152613590-152613612 CAGCATTCTTTTCTGGAAGAGGG + Intergenic
915086602 1:153393529-153393551 CTTAAATCATTTCTGGAAGAAGG + Intergenic
915489523 1:156243450-156243472 CTTCAACGTTTTCTGGAACAAGG - Exonic
916384479 1:164251863-164251885 CTTCATTCATTTCTAGAACAAGG - Intergenic
916695233 1:167228790-167228812 CTTACATCCTTTCTGGAGCAAGG + Intronic
918386072 1:184009350-184009372 CTTCAATCCTTTTTGGAAAAGGG + Intronic
919882502 1:201909798-201909820 CTTCACTTTCTTCTGTAACATGG - Intronic
920274609 1:204794828-204794850 CTTAAATCCATTTTGGAACAAGG + Intergenic
920302863 1:204999950-204999972 ATTAAATCTTTGCTGGAAAATGG + Intronic
920860978 1:209706511-209706533 CTGAAATATTTTCTGGAACTTGG - Intronic
920911495 1:210221897-210221919 CTTAAATCATTTCTGAAACAAGG + Intergenic
920919982 1:210290915-210290937 CTTCACTCTTGTCTAGGACAGGG + Intergenic
921034811 1:211366862-211366884 CTTAAAACCTTTCTGAAACAAGG - Intronic
922639682 1:227216453-227216475 CTAAAATCTTTTCTGGAATAAGG + Intronic
923703259 1:236319889-236319911 CTTCACTCTTTTCTAGACCAAGG + Intergenic
924870126 1:248033441-248033463 CTTCATTTTTTTTTGAAACAGGG + Intronic
1064723403 10:18252603-18252625 CTTAAATTATTTCTGAAACAAGG + Intronic
1065127582 10:22588594-22588616 CTTAAATCCTTTCTGGAATAAGG + Intronic
1066318944 10:34280215-34280237 ATTAAATGTTTTCTGGATCACGG - Intronic
1068220074 10:54032892-54032914 CTTCACTCTTTTCTGTCACCAGG - Intronic
1068606120 10:59006889-59006911 CATAAACCTTTTCTGTAACAAGG - Intergenic
1069955104 10:72045093-72045115 TTTAGATCTTCTCTGGAACAAGG - Intergenic
1070560966 10:77566257-77566279 CTTCCATGTTTCCTGGACCAAGG - Intronic
1070821045 10:79354648-79354670 CATAAAACATTTCTGGAACATGG + Exonic
1072530909 10:96318073-96318095 CTTCCATCTTTTCTGGACCTTGG + Intronic
1073787414 10:106905521-106905543 CTACAAACTTTTCTTGAACAGGG - Intronic
1073926906 10:108527057-108527079 TCTCAGTCTTTTCTGGATCAGGG - Intergenic
1074157930 10:110814282-110814304 CTTCAGTCTCTGCTGTAACATGG - Intronic
1074379911 10:112970914-112970936 CTTCATTCCTTTGTGGAAAATGG - Intronic
1074503932 10:114050497-114050519 CTTCAATTTTTTCTGAGACAGGG + Intergenic
1074766145 10:116701507-116701529 CTTGAATCCTGTCTGAAACAAGG + Intronic
1074932661 10:118145081-118145103 CTTCAAGCTTCTCCCGAACAAGG - Intergenic
1076535882 10:131177382-131177404 TTCCATTCTTTTCTGGCACACGG - Intronic
1078723052 11:13901680-13901702 CTTCAGAGTTTTCTGGAATAGGG + Intergenic
1079361602 11:19774873-19774895 TTCCAATCTTTGCTGGAAAAAGG - Intronic
1080441557 11:32299328-32299350 TTTAAATCCTTTTTGGAACAAGG - Intergenic
1081479533 11:43472334-43472356 CTTTTTTCTTTTCTGAAACAGGG - Intronic
1083185488 11:61015562-61015584 TTTCTTTCTTTTCTGGGACAGGG - Intronic
1083427539 11:62596326-62596348 TTTCAACCTTTTCTGTAAGAAGG + Exonic
1084060852 11:66673109-66673131 CCCCAGTCTTTTCTGGATCATGG - Intronic
1085785452 11:79444435-79444457 CTTCAGACTTTTCTGCAAGAGGG - Intergenic
1085852859 11:80141831-80141853 CTTGAATCCTTTCTGGAACAAGG + Intergenic
1090934078 11:131326382-131326404 CTTCCTTCTTATCTGGAAAATGG + Intergenic
1091960656 12:4691474-4691496 CTTAAATCCTTTCTGGAACAAGG - Exonic
1092041665 12:5390435-5390457 CTTTAATATGTTCTGGCACATGG - Intergenic
