ID: 1126752791

View in Genome Browser
Species Human (GRCh38)
Location 15:51894376-51894398
Sequence TTTTGAGATGGGACAGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 318
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 285}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126752791_1126752795 4 Left 1126752791 15:51894376-51894398 CCTGCCACTGTCCCATCTCAAAA 0: 1
1: 0
2: 1
3: 31
4: 285
Right 1126752795 15:51894403-51894425 AAATAAAACCTGTTTTTTTGAGG 0: 1
1: 0
2: 9
3: 92
4: 1101
1126752791_1126752797 20 Left 1126752791 15:51894376-51894398 CCTGCCACTGTCCCATCTCAAAA 0: 1
1: 0
2: 1
3: 31
4: 285
Right 1126752797 15:51894419-51894441 TTTGAGGTAAAATTTAAATATGG 0: 1
1: 1
2: 6
3: 108
4: 984

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126752791 Original CRISPR TTTTGAGATGGGACAGTGGC AGG (reversed) Intronic
900010333 1:101423-101445 TTTTGAGATGCCAAGGTGGCAGG + Intergenic
900026439 1:277989-278011 TTTTGAGATGCCAAGGTGGCAGG + Intergenic
900036226 1:411829-411851 TTTTGAGATGCCAAGGTGGCAGG + Intergenic
900057852 1:647583-647605 TTTTGAGATGCCAAGGTGGCAGG + Intergenic
900807834 1:4779444-4779466 CTTTCACATGGGAAAGTGGCAGG + Intronic
901728326 1:11259884-11259906 TTTTGAGACAGTGCAGTGGCAGG - Intronic
901902350 1:12375890-12375912 TCTTTAGATGGGACTGTGGAAGG - Intronic
902337985 1:15764845-15764867 TGTTGAGATGGTAGGGTGGCTGG + Intronic
902836844 1:19052954-19052976 GTCTGAGTGGGGACAGTGGCTGG - Intergenic
903221436 1:21871662-21871684 TTATGAAATGGGGCAGTAGCAGG + Intronic
903314285 1:22489054-22489076 CTGTGAGGTGGGAAAGTGGCAGG + Intronic
905369906 1:37477403-37477425 TTCTGAGCTGGGGTAGTGGCAGG + Intronic
907547514 1:55275006-55275028 TCTTGAGGTGTGTCAGTGGCAGG - Intergenic
907939270 1:59071754-59071776 TTCTGAGAAGGGACACTGCCCGG - Intergenic
908067600 1:60424228-60424250 TCTTGCCATGGGACAATGGCGGG - Intergenic
908322819 1:62994597-62994619 TTGGGGGATGGGACAGTGGATGG - Intergenic
909494895 1:76267365-76267387 TTTTGACTTTGGACAGTGGCAGG - Intronic
913683108 1:121205995-121206017 TTTTGAGATGGGAGAGGTGTGGG + Intronic
914034949 1:143993620-143993642 TTTTGAGATGGGAGAGGTGTGGG + Intergenic
914154505 1:145074351-145074373 TTTTGAGATGGGAGAGGTGTGGG - Intronic
916465695 1:165072601-165072623 TTTTGTGTTGGGGGAGTGGCAGG - Intergenic
916683173 1:167122389-167122411 TTTGGAAATGGGACTGAGGCAGG - Intronic
917510580 1:175666240-175666262 CTTTAAGATGGGACATTGCCTGG + Intronic
917590959 1:176476485-176476507 TATTGTAATGGGACAGTGTCAGG + Intronic
918287305 1:183069986-183070008 GTTTGAGATGGCACAGTGCCCGG + Intronic
920470417 1:206224505-206224527 TTTTGAGATGGGAGAGGTGTGGG + Intronic
921303614 1:213773321-213773343 TCCTGAGAGGGGACAGTGGTTGG - Intergenic
922258771 1:223917420-223917442 TTTTGAGATGCCAAGGTGGCAGG + Intergenic
922354271 1:224761134-224761156 TTTAGAAATGGCACAGTGGGAGG + Intergenic
923278658 1:232420391-232420413 CTTTGTGATGCCACAGTGGCTGG + Intronic
