ID: 1126755697

View in Genome Browser
Species Human (GRCh38)
Location 15:51923089-51923111
Sequence GTGAAGAGGCAGAAGGGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 714
Summary {0: 1, 1: 0, 2: 9, 3: 62, 4: 642}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126755687_1126755697 20 Left 1126755687 15:51923046-51923068 CCACGTGGATCCATTGGTTTGCA 0: 1
1: 0
2: 0
3: 4
4: 81
Right 1126755697 15:51923089-51923111 GTGAAGAGGCAGAAGGGGCCAGG 0: 1
1: 0
2: 9
3: 62
4: 642
1126755689_1126755697 10 Left 1126755689 15:51923056-51923078 CCATTGGTTTGCAGGTGTGAAGG 0: 1
1: 0
2: 0
3: 11
4: 146
Right 1126755697 15:51923089-51923111 GTGAAGAGGCAGAAGGGGCCAGG 0: 1
1: 0
2: 9
3: 62
4: 642

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126755697 Original CRISPR GTGAAGAGGCAGAAGGGGCC AGG Intronic
900089466 1:913554-913576 ATGAACAGGCAGAGGGGGTCAGG - Intergenic
900093900 1:932630-932652 CTGCAGAGGCAGAAGGACCCAGG - Intronic
900388131 1:2419877-2419899 GTTCCGAGGCAGAAAGGGCCTGG - Intergenic
900432488 1:2609451-2609473 CTGACGAGGCTGCAGGGGCCAGG + Intronic
900520738 1:3104420-3104442 GTGAACAGGCAGAGGCTGCCCGG + Intronic
900676538 1:3890690-3890712 GTGCAGAAGCAGAATGAGCCAGG - Exonic
901208468 1:7510909-7510931 GTGGACAGGCAGATGGGGCAGGG - Intronic
901216065 1:7556045-7556067 ATCAAGAGGCAGAGGGAGCCGGG + Intronic
901234587 1:7661157-7661179 GTGCAGATGCAGGAGAGGCCAGG - Intronic
901457786 1:9373279-9373301 GTGACTGGGGAGAAGGGGCCTGG + Intergenic
902116023 1:14121911-14121933 GCCCAGAGGCAGAAGGTGCCTGG + Intergenic
902225841 1:14996060-14996082 CTCCAGAGGCAGAAGGGGCTGGG - Intronic
902737628 1:18411610-18411632 GTGAGGAGGAAGAGGGTGCCAGG + Intergenic
902793474 1:18784799-18784821 GTGAAGAGGTAAAAGGGGTTGGG - Intergenic
902809010 1:18877785-18877807 GTGGAGTGGGAGAATGGGCCTGG - Intronic
902836664 1:19051844-19051866 GGGAAGGGGCAGAATGAGCCTGG - Intergenic
903669712 1:25028221-25028243 AAGAAGAGGAAGAAGGGGCTGGG - Intergenic
904600357 1:31669505-31669527 GGGATGAGGGAGAAGGGGGCAGG - Intronic
904633827 1:31864213-31864235 GTCAAGAGGCAGAAGGAGCAGGG + Intergenic
904799257 1:33081363-33081385 GACAGGAGGCAGAAGGGGCAGGG - Intronic
904924879 1:34039636-34039658 GTGACAAGGCAGAAGGAGCCTGG + Intronic
905349689 1:37336874-37336896 TTGAAGAGGCAGAAGTGGGAGGG + Intergenic
905443649 1:38010370-38010392 GGGAAGAGGCAGGAGTGGCTGGG + Intronic
905776944 1:40674396-40674418 GTCTAGAGGCTGGAGGGGCCAGG - Intergenic
906103701 1:43279254-43279276 GGGCAGAGGCAGGCGGGGCCAGG + Intergenic
907227014 1:52957222-52957244 TTAAATAGACAGAAGGGGCCAGG - Intronic
907300539 1:53483949-53483971 GAGCAGGGGCAGGAGGGGCCTGG + Intergenic
907655028 1:56333631-56333653 GAGCAGAGGCAAAAGGGGCAGGG - Intergenic
909457371 1:75865514-75865536 GTCGAGAGGCAGAAGGAGCAAGG + Intronic
909723586 1:78807067-78807089 GTGAGGAGGCAGGAGGGGGGTGG + Intergenic
909781985 1:79559002-79559024 GTCCAGAGGCACCAGGGGCCAGG - Intergenic
910369100 1:86497052-86497074 GGAAGGAGGCAGAAGGGGACTGG + Intronic
910792831 1:91068918-91068940 TTGAAGAGGCAGAAGAGGCTAGG + Intergenic