1093036731 12:14338906-14338928 CTTCAATCTATTCTGCCACGTGG + Intergenic
1098245403 12:68512164-68512186 CTTAAATCTTTTCCTGGACAAGG - Intergenic
1098438901 12:70497778-70497800 ATTCAATCTTTTTGGGATCAAGG - Intergenic
1098812298 12:75110189-75110211 CCTTAATCCTTTCTGGGACATGG - Intronic
1099348121 12:81528342-81528364 CCTAATTCTATTCTGGAACATGG - Intronic
1100219326 12:92487100-92487122 CCTAAATCCTTTCTGGAAGAAGG - Intergenic
1102237330 12:111302071-111302093 CTTGAACCATTTCTGGAACAAGG + Intronic
1102971733 12:117173396-117173418 CTTAAATACTTTCTGGAAGAAGG - Intronic
1104412204 12:128568376-128568398 CTAAAATCCTTTGTGGAACAAGG - Intronic
1106315234 13:28587485-28587507 CTTCTTTCTTTTTTGAAACAGGG + Intergenic
1106441955 13:29782609-29782631 CTCAAATGTTTTCTGGAACTAGG - Intronic
1106699707 13:32216351-32216373 CTTCAGTCTTCTCCAGAACAAGG + Intronic
1108087294 13:46806814-46806836 CTTCAATCATTTTTAGAAGATGG + Intergenic
1109205337 13:59477125-59477147 TTTTAATCTTTTCTGGATCATGG - Intergenic
1109436419 13:62309572-62309594 CTTCATTCTTTTTTTGAAAATGG + Intergenic
1109599595 13:64607320-64607342 TTTAAATTCTTTCTGGAACAAGG - Intergenic
1109842799 13:67942361-67942383 CTTGAATATTTTCTACAACAAGG - Intergenic
1110023604 13:70508089-70508111 CTTCAATTTATTATGGAAGAGGG + Intergenic
1110390928 13:74972989-74973011 TTTCAATCTTTTCTTGTATATGG + Intergenic
1112157532 13:96833858-96833880 CTTCCATCTTTTAGGGAACGGGG + Exonic
1112345874 13:98589102-98589124 CTTCCATCTCTTCTGGATCTTGG - Intergenic
1113337293 13:109389263-109389285 CTTAAAAGTTTCCTGGAACATGG - Intergenic
1114799162 14:25752831-25752853 TTTTAATCCTTTCTGGAACAAGG - Intergenic
1114928891 14:27442473-27442495 CTTCACTTTCTTCTGGAACATGG + Intergenic
1115031006 14:28793935-28793957 TTTTAATCTTTTCTGAGACAGGG - Intronic
1115513837 14:34165645-34165667 CCTCACTCTTTTCTGAAACAAGG + Intronic
1115811362 14:37112152-37112174 CTTTAATCCTTTCTAGAATAAGG - Intronic
1116896412 14:50319560-50319582 CCTAAATCCTTTCTGAAACAAGG - Intronic
1117924543 14:60764703-60764725 GTGAAATCTCTTCTGGAACAAGG + Intronic
1118686380 14:68295536-68295558 CTCCTATCTTAGCTGGAACAAGG - Intronic
1119440097 14:74622419-74622441 CTTAAATCTTTTTTGAGACAGGG + Intergenic
1119740631 14:77011805-77011827 CTTCATTCTTGCCTGAAACATGG + Intergenic
1120325925 14:83026178-83026200 CTACCATCTTTTCTGGCACCAGG - Intergenic
1121073536 14:91047175-91047197 CTTACATCTTTTCTGGACCAAGG - Intronic
1121396987 14:93634200-93634222 CTTAAATCATTTTTGAAACATGG + Intronic
1125110614 15:36027977-36027999 CTTCACTCTTTTCAGTACCAAGG - Intergenic
1126234504 15:46367790-46367812 CTTAAATATTTTCTTAAACAAGG + Intergenic
1126281522 15:46956979-46957001 GTTCAGTTTTTCCTGGAACACGG - Intergenic
1126751253 15:51878822-51878844 CTTCAATCTTTTCTGGAACAAGG + Intronic
1127939158 15:63676227-63676249 CATAAATCCTTTCTGAAACAAGG + Intronic
1128285804 15:66436027-66436049 CTTCAATGTTTTTTTGCACATGG + Intronic
1128493375 15:68173163-68173185 CTTAAATTTTTTTTGGATCAAGG + Intronic
1128864502 15:71104095-71104117 ATTCCATCTTTTCTGGAATAAGG + Intronic
1128943804 15:71808561-71808583 TTCCCATCTCTTCTGGAACACGG - Intronic