1063293119 10:4771864-4771886 TTTTGAGAAAGGATATTGGCAGG - Intergenic
1065314273 10:24447075-24447097 TTTCGAGAAGGGACAGTGAGTGG - Intronic
1066026026 10:31361707-31361729 TTCCCAGATGGGACGGTGGCCGG + Intronic
1066299151 10:34081576-34081598 TGTCCAGAAGGGACAGTGGCTGG - Intergenic
1070294181 10:75145111-75145133 TGTTGAGATGGTGCAGGGGCAGG + Intronic
1070521568 10:77258136-77258158 TTATGAGATGGGACCTTGGTAGG + Intronic
1070669499 10:78368173-78368195 CTTTGCCTTGGGACAGTGGCTGG + Intergenic
1072424608 10:95319555-95319577 TTTTGAGACAAGACAGTAGCAGG + Intronic
1073439687 10:103545127-103545149 TTGTGAGATGGGGCAGCTGCAGG + Intronic
1073463929 10:103682835-103682857 TTTTGAAATGGGCCATTGGAGGG + Intronic
1074718792 10:116247126-116247148 TTCTGAGATGGGGCAGGGGTCGG - Intronic
1078621347 11:12911515-12911537 TTTTGAGATGAGACAGAAGTAGG - Intronic
1079033826 11:17005633-17005655 TTTAGAGATAGGACAGATGCTGG - Intronic
1079492535 11:21005412-21005434 TGTTCAGACTGGACAGTGGCAGG + Intronic
1079885958 11:25989350-25989372 TTTGTAGATAGGACAGTGGTGGG + Intergenic
1080092098 11:28360565-28360587 TTTTGAGAAGGAACACTGCCTGG + Intergenic
1080136805 11:28864487-28864509 TTTTAAAAGAGGACAGTGGCAGG + Intergenic
1080274790 11:30491627-30491649 TTTAGAGATGAAACAGAGGCAGG + Intronic
1082682742 11:56197516-56197538 TGTGGAGTGGGGACAGTGGCAGG - Intergenic
1083107583 11:60373562-60373584 TATTGATATGGGAGAGGGGCAGG + Intronic
1083569203 11:63747941-63747963 TTTTGAGAGCAGAGAGTGGCTGG + Intronic
1083604706 11:63971250-63971272 TTTTGAGAGGCCACAGTGGGAGG + Intergenic
1085323777 11:75591452-75591474 TTTACAGATGGGAGACTGGCAGG - Intronic
1085381139 11:76119797-76119819 TTTGGAGAGTGGACAGAGGCAGG - Intronic
1085841597 11:80017653-80017675 TTTTCAAAAGGGCCAGTGGCTGG - Intergenic
1085879316 11:80446807-80446829 TTTTCAGAAGAGACTGTGGCTGG - Intergenic
1086665634 11:89478185-89478207 TTTTGTCAGGGGACAGGGGCAGG - Intronic
1086960599 11:92976533-92976555 CTTTGATAGGGGACAGTGGAGGG - Intronic
1087649873 11:100852680-100852702 TTTTGAGGTGGGAGAATGGGAGG + Intronic
1087837670 11:102891073-102891095 CTGGGAGATGGGACTGTGGCTGG - Intergenic
1088906790 11:114161163-114161185 TTCTGAGATGGGCCAGTGTAAGG + Intronic
1090294083 11:125570773-125570795 TTTATAGATGAGCCAGTGGCAGG + Intronic
1090726478 11:129531561-129531583 TTGAGAGCTGGGACAGAGGCAGG - Intergenic
1091793435 12:3284290-3284312 TGCTGTGCTGGGACAGTGGCAGG + Exonic
1093878247 12:24374832-24374854 TCTTTAGTTGGGACAGAGGCAGG + Intergenic
1096977850 12:55709683-55709705 TTTTGAGCTGGGTCGGGGGCGGG - Intronic
1097546426 12:61007511-61007533 TTTTAAGATGGGTAAGTGGAAGG - Intergenic
1098605931 12:72389699-72389721 TTTGGAGATGGGACCTTGGGAGG - Intronic
1099646683 12:85366588-85366610 TTTCAAGAAGGGAAAGTGGCTGG - Intergenic
1102956517 12:117062652-117062674 TGTTGAAAAGGGACATTGGCAGG - Intronic