912383093 1:109258039-109258061 GTGTAGAGGCTGAGGGGGCAGGG + Intronic
912432559 1:109636740-109636762 GTCTAGAGGCAGAAGGGTCATGG + Intergenic
912791593 1:112657293-112657315 GAGAAGAGGGAGAAAGGGCAAGG - Intronic
913656156 1:120962230-120962252 GTGAAAAGCCAGCATGGGCCAGG + Intergenic
913961326 1:143339920-143339942 GTGCAGAGGCAGCAGGTGGCAGG + Intergenic
914055679 1:144165493-144165515 GTGCAGAGGCAGCAGGTGGCAGG + Intergenic
914123467 1:144800869-144800891 GTGCAGAGGCAGCAGGTGGCAGG - Intergenic
914341032 1:146760759-146760781 GGAAGGAGGAAGAAGGGGCCAGG - Intergenic
914520714 1:148413460-148413482 GTGAAAAGCCAGCATGGGCCAGG + Intergenic
914725029 1:150320390-150320412 TTAAAGAGTCAGTAGGGGCCGGG + Intergenic
914889683 1:151612029-151612051 GTGAAGAGGAGGCAGGGGGCGGG - Intergenic
914889832 1:151612547-151612569 GTGCAGGGGCAGGAGGGGCGCGG - Intronic
915355547 1:155253602-155253624 GTGAGAAGGGAGCAGGGGCCAGG - Intronic
915584308 1:156835928-156835950 ACGGAGAGGGAGAAGGGGCCTGG - Intronic
915605309 1:156946788-156946810 CTGAAGAGGCAGAATGGACACGG + Intronic
915929998 1:160054378-160054400 GTGAGGACCCAGATGGGGCCAGG - Intronic
915953432 1:160205263-160205285 ATGGAGAGGCAGGAGGGGGCGGG - Intergenic
915959720 1:160255427-160255449 TTCAAGAGGGAGAAGAGGCCAGG - Intronic
915973935 1:160372671-160372693 GAAAAGAGGCAGATGGGACCAGG - Exonic
916786624 1:168091390-168091412 GTTAAGTGGGACAAGGGGCCAGG - Intronic
919785414 1:201255156-201255178 GTGAGGAGGCCAAACGGGCCGGG - Intergenic
919804307 1:201371987-201372009 GTGGAGAGCCAGAAAGGGGCAGG - Intronic
919919598 1:202160264-202160286 GTGAGGGGACAGAATGGGCCTGG + Intronic
920254654 1:204646178-204646200 GTGAAATGGGAGAAGGGGCGTGG + Intronic
920297443 1:204967632-204967654 GTGAGGAGGCAGAATGGTCTTGG + Intronic
920358913 1:205398604-205398626 GAAAAGAGGCAGAAGGGACATGG + Intronic
920436324 1:205949348-205949370 GAGAAAAGGCAGAGGGGGCTGGG - Intergenic
922063552 1:222114394-222114416 GGGAAGAGGCAGAAGGGCAAGGG - Intergenic
922444394 1:225684319-225684341 GTGCACAGGCAGAACGGACCTGG + Intergenic
922603149 1:226871851-226871873 GCGCAGGTGCAGAAGGGGCCTGG + Intronic
922681705 1:227603631-227603653 ATGAAGCAGCAGAAGGGGGCTGG - Intronic
922699079 1:227747686-227747708 CTTCAGAGGCAGAAGAGGCCTGG + Exonic
923687024 1:236160528-236160550 GTGGACAGACAGAAGGAGCCTGG - Intronic
924437983 1:244061895-244061917 GTGATGAGGGAGAATGGGACAGG + Intergenic
1063110973 10:3037276-3037298 GTCAGGAGGCAGAAGGGGTTGGG + Intergenic
1063390992 10:5649822-5649844 CTTAAGAGGCAGGAGAGGCCGGG - Intronic
1063483676 10:6399581-6399603 GTCAAGAGGCAGAAGAGAGCAGG + Intergenic
1063741915 10:8832240-8832262 GTGAAGACACAAAAGTGGCCAGG - Intergenic
1064040793 10:11961505-11961527 GGGAAGAGGAGGGAGGGGCCGGG + Intronic
1064699080 10:18000143-18000165 GGGAAGTGGCAGAAGGGGCAAGG + Intronic
1064979461 10:21151650-21151672 GTGGAAAGGAGGAAGGGGCCTGG - Intronic
1065953377 10:30672500-30672522 TTGTAGAGCTAGAAGGGGCCTGG - Intergenic
1065980189 10:30887282-30887304 GTCAGGAGGCAGAAGGAGCCAGG - Intronic
1066457067 10:35581666-35581688 GTGCAGAGGTAGAAATGGCCAGG + Intergenic