1130090520 15:80817009-80817031 CTCCATTCTTTTCTGGAAGTAGG - Intronic
1131427812 15:92361141-92361163 CTTCTACCTTATCTGGGACAGGG - Intergenic
1132363914 15:101242147-101242169 CTTAAATCCCTTCTGTAACAGGG - Intronic
1132926309 16:2430990-2431012 GTTCCATCTTTTGTGGCACAGGG + Intronic
1133719419 16:8480733-8480755 CTTAAATCTTTTCTGGAATGGGG - Intergenic
1135668240 16:24353518-24353540 ATTAAATATTTTCTGGATCATGG - Intronic
1136574052 16:31112801-31112823 CTTCAATATTATCTGGGACCCGG - Intergenic
1137813802 16:51379031-51379053 TTTCAATCTGGTCTGGAAAAAGG - Intergenic
1137871878 16:51957888-51957910 TTTAAATGTTTTCTGGAACGTGG + Intergenic
1137956901 16:52840703-52840725 CTTAATTCTTTTCAGGAAAAAGG + Intergenic
1138043110 16:53696041-53696063 CTTGAATCTTGTTTGGAACAAGG - Intronic
1138830094 16:60365006-60365028 CATCACTCTTTTCTAGAAAAAGG + Intergenic
1139281285 16:65773030-65773052 CTTAAATACTTTCTGAAACAAGG - Intergenic
1140131934 16:72170387-72170409 CTTAAATCCTTTCTGGAACAAGG + Intronic
1141245457 16:82302739-82302761 CTCCAATCTTTTCTTCATCAGGG + Intergenic
1144424052 17:15124514-15124536 CTCAAATCTTTTCTAGAGCAAGG - Intergenic
1149245728 17:54704813-54704835 CTTCATTTTTTTTTGGAAAACGG - Intergenic
1149407944 17:56374120-56374142 CTTCACTGTGTTCTTGAACAAGG + Intronic
1149791523 17:59481902-59481924 CTGAAATCCTTTCTGGAACAAGG - Intergenic
1150923174 17:69504859-69504881 TCTTAATCCTTTCTGGAACAGGG + Intronic
1151086198 17:71384010-71384032 CTTCAATCTTTTCTGGGTAGTGG + Intergenic
1151129684 17:71883411-71883433 TTTCAATCCTTTCTGGAATAAGG - Intergenic
1151440411 17:74125226-74125248 CCTAAATCTTTTCTAGAAGAAGG + Intergenic
1151520153 17:74622699-74622721 CTTAAATCCTTCCCGGAACAAGG - Intronic
1151637454 17:75360790-75360812 TTTCAATTTTTTCTGAGACAGGG + Intronic
1155000270 18:21679170-21679192 ATTAAATTATTTCTGGAACAAGG + Intronic
1155919552 18:31589455-31589477 CTTTTATCTTTTCTTAAACATGG - Intergenic
1155947703 18:31875060-31875082 CTTAAATTCTTTCTGGAAAAAGG + Intronic
1156735866 18:40258524-40258546 CAGCAATGTTTACTGGAACAGGG + Intergenic
1158563366 18:58533836-58533858 CTTTAAACCTTTCTGCAACAGGG + Intronic
1159130038 18:64271007-64271029 CTTCAATTTTGTCTGGGAGAAGG + Intergenic
1159894660 18:73984820-73984842 CTCCAATGTCATCTGGAACAGGG + Intergenic
1159943004 18:74422923-74422945 CTTAAATCCTTTCTGGACCGAGG - Intergenic
1159997023 18:74975265-74975287 CTACAAGGTTTTCTGGAGCAAGG - Intronic
1160541542 18:79626598-79626620 TTGCAATCTGTTCTGGAACTAGG + Intergenic
1162962076 19:14134276-14134298 GTTAAATCCTTTCTGGAACAAGG - Intronic
1164604434 19:29587265-29587287 CCTCAATCTTCTCTGGCAGAGGG - Intergenic
1164658914 19:29945389-29945411 CTTGTATGTTCTCTGGAACATGG + Intronic
1164661102 19:29968962-29968984 CTTAAATCTTTTCTGCAAGTAGG + Intronic
1164982194 19:32622455-32622477 CTTCAGTCTGTTCTGGATCTCGG + Exonic
925634123 2:5925972-5925994 CTTAAATCTGAGCTGGAACAAGG + Intergenic
925770253 2:7275085-7275107 CTTCAATCTTTTCTGGCCCAGGG - Intergenic
925875321 2:8306641-8306663 TTTCTACCTTCTCTGGAACATGG - Intergenic
925885224 2:8389688-8389710 CTTCAATGTTTACAGGAAAAAGG + Intergenic
926071617 2:9898396-9898418 CTCAAATCTTCTGTGGAACAAGG - Intronic