1104473875 12:129054283-129054305 TTTTGAGGGTGGACAGTCGCTGG - Intergenic
1106065328 13:26342509-26342531 TTGTAAAATGGGACAGTGCCTGG + Intronic
1106503016 13:30347427-30347449 TTTTTGGATGGGACAGGGGTGGG - Intergenic
1107418232 13:40221165-40221187 ATTTGAAAAGGGACAGTGGTGGG - Intergenic
1107802987 13:44127785-44127807 TGTGGAGAGGGAACAGTGGCTGG - Intergenic
1111320006 13:86614729-86614751 TTTGGAGTTGGGACTTTGGCAGG + Intergenic
1111912141 13:94324739-94324761 TTCTGAGATAGGACAATGGGTGG - Intronic
1112763967 13:102720909-102720931 TTTTAAGATGGGACTGGGACTGG + Intergenic
1114050193 14:18915294-18915316 TCAAGAGAAGGGACAGTGGCCGG + Intergenic
1114112366 14:19486637-19486659 TCAAGAGAAGGGACAGTGGCCGG - Intergenic
1114266946 14:21078278-21078300 AAATGAGATGGGACAGTGGGGGG + Intronic
1116210007 14:41925881-41925903 TTTTGAGATATGAAAGTGCCCGG + Intergenic
1117274041 14:54174345-54174367 ACTTGAGATCTGACAGTGGCAGG - Intergenic
1117483284 14:56169725-56169747 TTGTGAGGTGGGACAATGGGTGG + Intronic
1119855867 14:77900288-77900310 CTTTGAAATGGGACGGAGGCTGG + Intronic
1121639150 14:95473661-95473683 TTGGGAGGTGTGACAGTGGCTGG + Intronic
1121639155 14:95473703-95473725 TTGCGAGGTGTGACAGTGGCTGG + Intronic
1121639159 14:95473745-95473767 TTGCGAGGTGTGACAGTGGCTGG + Intronic
1121639171 14:95473829-95473851 TTGCGAGGTGTGACAGTGGCTGG + Intronic
1121639176 14:95473871-95473893 TTGTGAGGTGTGACAGTGGCTGG + Intronic
1121639181 14:95473913-95473935 TTGTGAGGTGTGACAGTGGCTGG + Intronic
1121639186 14:95473955-95473977 TTGCGAGGTGTGACAGTGGCTGG + Intronic
1121639198 14:95474039-95474061 TTGCGAGGTGTGACAGTGGCTGG + Intronic
1121639203 14:95474081-95474103 TTGTGAGGTGTGACAGTGGCTGG + Intronic
1126752791 15:51894376-51894398 TTTTGAGATGGGACAGTGGCAGG - Intronic
1127008989 15:54601928-54601950 TTCTCAGATGGGGCAGTGGGTGG - Intronic
1127630126 15:60820324-60820346 TTTTAAGATTGGACAGTATCAGG + Intronic
1127699141 15:61480106-61480128 TTCAAAGGTGGGACAGTGGCTGG + Intergenic
1128024202 15:64420865-64420887 TTATGAGTTGGGACATTGCCAGG - Intronic
1128148058 15:65343800-65343822 TTTAGAGATGGGACATTTGCAGG - Intronic
1128399761 15:67266041-67266063 TTTTGAATTGGGACAGAAGCAGG + Intronic
1129246553 15:74282459-74282481 TTTTGAGGTGTGACAGGGACTGG - Intronic
1130037804 15:80377464-80377486 ATTTGAGATGAGACTGTGGTGGG + Exonic
1131640170 15:94283666-94283688 TATTGAGAGGGGACAGAGGGAGG - Intronic
1131901275 15:97090296-97090318 CTTTGAGAAGGGAAGGTGGCTGG - Intergenic
1132571493 16:646356-646378 GGTGGAGATGGGACAGGGGCAGG - Intronic
1133394348 16:5434019-5434041 TTTTGAGTTGGGGTAGGGGCGGG + Intergenic
1135334541 16:21589838-21589860 GTTTGAGATGTGACAGCAGCAGG - Intergenic
1138829179 16:60357966-60357988 TTCCCAGATGGGACGGTGGCCGG + Intergenic
1139486163 16:67257677-67257699 TTCTGAGAAGGGACAGAGCCAGG + Intronic
1140207682 16:72947090-72947112 TTTTGGGTTGAAACAGTGGCCGG - Intronic
1144556350 17:16286101-16286123 TTTAGAGATGGGCCAGAGGTGGG + Intronic