1067029777 10:42872318-42872340 GTGCAGAGGCAGCAGGCGGCAGG + Intergenic
1067088792 10:43256187-43256209 GTGAGGATGCTGAGGGGGCCTGG + Intronic
1067693160 10:48517502-48517524 GGGAAGAGGAAGAAGAGGCTTGG - Intronic
1067757712 10:49017632-49017654 CTGTAGAGGCCTAAGGGGCCTGG + Exonic
1067829112 10:49599848-49599870 GTGATGTCACAGAAGGGGCCTGG - Intergenic
1068401534 10:56534125-56534147 GTCAGGGGGCAGAAGGGGCAGGG - Intergenic
1069717170 10:70528767-70528789 GCAATGAGGGAGAAGGGGCCTGG - Intronic
1069725422 10:70574481-70574503 GTGCAGAGGCAGAATGAACCTGG + Intergenic
1070378873 10:75861441-75861463 GTCAAGAGGCAGAGTGGGACTGG + Intronic
1070554098 10:77514826-77514848 GTGAAGAGGCAGAAGGTCAGAGG - Intronic
1070942546 10:80359636-80359658 GTGGGGAGGCAGTAGAGGCCCGG + Intronic
1071294806 10:84211787-84211809 TGGCAGAGGCAGGAGGGGCCTGG + Intronic
1072380659 10:94866123-94866145 GTAATGAGGCAGAAGGGGAATGG - Intergenic
1072753254 10:97999452-97999474 GGGAAGAGGCAGCAGGCGGCTGG - Intronic
1073779099 10:106817412-106817434 GTGGGGAAGCAGGAGGGGCCTGG - Intronic
1073959633 10:108911927-108911949 GTGGAGAGGAAGAAGGGAGCAGG - Intergenic
1074519863 10:114209315-114209337 GTGAAGAAGCAGAAGCTGACTGG + Intronic
1074532047 10:114304943-114304965 GTGCAGATGCAGGAGGGGACAGG + Intronic
1075539135 10:123297612-123297634 TTCAAGAGACAGCAGGGGCCCGG - Intergenic
1075730301 10:124631786-124631808 GTGAAGAGGGAGACAGGGCGGGG - Intronic
1076260188 10:129059013-129059035 GTGAGGAGGGACAAGGGGCCGGG + Intergenic
1076347324 10:129788374-129788396 GTGCAGAGGCAGAGGGTGACCGG + Intergenic
1076392284 10:130111686-130111708 GTGCTAAGGCAGGAGGGGCCTGG - Intergenic
1076736125 10:132459893-132459915 TTCAACAGGCAGGAGGGGCCAGG - Intergenic
1076796001 10:132798813-132798835 GTGAGGTAGGAGAAGGGGCCTGG + Intergenic
1076838411 10:133032723-133032745 ATGAGGAGGGAGAAGGGGGCAGG - Intergenic
1077159839 11:1107706-1107728 GTGAAGAGCAAGATGGTGCCTGG + Intergenic
1077199046 11:1296456-1296478 CTGCAGCGGCCGAAGGGGCCTGG + Intronic
1077888842 11:6404807-6404829 GGGTGGAGGCAGGAGGGGCCGGG - Intronic
1077996419 11:7456301-7456323 GTCAGGAGGCAGGAGGGGGCTGG + Intronic
1078180495 11:9006168-9006190 GTGATGGGACAGAAGGGGCCAGG - Intergenic
1080076085 11:28151460-28151482 TTGAAGAGGTAAAATGGGCCTGG - Intronic
1080118575 11:28648120-28648142 TTGAAGAGCCAGATGGGGCAAGG + Intergenic
1080401614 11:31941612-31941634 GTCAAGAGGCAGAGGGAGCAAGG + Intronic
1081992493 11:47345368-47345390 GGGCAGAGGGATAAGGGGCCTGG + Intronic
1082580110 11:54855746-54855768 GATAAAAGGCAGAAGTGGCCAGG - Intergenic
1083621977 11:64053681-64053703 GGGAAGGGGCTTAAGGGGCCTGG + Intronic
1083714936 11:64569732-64569754 GAGAGGAGGCAGCAGGGGCAGGG - Exonic
1083885640 11:65572359-65572381 GGGAAAAGGCTGAAGGGGGCAGG - Intronic
1084053297 11:66615220-66615242 GTCAAGAGCCAGTATGGGCCAGG - Intergenic
1084482911 11:69432413-69432435 GTGATGAGGGAGAAGGTGCTGGG - Intergenic
1084486774 11:69452852-69452874 GTGGAGAGGTAGAAGGAACCTGG + Intergenic
1084515626 11:69636844-69636866 GTGAACACACAGAAGGGGCTTGG + Intergenic