926336228 2:11864833-11864855 CTTCCATCTATTCTGCAGCAGGG - Intergenic
926882626 2:17564022-17564044 CTGAAATCCTTTCTGAAACAAGG - Intronic
927088706 2:19694343-19694365 TGGGAATCTTTTCTGGAACAAGG - Intergenic
927607424 2:24499746-24499768 CTTAAATCCTTTTTGGAACATGG - Intronic
928352602 2:30573879-30573901 TTTAAATCTTTATTGGAACACGG - Intronic
928962400 2:36941272-36941294 GTTCAATCTCTTCTGCAAAAGGG + Intronic
929875489 2:45793119-45793141 CTTAAATCTATTCTGGAACAAGG - Intronic
929956413 2:46461840-46461862 CTGCAGGCTTTTCTGGGACAGGG - Intronic
930412122 2:51038031-51038053 CTTTAATTTTCTCTAGAACAAGG + Intergenic
930899302 2:56484254-56484276 CTTTCATCTTTTTTGTAACATGG + Intergenic
931602954 2:64021658-64021680 TTGGAATCTTTTCTGGAACAAGG - Intergenic
931928859 2:67106285-67106307 CTTTAATCTTCTCTGGATAATGG - Intergenic
932137931 2:69246911-69246933 CTCAGATCTTTTCTGGAACAAGG + Exonic
932175437 2:69596667-69596689 ATTCATGCTTTTCTGGAGCATGG + Intronic
932598921 2:73111207-73111229 CTTGAATGTTTTCTGAAACATGG - Intronic
934755689 2:96823217-96823239 TTTCAAACTTCTCTAGAACAAGG - Intronic
935113941 2:100118096-100118118 TTTCTATCTTTTCTGGAGCAGGG + Intronic
935307845 2:101755007-101755029 CTTAAATTATTTCTGGAGCAAGG - Intronic
937952279 2:127397805-127397827 CCTCACTCATTTCTGCAACATGG - Intergenic
939403901 2:141731192-141731214 CTTCAATGTTACCTGGAGCATGG + Intronic
940771798 2:157846628-157846650 CTTAAATTGTTTCTGGAACAAGG - Intronic
941012920 2:160321633-160321655 CTTCAATATTATCTCAAACATGG + Intronic
941646000 2:168042233-168042255 CTTAAATCTTCTCTGGAACAAGG + Intronic
941670664 2:168288994-168289016 ATTTAATCATTTCTGAAACAAGG + Intergenic
942048242 2:172113759-172113781 ATTCAATCTTTTCTGGAATGTGG - Intergenic
942153524 2:173103483-173103505 CTTAAATCCTTTTTGAAACAAGG - Intronic
945347632 2:208737605-208737627 CTCCAATCTTTCCTGGATCATGG + Intronic
945634295 2:212328160-212328182 CTTCAATCATGTTTGGAACCTGG + Intronic
947510117 2:230744662-230744684 CTTAAATTCTTTCTGGAACAAGG - Intronic
1168858043 20:1023132-1023154 CTTAAATCATTTTTGCAACAAGG - Intergenic
1169318046 20:4609387-4609409 CTTCAAACTTTCTTTGAACAGGG - Intergenic
1169710141 20:8551852-8551874 CTTAAATTTTTTCTGCAAAAGGG + Intronic
1172469449 20:35180712-35180734 TCTCAATCTTGTCTGGACCATGG + Intergenic
1173270342 20:41528400-41528422 CTCCAATCCTCTCTGGAATAAGG + Intronic
1173401875 20:42733300-42733322 GTTCACTCTCTTCTGAAACACGG + Intronic
1173419553 20:42888962-42888984 CTTAAATCTTATCTAGAAGAAGG - Intronic
1175103686 20:56598577-56598599 CTGTAATCTTTTTTGGAATAAGG + Intergenic
1176203598 20:63876032-63876054 CTTTAAACTTTTGTGGAACAGGG + Intronic
1177709653 21:24756500-24756522 CTTCAATATATTCTGTATCATGG + Intergenic
1178886845 21:36491605-36491627 CTGAAATCCTTTTTGGAACAAGG + Intronic
1178902924 21:36612006-36612028 CTCCAACCCTTTCTGGAACTAGG - Intergenic
1180028166 21:45180711-45180733 CCTCAATCTGCTCTGGAAGATGG + Intronic
1181577710 22:23805933-23805955 CTTGCATCCTTTCTGGAACAGGG - Intronic
1181861146 22:25819078-25819100 CTTCTATCTTTGCTTGGACATGG - Intronic
1182782417 22:32878683-32878705 CTTCAACCTTTTTTGGAAGCAGG + Intronic