1145756176 17:27391888-27391910 TTCTGAGATGGGAATGTGTCTGG + Intergenic
1146534501 17:33638691-33638713 TCTTGAGGTGGGGCACTGGCAGG - Intronic
1147401156 17:40180801-40180823 TTTTGTCCTGGGACAGTGCCTGG + Intronic
1149070777 17:52539690-52539712 TTTTGAGGTGACACAGTGACTGG + Intergenic
1150067450 17:62123505-62123527 TTTTGAAATGTTTCAGTGGCTGG + Intergenic
1151313026 17:73305766-73305788 GTTTGCGAAGTGACAGTGGCTGG - Intronic
1153741187 18:8130314-8130336 ATTTGAGATGGGACAGCAGCTGG - Intronic
1154205100 18:12329440-12329462 ATTTCAGCTGGGCCAGTGGCTGG + Exonic
1160341674 18:78094590-78094612 TTTTGACATAGGAGACTGGCAGG - Intergenic
1161571590 19:5033613-5033635 TTTTGAGATGGCAGAGTGACTGG + Intronic
1163581036 19:18138881-18138903 CTCTGAGGTGGGACAGTGCCTGG - Intronic
1163989567 19:20985817-20985839 TCTTGAGATGGGACAAGGGCTGG + Intergenic
1164186203 19:22871674-22871696 TTCTCAGATGGGGCAGTTGCCGG + Intergenic
1165530845 19:36399498-36399520 ATCAGAGATGGGTCAGTGGCTGG + Intronic
1168102183 19:54147161-54147183 TTCTGAGAGGAGACGGTGGCGGG + Intronic
925104552 2:1279676-1279698 TTTTCAGATGGGAAGTTGGCTGG + Intronic
926627134 2:15101571-15101593 CTTTGAGTTGGGGCAGGGGCAGG + Intergenic
927407804 2:22791904-22791926 GTTTGAAATGGGCCAGTGGAAGG - Intergenic
931301153 2:60979538-60979560 TTTTGAGATGGGGAGGTGGCGGG - Intronic
932934254 2:76083394-76083416 TTTTCAGATGGTAAAGTGGCGGG - Intergenic
932945738 2:76228249-76228271 TTATGAGATAGGAGACTGGCAGG + Intergenic
933821099 2:86112756-86112778 TTTTGAAAGTGGCCAGTGGCTGG + Intronic
933863901 2:86498703-86498725 TTCTGAGATGGTTCAGTGGCTGG + Intergenic
933905787 2:86891150-86891172 TTTTAAGCTGGGAGGGTGGCGGG + Intergenic
933917758 2:87013537-87013559 TTTTTAGATGGGGGAATGGCAGG + Exonic
934005238 2:87756377-87756399 TTTTTAGATGGGGGAATGGCAGG - Exonic
934978864 2:98824030-98824052 TGTTGACATGGGAGACTGGCTGG - Intronic
935766628 2:106374312-106374334 TTTTAAGCTGGGAGGGTGGCGGG + Intergenic
935768195 2:106390471-106390493 TTTTTAGATGGGGGAATGGCAGG - Intergenic
936366374 2:111860504-111860526 TTTTAAGCTGGGAGGGTGGCGGG - Intronic
936606600 2:113963809-113963831 TTTTGAGATATACCAGTGGCAGG - Intergenic
937706023 2:124921816-124921838 TTTGGAGAAGGGACAATAGCAGG + Intergenic
938375459 2:130802677-130802699 TTCTGAGGTAGGACAGTGGAGGG - Intergenic
938626109 2:133111289-133111311 TTTTGAGATGGGTATATGGCAGG - Intronic
939424689 2:142019781-142019803 TCCTGAGATGGGAATGTGGCTGG - Intronic
940890836 2:159033758-159033780 TTTTCAGATGTGACAGAGGCTGG - Intronic
942673652 2:178403984-178404006 TTCTGTGATTGGACAGTGTCAGG - Intergenic
944440661 2:199740277-199740299 TTTTGAGATGGAGCAGGGCCTGG + Intergenic
944487545 2:200222592-200222614 TATTTAGATGGGAGAGTGGTAGG + Intergenic
944827612 2:203501306-203501328 TTATCAGATGGGGCAGTGCCTGG + Intronic
946186814 2:217985716-217985738 TTTTAAGATGGGACAAAAGCCGG - Intronic