1084551689 11:69847303-69847325 GTGTAGAGGGAGAAGGGGCAGGG - Intergenic
1085330821 11:75649431-75649453 GGGAAGAAGCAGAATGGGTCTGG + Intronic
1087474826 11:98622121-98622143 GGGAAGAGGAAGAAGGGGAGGGG - Intergenic
1087679364 11:101202346-101202368 GAGTGGAGGCAGAAGGAGCCAGG - Intergenic
1087908901 11:103729916-103729938 GTGGAGAGGAAGAAGGGGGGTGG + Intergenic
1088734599 11:112718441-112718463 GTGAAGAGGCAGAAAAATCCTGG - Intergenic
1089281236 11:117376100-117376122 GTAAAGAGGATGAATGGGCCAGG - Intronic
1089528310 11:119110978-119111000 GAGAAGAGGCAGAACGGGGAGGG + Intronic
1089602575 11:119624526-119624548 ATGAGGAGGCAGGAGGGCCCAGG - Intronic
1090713391 11:129408495-129408517 GTGAAGAGACAGGCAGGGCCAGG - Intronic
1090745215 11:129699838-129699860 CAGAAGTGGCAGAAGGAGCCGGG - Intergenic
1091030601 11:132184203-132184225 GTGAGGAGGCAGAAGTGTCAGGG - Intronic
1091214583 11:133892953-133892975 GTGAGGAGGGAGAAATGGCCTGG - Intergenic
1091640135 12:2230069-2230091 CGGAAGGGGAAGAAGGGGCCTGG + Intronic
1091817997 12:3454135-3454157 GTGAAGAGACAGCAGGGGCTAGG - Intronic
1092253977 12:6916366-6916388 GTGAAGAGGACACAGGGGCCAGG - Intronic
1092945407 12:13449815-13449837 GGGCAGAGGCAGAAGGGGGTGGG - Intergenic
1093637509 12:21488999-21489021 GTGAGTAGGCAGAAGGGACAGGG - Intronic
1094143168 12:27201726-27201748 TAGAAAAGCCAGAAGGGGCCAGG + Intergenic
1094267176 12:28572483-28572505 TTGAAGATGCAGAACAGGCCAGG + Intronic
1095943649 12:47741399-47741421 GAGAAGAGGGAGGAGGGGCCTGG - Intronic
1096073072 12:48786656-48786678 GTTAAGAGGTTGAAGGGGCCAGG - Intronic
1096225668 12:49865460-49865482 GTGGTGAGGCAGAAGGGATCTGG + Intergenic
1096439295 12:51626057-51626079 GTCAGGAGGCAGAAGGAGCGAGG + Intronic
1097527733 12:60759382-60759404 TTGAAGATGGAGAAGGGGGCAGG - Intergenic
1097872124 12:64610465-64610487 GGGAGGCGGCAGGAGGGGCCGGG + Intergenic
1098100538 12:67011437-67011459 GTAGAGAGGTAGCAGGGGCCAGG - Intergenic
1098448353 12:70590807-70590829 GCCCAGAGGCAGAAGGGCCCAGG - Intronic
1098879336 12:75901088-75901110 GAGGAGAGGAAGCAGGGGCCGGG + Intergenic
1099205448 12:79721385-79721407 CAGAAAAGGCAGAAGGGGCTAGG - Intergenic
1099334990 12:81344153-81344175 GTCAGGAGGCAGAAGGAGCAGGG - Intronic
1099561023 12:84174079-84174101 GGGTGGAGGCAGAAGGGGGCTGG + Intergenic
1099888126 12:88556668-88556690 GAGAAGAGGCAGCAGGAGTCTGG + Intronic
1100802942 12:98252237-98252259 GTGAAATGGCTGAAAGGGCCGGG - Intergenic
1102009324 12:109608267-109608289 GAGAAGATGCAGACGGGACCTGG - Intergenic
1102215632 12:111159639-111159661 GTGAATAGCCGGAAGGGGGCTGG - Intronic
1102348761 12:112176573-112176595 GTGAATGAGCAGACGGGGCCTGG - Intronic
1102650662 12:114439993-114440015 GAGAAGAGCCAGGTGGGGCCTGG - Intergenic
1102720570 12:115012854-115012876 GTGAAGAAGAGGAAGGAGCCAGG - Intergenic
1103367816 12:120395789-120395811 TTGAAAAGGCAAAATGGGCCGGG - Intergenic
1103726504 12:122999874-122999896 GGGGAGGGGCAGAAGGGGCCTGG - Intronic
1103755840 12:123206151-123206173 GTGAAGAGAGAGAAATGGCCAGG + Intronic
1104062087 12:125277183-125277205 ATGAAGAGGGAGAACAGGCCGGG + Intronic