1183034626 22:35131894-35131916 CTTAAATCCTTTGGGGAACAAGG - Intergenic
1184304020 22:43582826-43582848 CATCACTTTTTTCTAGAACAGGG - Intronic
949098013 3:109350-109372 CTTCTTTATTTTCTGGAAAATGG + Intergenic
949824321 3:8149098-8149120 CATCAATTTCTTCTGCAACATGG + Intergenic
954894241 3:53962551-53962573 CTTAAATCCTTTTTGGAACAAGG - Intergenic
955076931 3:55622730-55622752 CTTTAATCCTTTCTGGACCAAGG - Intronic
955224913 3:57052650-57052672 CTTAAAGCTTTTATGGAACACGG + Intronic
955315785 3:57937919-57937941 CTTAAAGCTTTACTGAAACAAGG - Intergenic
956203833 3:66735814-66735836 CTTCAATATTTTCTGGATGTCGG - Intergenic
957775082 3:84748235-84748257 TTACAATCTTTTATGGAAAAAGG + Intergenic
957905368 3:86546434-86546456 CTTCAAGATTTTTTGGAAAATGG - Intergenic
957962042 3:87268682-87268704 CATCAACATTTTCTGAAACATGG + Intronic
958887951 3:99749797-99749819 CATAAATATTTTCTAGAACAAGG + Intronic
959156692 3:102675003-102675025 CTTCAACTCTTTCTGGAAAAGGG + Intergenic
959177242 3:102929579-102929601 TTTAAATCTTTGCTGGTACATGG + Intergenic
960104565 3:113780541-113780563 CTTAAAACTCTTCTGGGACATGG - Intronic
960226230 3:115172425-115172447 ATTCTATCTATTCTGGAAGAGGG - Intergenic
960806909 3:121592883-121592905 CTTTCATCTTTCCTGGAAAAGGG - Intergenic
961808765 3:129508467-129508489 CTTCATTCTCATCTGTAACATGG - Intronic
962167635 3:133066347-133066369 CCTAAATCCTTTCTAGAACAAGG - Intronic
963402689 3:144821124-144821146 ATTAAATATTTTCTGGAACAAGG - Intergenic
963753200 3:149204072-149204094 CTGCCATATTTTCTAGAACATGG - Intronic
963819459 3:149872225-149872247 TTTAAATGTTTTCTGAAACAAGG - Intronic
964028952 3:152114278-152114300 TTTGAAAGTTTTCTGGAACAGGG - Intergenic
964058278 3:152488662-152488684 CTTCTGTCATTTCTGGCACAAGG + Intergenic
964401619 3:156305673-156305695 TTAAATTCTTTTCTGGAACAAGG - Intronic
965305235 3:167056385-167056407 CTTAAATATTTTCTGAAATAAGG + Intergenic
965829270 3:172765564-172765586 CATCAGTCTTTTCTGTAAAAAGG + Intronic
966364509 3:179169447-179169469 CTTCAATCTTTTGTGTTACTTGG + Intronic
966625842 3:182015988-182016010 CCTCAATCTTATCTGTAAAATGG + Intergenic
967019988 3:185514285-185514307 CTTATATCTTTTATAGAACAAGG + Intronic
967323420 3:188216130-188216152 CTCAGATCATTTCTGGAACAAGG + Intronic
967375085 3:188792200-188792222 CTTCAAGATTTTGTGTAACAGGG + Intronic
967794186 3:193580610-193580632 CTTCATTCTATTCTGTAACTTGG - Intronic
969175378 4:5394990-5395012 CTGCACTCCTTTCTGGAACATGG + Intronic
969287003 4:6208859-6208881 CCTCTATCTCCTCTGGAACATGG - Intergenic
969339291 4:6530253-6530275 CTTGGACCTTTTCTGAAACAAGG - Intronic
970589906 4:17550486-17550508 CTTAAATCTCTTCTGGAATAAGG + Intergenic
970647278 4:18136822-18136844 GTTCACCTTTTTCTGGAACATGG - Intergenic
971184735 4:24363043-24363065 CTTCAGGCTTTTCTCAAACATGG + Intergenic
972472118 4:39416052-39416074 TTTAAATCCTTTCTGGAACAAGG - Intronic
972747379 4:41950121-41950143 CTTCAAACTCTTCTGGCACAAGG - Intronic
974446018 4:61982816-61982838 CTTAAATCATTTTTGAAACAAGG + Intronic
975176381 4:71294121-71294143 CTTCAATTCTTTCTGGAATGAGG + Intronic
976350845 4:84058042-84058064 CTTAAATCCTTTCTGGGATAAGG + Intergenic