947835546 2:233172272-233172294 GCCTGAGATGGGAGAGTGGCCGG + Intronic
1169281232 20:4268517-4268539 TTTTGAGATGGGGCTTTGGGAGG - Intergenic
1169478371 20:5953154-5953176 TTTAGAGACGGGAAGGTGGCAGG - Intronic
1170136152 20:13075685-13075707 TTTGGAGATGGGGCAGAGACTGG + Intronic
1172625239 20:36342944-36342966 CTTGGAGGTGGGACAGAGGCTGG + Intronic
1175242363 20:57559110-57559132 TTTTGACAAGGGACAGTTGCGGG + Intergenic
1175279701 20:57794835-57794857 CTTTGGGAGGGGACAGAGGCAGG - Intergenic
1177813482 21:25950128-25950150 TATAGAGATGTGGCAGTGGCAGG - Intronic
1178592167 21:33920564-33920586 TTTGGAGATGTGCAAGTGGCTGG - Intergenic
1178807259 21:35849930-35849952 TTTTGAGATAGGACTGAGGTGGG - Intronic
1179768382 21:43592875-43592897 TTTTGGGATTGAACCGTGGCTGG + Intronic
1181147222 22:20857960-20857982 TTTGCAGAAGGGACAGTGGCAGG - Intronic
1181844159 22:25692955-25692977 TTTGGAGATGGGCCAGCCGCTGG - Intronic
1183078735 22:35442899-35442921 ATTGGAGATTGGACAGTGGCAGG + Intergenic
1184114475 22:42414385-42414407 ATCCGAGATGGGACAGGGGCAGG + Intronic
1185073771 22:48671566-48671588 TGTTGGGATGGAACAGTGTCTGG + Intronic
1185175203 22:49322495-49322517 AGATGAGACGGGACAGTGGCTGG + Intergenic
1185239592 22:49735429-49735451 TCTGGGGAGGGGACAGTGGCAGG + Intergenic
949510606 3:4763746-4763768 TTATGAGATGAGACAGGGCCAGG - Intronic
950171297 3:10840663-10840685 TGTTAAGAAGGGAAAGTGGCAGG + Intronic
952058714 3:29480930-29480952 TTTTGAGACAGGAGAATGGCAGG + Intronic
952293989 3:32045110-32045132 TTTTAAGATGGCATAGTGGGTGG + Intronic
952572258 3:34731696-34731718 TCTTGGGATGGGGCAGGGGCGGG + Intergenic
954500098 3:51005376-51005398 TGGCGAGAGGGGACAGTGGCAGG - Intronic
954652099 3:52171377-52171399 TCCTGAGATGAGAGAGTGGCTGG - Intergenic
954713676 3:52516857-52516879 TCCTGAGATGGGACAGTGAGGGG - Intronic
955354711 3:58221896-58221918 TTCTGAGCTGGAATAGTGGCAGG - Intergenic
955577662 3:60383977-60383999 TTTGGAGATAGGACAGGCGCAGG + Intronic
955753580 3:62206143-62206165 TTGAGAGATGGGAGAGAGGCAGG + Intronic
957204777 3:77182487-77182509 GTCTGAGATGGGACAGGGGAAGG + Intronic
958412044 3:93830216-93830238 GTATGGGATGGGACAGAGGCTGG + Intergenic
959769328 3:110073264-110073286 ATTTGGGAGGGGACAGGGGCAGG + Intergenic
960447646 3:117767034-117767056 TTTGGAGATGGGACTTTGGGAGG + Intergenic
963288499 3:143462631-143462653 TTTTGACCTGGGACAGTTACGGG - Intronic
964718748 3:159750739-159750761 TTTGGTGATGGGGCAGTGGGTGG + Intronic
966846949 3:184138096-184138118 CTTTGAGATGGGGAAGTGACAGG + Intronic
967675601 3:192295216-192295238 TTTTGGTGTGGGTCAGTGGCAGG + Intronic
967691431 3:192478356-192478378 TTTGGAGTTGGGCCAGGGGCTGG - Intronic
967887352 3:194342186-194342208 TCTTCAGATGGGTCAGAGGCTGG + Exonic
970823355 4:20245666-20245688 TTTTGAGATGAGAAAGTTGAGGG - Intergenic
972880462 4:43416744-43416766 ATTTGAGAGGGGTCAGGGGCAGG - Intergenic
974121070 4:57640000-57640022 TTTTGATATGGGAGGGGGGCAGG + Intergenic