1104400660 12:128473335-128473357 GTGAAGATGAAGAAGGAGGCTGG - Intronic
1106002646 13:25738559-25738581 GTGAAGGGTGGGAAGGGGCCTGG + Intronic
1106155814 13:27154904-27154926 TTGAAGATGCTGCAGGGGCCAGG + Intronic
1106230187 13:27815476-27815498 GTGAAGAGGCTGGATGAGCCAGG - Intergenic
1106409148 13:29498995-29499017 CTCACAAGGCAGAAGGGGCCAGG + Intronic
1106856427 13:33858469-33858491 GTGAAGAGTGGGAAGGGACCTGG - Intronic
1107372541 13:39768328-39768350 GTGGAGTGGCAGTAGGGGCCAGG - Intronic
1107660113 13:42630556-42630578 GTGGAGAGGAAGGAGGGGGCAGG - Intergenic
1108477138 13:50831466-50831488 GTGTGGAGTCAGAAGGGGCTGGG + Intronic
1110733416 13:78907913-78907935 GTGAAAAGGCAGAGATGGCCAGG + Intergenic
1111549161 13:89784424-89784446 GGGCTGAGGCAGCAGGGGCCTGG + Intergenic
1111969051 13:94891590-94891612 GTGGAAAGGCAGAAAGAGCCTGG - Intergenic
1111986712 13:95073355-95073377 GGTAAGTGGCAGAAGGAGCCAGG - Intronic
1112771870 13:102800738-102800760 CTGAAGGGGAGGAAGGGGCCTGG + Intronic
1113632973 13:111900420-111900442 GTGAACTGGCAGCAGGGGCATGG - Intergenic
1114992592 14:28306039-28306061 GTGAAGAGGCAACAGGTACCTGG - Intergenic
1115099496 14:29681318-29681340 ATGAAGTGACAGAAAGGGCCAGG - Intronic
1115114838 14:29867698-29867720 GTACAGAGGCAGAATGAGCCAGG + Intronic
1115128596 14:30025993-30026015 GTTTAAAGGCAAAAGGGGCCAGG + Intronic
1115505724 14:34092591-34092613 GTGAGGGGGCAGGAGGTGCCAGG + Intronic
1117833845 14:59781215-59781237 GTGAACAAGCAGAAGGGAGCTGG - Intronic
1118658440 14:67980147-67980169 GTAAAGAGGAAGAAGTGGCCAGG + Intronic
1118686101 14:68292663-68292685 GTGGAAAGGGAGGAGGGGCCTGG - Intronic
1119716493 14:76863336-76863358 GTGGAGAGACAGTAAGGGCCAGG - Intronic
1119800544 14:77441096-77441118 GGGAAGAAGCAGAAGGGAGCAGG + Intronic
1120186159 14:81395871-81395893 GTGAGGAGGTAGGAAGGGCCCGG - Intronic
1120277023 14:82388910-82388932 GTGGAGAACCAGAAGGGGACTGG + Intergenic
1120532312 14:85646825-85646847 GTCAAGAGGCAGAACCAGCCTGG - Exonic
1120595732 14:86432973-86432995 CTGAGGAGGAAGAAGGGGCTAGG + Intergenic
1121721028 14:96108695-96108717 GTGAAGAGGAAGGAGTGGACTGG - Intergenic
1122047769 14:99035834-99035856 TTGCAGAAGGAGAAGGGGCCGGG + Intergenic
1122064259 14:99160452-99160474 GCAAAGAGGCTGGAGGGGCCTGG + Intergenic
1122138170 14:99646318-99646340 GTGGAGAGGCCCCAGGGGCCAGG + Intronic
1122605718 14:102946316-102946338 GTTAAGAAGCAGACGAGGCCGGG - Intronic
1122784075 14:104155858-104155880 GGGAAGAGGGTGGAGGGGCCGGG + Intronic
1122935429 14:104953843-104953865 GTGAGGAGGTGGAAGGAGCCGGG - Exonic
1124373319 15:29115564-29115586 GGGAAGAGGCAGGAGGCGGCCGG + Intronic
1125048726 15:35272981-35273003 GTGAAAAGGCAAAGGGGGGCTGG - Intronic
1125182128 15:36888917-36888939 GTGAGGAGGCAGGAGGATCCTGG + Intergenic
1126755697 15:51923089-51923111 GTGAAGAGGCAGAAGGGGCCAGG + Intronic
1127540273 15:59930837-59930859 GTGAAGATGGAGAAGGTGCAGGG - Intergenic
1127806788 15:62528553-62528575 CTCAAGAGACAGAAGGTGCCAGG + Intronic
1127904015 15:63362849-63362871 GAGAAGAGACAGAAGTAGCCAGG - Intronic