976784483 4:88802519-88802541 CTTCAGTCCTTTCTGTAATATGG - Intronic
978572219 4:110150457-110150479 CTACAATTTTTTCTGGCAAAAGG + Intronic
981755187 4:148135116-148135138 CAGCAATGTTTTCTGCAACAAGG + Intronic
982268789 4:153565624-153565646 CATTTATCTTTTCTGGATCATGG - Intronic
983040786 4:162923379-162923401 ACTCAATCTTTTCTGGATCCAGG - Intergenic
983941006 4:173534101-173534123 CTGCATTCTTTTCTGTACCAGGG + Intergenic
984499707 4:180544335-180544357 TTTTAATATTTTCTGGACCATGG - Intergenic
988662837 5:33292072-33292094 CTTCAATCTTTTGTTCAAGAGGG + Intergenic
988830626 5:34983564-34983586 CTTAAATCCTTCTTGGAACAAGG - Intergenic
990055250 5:51568310-51568332 CTTCATTTTTTTCCGTAACATGG - Intergenic
990419610 5:55618461-55618483 ATTAGATCCTTTCTGGAACAAGG + Intergenic
990423053 5:55656653-55656675 CTTAAATCCTTTTTGGAGCAAGG + Intronic
990614659 5:57495160-57495182 CCTCAATCTTTTTTTGCACATGG - Intergenic
990616301 5:57511882-57511904 CTGCAATGTTTTCTGGAATTAGG + Intergenic
990718997 5:58672140-58672162 TTTCAATGTTTTCTGGATAATGG + Intronic
990928016 5:61051731-61051753 CTTACATCCTTTCTGGAAGAAGG - Intronic
991029652 5:62069351-62069373 CTTCATTATATTCTGGCACAAGG - Intergenic
993215363 5:85016018-85016040 CTTCCATGTTTACTCGAACAAGG - Intergenic
994288567 5:97999706-97999728 CTTCATTCTTTTCTGGGTGAGGG + Intergenic
994501659 5:100586973-100586995 CTTCATTGTGTTATGGAACAGGG + Intergenic
995408695 5:111830960-111830982 CTTCCATCACTTATGGAACAGGG - Intronic
997795219 5:136803080-136803102 CTTCTTTCTTGTCTGGACCATGG + Intergenic
998229855 5:140354064-140354086 TTTAAATCTTTTCTGGAAGTAGG + Intergenic
998629908 5:143886602-143886624 TTTTAATCTTTTCTAGAAAAAGG - Intergenic
998661005 5:144237624-144237646 TTTCCAGTTTTTCTGGAACAGGG + Intronic
1002461783 5:179377503-179377525 GTGCATTCTTTCCTGGAACAAGG - Intergenic
1002659232 5:180779461-180779483 CTTCAATATTTACAGGAAAAGGG - Intergenic
1003577265 6:7309041-7309063 CATAAGTATTTTCTGGAACAGGG - Intronic
1003894641 6:10595609-10595631 CTTAAGTCCTTTCTGGAACATGG - Intronic
1004802149 6:19160748-19160770 CTTAAATCATCTGTGGAACAAGG + Intergenic
1005361292 6:25033399-25033421 CTTCTTTATTTTCTGGCACAAGG + Intronic
1005512081 6:26520635-26520657 CTCCAGTTTTTGCTGGAACAAGG - Intergenic
1005891576 6:30144550-30144572 CTTCATTTTTTTCTGTAAAAAGG - Intronic
1006618414 6:35345290-35345312 CTTCTTTCTTTTCTGACACAAGG + Intronic
1006641668 6:35492511-35492533 CTTCCCTCCTTCCTGGAACAGGG + Intronic
1006982948 6:38160368-38160390 CCTCAATCTTTCCTTGAGCATGG - Intergenic
1007183196 6:39945580-39945602 TTTAAATCCTTTCTAGAACAAGG + Intergenic
1007734220 6:43970664-43970686 CTTCAAGCATGTCAGGAACAAGG - Intergenic
1007914927 6:45552563-45552585 CTTCACTCCTCTCTGCAACATGG + Intronic
1008411323 6:51183309-51183331 CTTCATCCTTTTCTGGTAGAGGG - Intergenic
1008779237 6:55082278-55082300 CTTTTGTCTTTTCTGGAAGAAGG - Intergenic
1009968306 6:70600921-70600943 TTTCAGTCCTTTCTGGAATAAGG + Intergenic
1010323740 6:74541752-74541774 CTTCAGGATTTTATGGAACATGG - Intergenic
1011178335 6:84588993-84589015 CTTCCATATTGTCTGGAAAATGG - Intergenic
1014381154 6:120743920-120743942 CTTCTATCTTTTTTGGATGAGGG + Intergenic