974466177 4:62259252-62259274 TTTTGAGAGGAGAGAGTGACTGG - Intergenic
976904209 4:90216418-90216440 TTTTGAGATAGTCCAGTGGATGG + Intronic
978431261 4:108635292-108635314 TTTTGGGGTGGGATATTGGCAGG - Intergenic
978703313 4:111675193-111675215 TTTTGATATGGGAGGGGGGCAGG + Intergenic
979262892 4:118668404-118668426 TTTTGAGATGCCAAGGTGGCAGG - Intergenic
979838172 4:125400819-125400841 TTTTGAGATGAGACAGAGTCGGG + Intronic
979910164 4:126355143-126355165 GTTGGAGCTGGGACAGTGGAGGG + Intergenic
980023104 4:127732234-127732256 TTTTTAAATGGGACAGTATCTGG - Intronic
981429898 4:144646270-144646292 TGTTTAGGTGGGACAGTAGCAGG - Exonic
983586886 4:169365121-169365143 TTTTGAAATCAGACAGTGGGTGG - Intergenic
984634169 4:182092986-182093008 TTTGGAGTTGGGACACTGGTAGG - Intergenic
984920137 4:184756598-184756620 CTGTGAGAAGGGACAGTAGCAGG + Exonic
985228810 4:187792221-187792243 TTTAGGGGTGAGACAGTGGCAGG + Intergenic
986166626 5:5278188-5278210 GTTGGAGATGGGTGAGTGGCTGG - Intronic
986230413 5:5859475-5859497 TTTTGGGTTTGGACAATGGCTGG - Intergenic
988170828 5:27653093-27653115 TTTTGGGAAGGGCCAGGGGCAGG + Intergenic
988798384 5:34673759-34673781 TTGAGAGAGGGGACAGAGGCAGG - Intronic
988995024 5:36706454-36706476 TTTTGAAATGGGACATTATCTGG + Intergenic
990755380 5:59063590-59063612 TTTTGAGATGGGTCAGGGCCAGG + Intronic
991096039 5:62740422-62740444 TTTTGAGATGTGAGAGTGGTTGG + Intergenic
991263728 5:64692608-64692630 TTTTGAGATTCTATAGTGGCAGG + Intronic
991987918 5:72308589-72308611 TCTGGAGATGGGACAGTAGGTGG - Intronic
992745970 5:79820666-79820688 CTTTGAGACTGGCCAGTGGCTGG - Intergenic
992753862 5:79886084-79886106 TGTGGAGATGGGAGGGTGGCGGG + Intergenic
992993411 5:82308429-82308451 TCTGGAGATGTGACAGTGGTTGG - Intronic
993436729 5:87905002-87905024 TTTTGACATGGGACACTTGTTGG + Intergenic
994384611 5:99115554-99115576 TTCTGATATGGAACAGCGGCAGG + Intergenic
996010475 5:118477004-118477026 TTTTTAGAGGGGAAAGTGGCTGG + Intergenic
996767129 5:127045878-127045900 TTTTGTGATTTGATAGTGGCAGG - Exonic
998038723 5:138937512-138937534 TTTGCAGATGGCACAGGGGCAGG - Intergenic
998107006 5:139475124-139475146 TGATGAGATGGGACAGTCCCTGG - Intergenic
999425091 5:151480964-151480986 TATTGAGCTGGGGCAGTGACAGG + Intronic
1000177046 5:158767378-158767400 GTTGGTGATGGGAGAGTGGCAGG - Intronic
1001531353 5:172464336-172464358 TTTTGGGCTGGGACTCTGGCAGG - Intergenic
1002737595 5:181407035-181407057 TTTTGAGATGCCAAGGTGGCAGG - Intergenic
1003016616 6:2473147-2473169 ATTTGAGGTTGGACAGCGGCGGG - Intergenic
1003129755 6:3385777-3385799 TTTTCATATGGGCCAGTTGCAGG - Intronic
1003151452 6:3554776-3554798 TTTTGAGAGGGCAAAGTGGGAGG - Intergenic
1003515454 6:6814592-6814614 TTTTGAGATAGGATGATGGCAGG - Intergenic
1004312694 6:14559598-14559620 TGTTGAGATGGGAGAGGGGATGG + Intergenic
1005352329 6:24948825-24948847 GTTTGAAATAGGAGAGTGGCTGG - Intronic