1128223216 15:65982982-65983004 GGGAAGAGGGAGAAGCGGGCAGG - Intronic
1128554657 15:68623270-68623292 TTCAAGAGGCAGCATGGGCCCGG - Intronic
1128701953 15:69811146-69811168 GAGAAGAGACTGAAGGGGCCTGG - Intergenic
1129158875 15:73735968-73735990 GTGGAGGGGCAGAAGGGAGCTGG - Exonic
1129902988 15:79166014-79166036 GTAAAGAGGAAGAAGGGTCCTGG + Intergenic
1130202973 15:81850604-81850626 GTCAGGAGGCAGAAGGGGTGAGG + Intergenic
1130430479 15:83842219-83842241 ATGAGGAGGCAGAAGGGGGATGG + Intronic
1130982425 15:88821915-88821937 GGGAAGAGGCACAAAGGGCAGGG + Intronic
1131149490 15:90037937-90037959 GTGAAGAGGCAGTGAGGGTCTGG + Intronic
1132497229 16:269607-269629 GTGAGGAGGCAGAAGGGTCAGGG - Intronic
1132615364 16:838886-838908 GGGAAGAGCCAGACGAGGCCTGG + Intergenic
1132894026 16:2219284-2219306 TTTAAGAGGCAAAGGGGGCCGGG - Intergenic
1133282680 16:4676153-4676175 GTGAAGAGGCTGCTGGGGCCTGG + Intronic
1133317597 16:4894098-4894120 GTGCAGTGGAAGAAGGTGCCTGG + Intronic
1134046793 16:11107059-11107081 GTGGAGAGGCGGCAGAGGCCCGG + Intronic
1134260884 16:12649944-12649966 GTGAGAAGGCATAATGGGCCAGG + Intergenic
1134516804 16:14894218-14894240 GCAATGAGACAGAAGGGGCCTGG - Intronic
1135956254 16:26958903-26958925 CTGCAGAGTCAGAAGGGTCCGGG + Intergenic
1136138697 16:28275029-28275051 ATGAAGTGGGAAAAGGGGCCGGG + Intergenic
1136145604 16:28314682-28314704 GATTAGAGGGAGAAGGGGCCAGG + Intronic
1136154725 16:28374974-28374996 GAGCAGGGGCAGAAAGGGCCCGG + Intergenic
1136208367 16:28740284-28740306 GAGCAGGGGCAGAAAGGGCCCGG - Intergenic
1136386263 16:29928014-29928036 GTAAAGAAGCAGCAGTGGCCAGG - Intergenic
1136472479 16:30490509-30490531 GTGAAGAGGCAGGAGGAGCCAGG - Intronic
1136546656 16:30958385-30958407 GTGAGGAGGCGGGAGGGGGCGGG + Intronic
1137377518 16:47965760-47965782 GTGGAGCTGCAGAAGGGGCTGGG - Intergenic
1137388948 16:48065600-48065622 GTCAAAAGGCAGAAGGGTGCTGG + Intergenic
1137604066 16:49775688-49775710 GTGAGGAGGCAGCAGTGGGCAGG - Intronic
1137889249 16:52141114-52141136 TTGAAATGCCAGAAGGGGCCAGG - Intergenic
1138457869 16:57131718-57131740 GTGAGGGGCCAGGAGGGGCCAGG - Intronic
1138596969 16:58034365-58034387 GGGAAGAGACAGCAGGGGGCGGG - Intronic
1139276391 16:65731646-65731668 TTGAAGATGCGGAAGGGGCTGGG + Intergenic
1139356682 16:66371064-66371086 AGGAGGAAGCAGAAGGGGCCAGG + Intronic
1139446540 16:67001719-67001741 GTGGAGAGGCAGAAGGTGCTGGG - Intronic
1139485268 16:67252664-67252686 AGGAAGAGGAAGAAGGTGCCTGG - Exonic
1139603551 16:68001583-68001605 GGGAGGAGGCAGGAGGGCCCTGG + Intronic
1139682245 16:68574079-68574101 GTCAGAAGGCAGGAGGGGCCTGG - Intronic
1139993253 16:70956647-70956669 GGAAGGAGGAAGAAGGGGCCAGG + Intronic
1140195815 16:72854507-72854529 GTGAAGAGCCAGAATGGGAGTGG - Intronic
1140214263 16:72994783-72994805 TTAAAGAGGCACAAGGGGCGGGG + Intronic
1140741798 16:77948053-77948075 TTTAAGAGGGAGATGGGGCCGGG - Intronic
1141156128 16:81598311-81598333 GTAAAGAGCCAGATGTGGCCAGG - Intronic
1141384182 16:83604121-83604143 GTGAAGAGGCTGATGTGGCTTGG - Intronic
1141675630 16:85515835-85515857 CAGAAGAGGCAGGAGGGGACCGG - Intergenic