1014769847 6:125448223-125448245 CTTGAATGTTTCCTGGAACTGGG + Intergenic
1015676714 6:135758736-135758758 CATTACTCTTTTCTGTAACATGG + Intergenic
1015947674 6:138519977-138519999 CTTCAATCCTTTCTGAAACAAGG + Intronic
1016053584 6:139555286-139555308 CTTAAATCCTTTCTGGAACAAGG - Intergenic
1018141223 6:160838793-160838815 TTTAAATCTTTCCTGGAACAGGG + Intergenic
1018283472 6:162213113-162213135 CTTTAATCTTGTCTGCAAAAAGG + Intronic
1018609559 6:165634490-165634512 CTTAAATGTTCTCTGGAACAAGG - Intronic
1020614174 7:10437847-10437869 AGTCAATCTTTTCTGTAATATGG - Intergenic
1020906983 7:14075592-14075614 TTTCAATTTGTTCTGGAAAATGG + Intergenic
1021146929 7:17100399-17100421 CATCTTTCTTTTCTGAAACAAGG + Intergenic
1021188315 7:17591445-17591467 CTTCACTCTCTTCTGGAAGTTGG + Intergenic
1021481237 7:21119914-21119936 CTTAAATCCTTCCTGGAGCAAGG - Intergenic
1022650387 7:32268504-32268526 CTTAAATCTCTTTTGGAACAAGG - Intronic
1023162396 7:37309867-37309889 CTTCAATCCTTTCTGGAGACTGG + Intronic
1025743050 7:64216476-64216498 CTTCAATGTATTCTTGCACAGGG - Intronic
1026358160 7:69578033-69578055 CACCAATCTTCTCTGGAACCTGG + Intergenic
1026566187 7:71491479-71491501 CTTAAATCTTCCTTGGAACAAGG - Intronic
1026676478 7:72432694-72432716 CTTGCATCCTTTCTGGAACAAGG + Intronic
1029005131 7:97201371-97201393 CTTAATTCTTTTCTCAAACAGGG + Intergenic
1030024027 7:105304545-105304567 CTTAAATCCTTTTTGGAACAAGG + Intronic
1030153743 7:106431150-106431172 CTGCAATGTTTGCTGGATCATGG + Intergenic
1030200106 7:106894209-106894231 CTTAAATCCTTTTTGGAACAAGG + Intronic
1031012995 7:116543062-116543084 TTTCAGTCCTTTCTTGAACATGG + Intronic
1031520647 7:122761284-122761306 CTCCACTCATTCCTGGAACATGG + Intronic
1032634444 7:133691128-133691150 CTTAAATCTTTTGTGGATGAAGG - Intronic
1033447069 7:141432505-141432527 CTTAAGTCTTTTTTGGAACATGG + Intronic
1033607824 7:142940341-142940363 CTTGATTCTGGTCTGGAACAGGG - Exonic
1035520163 8:269418-269440 TTCAACTCTTTTCTGGAACAGGG - Intergenic
1037238098 8:16745215-16745237 CTTCAATCTTTTCTTGACTCAGG - Intergenic
1037316728 8:17606390-17606412 CTTCATTCTTATCTGGAGCATGG + Intronic
1038511739 8:28143838-28143860 CTTAAATCCTTTCTGGAACAAGG + Intronic
1039059657 8:33563653-33563675 CTTCAGTCTATGCTGGAAAAGGG + Intronic
1039347216 8:36719491-36719513 CTACAATCTTTTCCAGAAAATGG - Intergenic
1042553430 8:70014345-70014367 TTTCAATATTTTCTAGAAAAAGG + Intergenic
1043575176 8:81648250-81648272 CTTAAGTCTTTTTTGAAACATGG - Intergenic
1043919616 8:85965976-85965998 ATTCCATCTTTTCTTTAACAGGG - Intergenic
1044745315 8:95365296-95365318 CCTAAATTCTTTCTGGAACAAGG - Intergenic
1046606011 8:116373216-116373238 CTGCAATTTTTTCAGGCACACGG + Intergenic
1046689929 8:117271324-117271346 ATTCAAGCTCTTCTGGAACAAGG - Intergenic
1046753388 8:117948092-117948114 CTTAAATCTTTTTTGGAAAGAGG - Intronic
1046787556 8:118284606-118284628 CATCATTGTTTTCTGGAAAATGG + Exonic
1048497077 8:134944153-134944175 CTTCCATCTCTTCTGCAACGAGG - Intergenic
1049343368 8:142125681-142125703 TTTAAATCCTTCCTGGAACACGG + Intergenic
1049931374 9:460142-460164 CTTCAATTTTCTCTGGAAAATGG - Intronic
1050148541 9:2596306-2596328 CTTCCATCTTTTGTGTAGCATGG - Intergenic