1006362642 6:33595340-33595362 ACCTGAGCTGGGACAGTGGCAGG + Intergenic
1008373084 6:50758717-50758739 TCTTGAGATGGAAAAGTGGCTGG + Intronic
1010315410 6:74443079-74443101 TTTTGAGATGGGCTATTGGCAGG + Intergenic
1012552909 6:100480828-100480850 TTTTGAGAGGGCAAAGTGGGAGG - Intergenic
1012794942 6:103748336-103748358 TTTTGATATGGGAGCGGGGCAGG + Intergenic
1013372689 6:109483593-109483615 TTCGGAGGAGGGACAGTGGCCGG + Intergenic
1014598355 6:123373990-123374012 TTTTTAGTTGGGAAAATGGCTGG + Intronic
1014713690 6:124839655-124839677 TTCTGAGATGGAGCAGAGGCTGG - Intergenic
1016783893 6:147989189-147989211 TTTTGCTATTGGAAAGTGGCGGG + Intergenic
1016786903 6:148020884-148020906 TCTGGAGATGGGACAGTGGGGGG + Intergenic
1017179811 6:151540681-151540703 TTATAAGAAGGGACACTGGCTGG - Intronic
1018129037 6:160710646-160710668 TTTTTAGATGGGGGAATGGCAGG - Intronic
1018379738 6:163247767-163247789 TGATGAGATGGGACAGTGGCAGG - Intronic
1018649753 6:165983535-165983557 TTTTAAGATGGCACGTTGGCAGG - Intronic
1019029139 6:168995319-168995341 ACCTGAGATGGGACAGTGGCAGG - Intergenic
1019242693 6:170682591-170682613 TTTTGAGATGCCAAGGTGGCAGG - Intergenic
1019448293 7:1082721-1082743 TTACGAGATGGGGCAGTGGCAGG - Intronic
1019488502 7:1300380-1300402 TTCTGAGATGGCACAGAGGCAGG - Intergenic
1019570987 7:1712035-1712057 GTTGGGGATGGGACAGTGGTTGG + Intronic
1020049705 7:5073236-5073258 TTTTGGGATGGGCCCGTGCCTGG + Intergenic
1020430429 7:8112124-8112146 GTATGAGATGGGAGAGAGGCAGG + Intergenic
1021710040 7:23406934-23406956 TTTTGAGAGGTGAAGGTGGCTGG - Intronic
1022173235 7:27849448-27849470 TTTTTATATGTGACAGTGTCAGG - Intronic
1024252388 7:47516406-47516428 AGTTTAGATGGGACAGAGGCAGG - Intronic
1024376929 7:48650569-48650591 TATTGGGATGGGACACTGGTAGG - Intergenic
1026557857 7:71423266-71423288 TTTTGATATGCAACAGGGGCAGG - Intronic
1028371208 7:90094398-90094420 TTTTGTGGAAGGACAGTGGCTGG - Intergenic
1028964675 7:96789121-96789143 TTTCGAGCTGAGACAGGGGCTGG + Intergenic
1029263787 7:99323049-99323071 TTTTGTTATGCGACAGTGTCTGG - Intergenic
1029316775 7:99723126-99723148 ATTTGACATGGGAAAGTGGTGGG + Intronic
1031868839 7:127069965-127069987 TTTTCAGATAGGATATTGGCAGG - Intronic
1033291295 7:140085324-140085346 TTTGGAGAGGGGACAGTTGTTGG - Exonic
1034333485 7:150304675-150304697 TTTTGAGATGGGGCAGTGCATGG - Intronic
1034664558 7:152805215-152805237 TTTTGAGATGGGGCAGTGCATGG + Intronic
1035396526 7:158538703-158538725 TTTTGGGATGAGGTAGTGGCTGG - Intronic
1035505428 8:125563-125585 TTTTGAGATGCCAAGGTGGCAGG + Intergenic
1035985896 8:4431551-4431573 TTTTGAAATGGGGCCGGGGCTGG - Intronic
1036573088 8:9999073-9999095 TGTGGAGATGGGACACTGGGTGG + Intergenic
1037285620 8:17295495-17295517 TTGTGAGATGGCACATAGGCAGG - Exonic
1037990636 8:23319337-23319359 TTTGGAGAGGGGGCAGTGGGAGG + Intronic
1038499883 8:28035059-28035081 TGATGAGATGGGACAGTTGATGG + Intronic