1142720082 17:1770153-1770175 GTGAAGTAGCACCAGGGGCCTGG + Intronic
1142764827 17:2059095-2059117 AGGAAGAGGCGGGAGGGGCCTGG - Exonic
1142940739 17:3378295-3378317 GGGCAGAGGCAGCAGGGGGCTGG + Intergenic
1142976570 17:3648240-3648262 GTGCAGAGACAGAAGGAGCTGGG - Intronic
1143416865 17:6756724-6756746 GAGCAGGGGGAGAAGGGGCCAGG + Intronic
1143539581 17:7561242-7561264 GTGAAGAGGCAGAGGGCACCTGG - Exonic
1143625099 17:8105170-8105192 ATGAAGTGGGAGAAGGGGCTGGG - Intronic
1143761863 17:9110566-9110588 GAAAAGAGGCAGGAGGGGCTGGG - Intronic
1143986197 17:10916503-10916525 ATAAAGAGGGAGAAAGGGCCTGG + Intergenic
1144518657 17:15939373-15939395 GTGAAAAGACAGAAGGCTCCAGG - Intergenic
1144780137 17:17803934-17803956 CTGAAGAGTGAGATGGGGCCTGG - Intronic
1146034127 17:29390919-29390941 GTGAGGAGGAGGAGGGGGCCCGG - Exonic
1146257584 17:31400539-31400561 TCGGAGAGGCAGAAGGGGCCGGG + Intronic
1146354864 17:32125464-32125486 CTGGAGAAGCAGCAGGGGCCTGG - Intergenic
1146433097 17:32817829-32817851 TTTAAGAGGTAGTAGGGGCCGGG + Intronic
1146506024 17:33406053-33406075 GTCAGGAGGCAGAAGGAGCCAGG - Intronic
1146804656 17:35855627-35855649 GAGAAGAGGAAGAAGTGGGCAGG + Intronic
1147367873 17:39971172-39971194 GTGAAGAGGAAGAAGGAGCCAGG + Intronic
1147379230 17:40043377-40043399 TTCAAGAGGCTGAAGGGACCTGG + Intronic
1147773460 17:42883748-42883770 GTTAAGAGGCATAAGGGGCTGGG - Intergenic
1147986581 17:44310567-44310589 GTGATGAGGCAGTAGGGGCCTGG - Intronic
1148083799 17:44982130-44982152 GGGAAGAGGGTGAAGAGGCCTGG + Intergenic
1148332699 17:46821642-46821664 CAGAAGAGGCAGCAAGGGCCAGG + Intronic
1148463979 17:47853595-47853617 GGGAAAAGGCAGAAGGGGCCAGG - Intronic
1148789759 17:50166579-50166601 GAGGAGAGGAAGACGGGGCCAGG - Intronic
1148841052 17:50497491-50497513 AAAAAGAAGCAGAAGGGGCCAGG + Intergenic
1150613908 17:66754406-66754428 GGGAGGTGGCAGATGGGGCCAGG - Intronic
1151139139 17:71975233-71975255 GGAAAGAGGCAGAAGGAGTCTGG + Intergenic
1151372339 17:73656160-73656182 GAGGAGAGGCAGAGGAGGCCGGG + Intergenic
1151576851 17:74956810-74956832 GAGAGGAAGCAGAAGGAGCCAGG - Intronic
1151688098 17:75661572-75661594 GTGAAGAGACTCAAGTGGCCTGG + Intronic
1152019389 17:77772557-77772579 GGGAACAGGCAGATGGGGGCAGG - Intergenic
1152096444 17:78274716-78274738 AAAAATAGGCAGAAGGGGCCGGG + Intergenic
1152243810 17:79175026-79175048 AGGAAGAGGCAGGAGGGGCTGGG - Intronic
1152693123 17:81730311-81730333 GTGAAGAGCTGGGAGGGGCCTGG + Intergenic
1152937483 17:83148834-83148856 GTGAGGGTGCAGGAGGGGCCTGG + Intergenic
1152984275 18:307705-307727 GTGTGAAGGCAGAAGGGGACGGG + Intergenic
1154492412 18:14932170-14932192 GGGATGAGGCACAAGGGGCTGGG - Intergenic
1155250029 18:23945442-23945464 GAGAAGAGGCAGATGTGGCCAGG + Intronic
1155518321 18:26644462-26644484 GTAAAGAGGAAGCAGGGGGCAGG + Intronic
1156160292 18:34350938-34350960 GGGCAGAGGCAGCAGGGGGCTGG - Intergenic
1156451592 18:37269529-37269551 GTGAATTGGCAGCAGGGGCTGGG - Intronic
1157191471 18:45585769-45585791 ATGCAGAGGGAGAAGGGGGCAGG - Intronic
1157476279 18:48025512-48025534 GTGAAGATGGAGAAGGGGAAGGG - Intergenic