1050470319 9:5981743-5981765 CGTCCATCTCTTCTGGAAAATGG + Intronic
1050954902 9:11643573-11643595 CTTCTCTCTTTTCTAGGACATGG + Intergenic
1052764642 9:32628860-32628882 CTTAAATCCTTCCTGGAACAAGG + Intergenic
1053109476 9:35445289-35445311 CTTAAATCCTTTATAGAACATGG - Intergenic
1055795021 9:79966778-79966800 CTTCAAATTTTTGTGCAACAAGG - Intergenic
1055902163 9:81253054-81253076 ATTCAAACTTTCCTGGAATATGG - Intergenic
1056216743 9:84412171-84412193 CTTCACTCCCTTCTAGAACAAGG - Intergenic
1056602479 9:88056975-88056997 CTTCTTTCTTTTCTGAGACAGGG + Intergenic
1056986490 9:91368120-91368142 CTTCAGTGTTTTCTGGCACAAGG - Intergenic
1057368568 9:94448161-94448183 CTTCAATCAGACCTGGAACAAGG - Intronic
1057925140 9:99139941-99139963 CTTCTATCTTTTCTGAAAACTGG + Intronic
1058523640 9:105836318-105836340 CGTGAATCCTTTCTGGAAGAAGG + Intergenic
1058630294 9:106979444-106979466 CTTAAGCCTTTTCTCGAACAGGG + Intronic
1058829141 9:108799750-108799772 CTTCATTCTGTTCTGTAACATGG + Intergenic
1060008166 9:120018790-120018812 GTCAAATCCTTTCTGGAACAAGG - Intergenic
1060320726 9:122557755-122557777 CTGCAATCTCTTCTAGAAGATGG - Intergenic
1060397090 9:123323951-123323973 CTCAAGTCTTTTTTGGAACAAGG - Intergenic
1061105751 9:128529075-128529097 CTGAAATTCTTTCTGGAACAGGG + Intronic
1061226089 9:129281772-129281794 CTGCAACCTCTTCTGGAAAAAGG + Intergenic
1062192290 9:135254225-135254247 CTTAAATTATTTCTGGGACAGGG + Intergenic
1186489937 X:9963669-9963691 TTTGCATCTTTTCTGGAAAAAGG - Intergenic
1186767248 X:12783315-12783337 CTCAAATCCTTTCTGGAATAAGG - Intergenic
1187087925 X:16061118-16061140 CTTCAGTCTCATCTGGAACTTGG + Intergenic
1187522135 X:20023105-20023127 CTTCCATACTTTCTGGAACAAGG - Intronic
1187647768 X:21367780-21367802 CTACAATCCTGCCTGGAACATGG - Intergenic
1187915093 X:24146427-24146449 CTTCTATCGTTTCTGGCTCAAGG + Intergenic
1187947177 X:24437642-24437664 CTTAGATCCTTTCTGGAACAAGG - Intergenic
1188236334 X:27736141-27736163 CTTCAATATTTCCTGAATCAGGG + Intronic
1189341808 X:40210229-40210251 CTTCCAGCTTGTTTGGAACAAGG - Intergenic
1189402918 X:40689219-40689241 CTTAAATCCTTTCCAGAACATGG - Intronic
1191869591 X:65734768-65734790 CTTAAATCCTTTTTGGAACAAGG - Intronic
1192267816 X:69551958-69551980 CTGCAATCTTATCTGAAACTTGG - Intergenic
1192478599 X:71465511-71465533 ATTAAATCCTTCCTGGAACAAGG - Exonic
1192733641 X:73827015-73827037 CTTCTATCTATCTTGGAACATGG + Intergenic
1192859161 X:75047686-75047708 GTGCAATCTTTACTGGCACAAGG - Intergenic
1193956162 X:87865925-87865947 TTTCTCTCTTTTCTGGAACCCGG - Intergenic
1196545097 X:116953866-116953888 CTTCAATCTTTTGAGGAGAAAGG + Intergenic
1197293082 X:124684423-124684445 CTTCACTCTCTTCTGCCACATGG - Intronic
1197781266 X:130162900-130162922 CTTCAATCATCTCTGGAAGGAGG + Intronic
1197857970 X:130937979-130938001 CTTCTCTCTCTTCTGGAACTAGG - Intergenic
1198100653 X:133419145-133419167 CTTCTCTCTTTCCTGAAACACGG - Intergenic
1198244986 X:134821789-134821811 CTTAAATCATTTCTGAAACTAGG + Intronic
1199560138 X:149152735-149152757 CTTCAAATTTTTCTTGGACAAGG - Intergenic
1199659798 X:150037687-150037709 CTTCAATCTTGTCTAGAAACTGG + Intergenic