1039056453 8:33540829-33540851 TATTAAGATGGGGCAGAGGCCGG - Intergenic
1039306824 8:36272383-36272405 TATTGATATGGGGCAGAGGCAGG + Intergenic
1040855746 8:51946625-51946647 TCCAGGGATGGGACAGTGGCTGG - Intergenic
1040944124 8:52864395-52864417 TATTGAGAGTGGACAGTGGCAGG - Intergenic
1041342309 8:56858708-56858730 ATTTCAGAGGGGAGAGTGGCAGG - Intergenic
1042027728 8:64441982-64442004 TTTTGAAATGAAACAGAGGCTGG + Intergenic
1044597179 8:93970637-93970659 CTCCGAGATGGGGCAGTGGCCGG + Intergenic
1045956084 8:107909542-107909564 TTTAAAGCTGGGAAAGTGGCCGG - Intronic
1046221290 8:111218678-111218700 TGTTAAGATGGGCCAGTTGCAGG - Intergenic
1046817700 8:118603147-118603169 TTTTGAGATGATAAATTGGCTGG - Intronic
1047317819 8:123750622-123750644 TTTTGAGCGGGGGCAGTGGGCGG + Intergenic
1047346698 8:124035613-124035635 TTTTTAGATGGGACAATGAAAGG - Intronic
1047960615 8:130009180-130009202 CTTTGAAAAAGGACAGTGGCAGG - Intronic
1048082218 8:131140735-131140757 CCTTGAGATGGCACAGTGGAAGG + Intergenic
1048107396 8:131426889-131426911 ATTTGAGAGGGGCCAGGGGCAGG - Intergenic
1048462736 8:134636022-134636044 TTATGAGAGGGAACAGTGTCTGG + Intronic
1048778142 8:137970315-137970337 TTTTGAGATGGTATAGTTGCAGG + Intergenic
1049445694 8:142630346-142630368 TTTCTAGATGGGAGAGTGGAAGG - Intergenic
1050367338 9:4884652-4884674 CGTTGAGATGGGCCAGTGGCAGG - Intronic
1050585897 9:7111120-7111142 TTTTTTGATGAGACAGTGGTGGG + Intergenic
1051351915 9:16205192-16205214 TTCTTAAATAGGACAGTGGCAGG + Intronic
1056575280 9:87851638-87851660 TGTTGAGTTGGGACAGGGGATGG - Intergenic
1057778529 9:98030242-98030264 TGTAGAGATGGGGCAGAGGCAGG + Intergenic
1059334584 9:113560841-113560863 CAGTGAGTTGGGACAGTGGCAGG + Intronic
1060524654 9:124313730-124313752 TTTTGTGGTGGGACAGTGCTGGG + Intronic
1061196230 9:129108575-129108597 CTTTGAGATGGGGCAGGGGTGGG + Intronic
1062122459 9:134841128-134841150 TTTGGGGATGGGGCAGTGGAAGG + Intronic
1203602884 Un_KI270748v1:31815-31837 TTTTGAGATGCCAAGGTGGCAGG - Intergenic
1187075455 X:15929994-15930016 ATCTGAGCTGGGACAGTGACTGG + Intergenic
1187431303 X:19227864-19227886 TTTGCAAATGGGTCAGTGGCAGG + Intergenic
1187431889 X:19232579-19232601 TTTTGAGAGGGGGCAGTTACAGG + Intergenic
1188767939 X:34119875-34119897 TTTAGAGATGACACAGTTGCAGG + Intergenic
1190005601 X:46734171-46734193 TTGTGACATGTGACAGTAGCTGG - Intronic
1193132420 X:77932140-77932162 TTCTCAGATGGGGCAGTTGCCGG + Intronic
1195978986 X:110558497-110558519 TTGCTAGATGGGGCAGTGGCCGG + Intergenic
1196227601 X:113184949-113184971 GTTTGAGAGGGGAGAGTGGGAGG - Intergenic
1197585206 X:128338361-128338383 TTTTGAGCTGGGAAAGTAGTGGG + Intergenic
1198400243 X:136261896-136261918 TTTTGAGTTGGGACAGGATCAGG - Intergenic
1198795089 X:140385976-140385998 TTTTGAGATAGGAGAATGCCAGG - Intergenic
1202384957 Y:24316854-24316876 TTTTGAGATGCCAAGGTGGCAGG - Intergenic
1202485828 Y:25353268-25353290 TTTTGAGATGCCAAGGTGGCAGG + Intergenic