1158172451 18:54614877-54614899 TTGAAGAGGCAGGAGGGGACGGG + Intergenic
1158426042 18:57340422-57340444 GTGAAAAGGCAGAAGGAGCTGGG - Intergenic
1158532745 18:58278353-58278375 GTGAAGAGGCAGGAGGGGCAGGG - Intronic
1158594875 18:58807265-58807287 GTCAGGAGGCAGAAAGGGCCAGG - Intergenic
1158931881 18:62330743-62330765 GTGCAGGGGCAGAAGGTGCAGGG + Intronic
1160134318 18:76259613-76259635 GACAAGAGGCAGAAGGGGTCAGG - Intronic
1160227009 18:77019419-77019441 GTGAAGATGGAGGAGGAGCCTGG + Intronic
1160248969 18:77184599-77184621 GTGAAGAGGCAGGCCGGGCGCGG - Intergenic
1160705185 19:526246-526268 GTGAAGGGGGAGGAAGGGCCTGG - Intergenic
1160792167 19:927892-927914 GTGAAAAGGCAGTGGGGGGCAGG - Intronic
1161006869 19:1941439-1941461 GTGCAGGGGGCGAAGGGGCCGGG - Intronic
1161055284 19:2187944-2187966 GTGAAAAGACAGGAAGGGCCAGG + Intronic
1161081126 19:2310659-2310681 GTGAAGAGGGGGAAAGGGGCGGG - Intronic
1161251733 19:3284509-3284531 GTGGAGAGGGAGACGGGGCAGGG + Intronic
1161303015 19:3552027-3552049 AGGTAGAGGCAGCAGGGGCCAGG - Intronic
1161435469 19:4260127-4260149 GTAAAAAAGTAGAAGGGGCCGGG + Intronic
1161613565 19:5257443-5257465 AGGAAGAGGCAGAAGGCGCCGGG + Intronic
1161728352 19:5943945-5943967 TTCAAGAGGCAGCAGGGACCAGG - Intronic
1161963760 19:7536379-7536401 GAGAAGAGGCAGACGGATCCAGG - Intronic
1162049664 19:8025293-8025315 AAGAATAGGAAGAAGGGGCCGGG - Intronic
1162129548 19:8517617-8517639 GTGAGGTGGCAGAAGGGACAGGG + Intergenic
1162297408 19:9822792-9822814 GAGAAGAGGAAAATGGGGCCGGG - Intronic
1162967703 19:14163862-14163884 GAGAAGAGGGAGAAGGGGCCGGG - Intronic
1163053822 19:14704071-14704093 GTGAAGAGGCAGCAGGAGGGTGG - Intronic
1163413192 19:17169728-17169750 GTGAAGAGGAAGAGGGAGGCAGG - Intronic
1163611255 19:18302948-18302970 GGGAAGGGGCAGAGGGGGTCAGG - Intergenic
1163720225 19:18895226-18895248 GGGAAGAGGCAGGAGCTGCCCGG - Intronic
1163761679 19:19140345-19140367 GGGAAGGGACAGAAGGGACCAGG + Intergenic
1163826412 19:19527167-19527189 GGGAAGAGGCGGAGGGGGGCGGG - Intronic
1164969734 19:32521402-32521424 GTAAAGAGGGAGAAGTGGACAGG - Intergenic
1165406490 19:35634039-35634061 GTGAAGGGACAGAAGGGACGGGG + Intronic
1165696791 19:37906946-37906968 GGGAGGAGGTAGACGGGGCCAGG + Intergenic
1166219771 19:41356958-41356980 GGGGAAAGGCAGAAGGGGACAGG - Intronic
1166303097 19:41923010-41923032 GGGAAGAGGCGGGAGGGGGCTGG + Intronic
1166646596 19:44536656-44536678 GTGTAGAGGCTGCAGGGGGCAGG - Intergenic
1167028751 19:46942336-46942358 TAGATGAGGCAGAAGAGGCCGGG + Intronic
1167080943 19:47275626-47275648 GTGAAGAGGCAGATGGGCTGTGG - Exonic
1167441709 19:49512920-49512942 GGGAGGAGGGAGGAGGGGCCGGG + Intronic
1167503921 19:49861642-49861664 GTGAAGAGGAAGCAGCGGCAGGG + Exonic
1167597154 19:50433778-50433800 GTGAAGACTCAGAGGGAGCCAGG + Intronic
1168137436 19:54360766-54360788 GTGCAGAGGAAGAAGGGGAGGGG + Intronic
1168160641 19:54508316-54508338 GTGCAGAGGAAGAAGGGGAGGGG - Intronic
1168458737 19:56537010-56537032 GTGAATAGGGAGAAGGGGGGTGG + Intergenic
1202695162 1_KI270712v1_random:118170-118192 GTGCAGAGGCAGCAGGTGGCAGG + Intergenic
925092509 2:1166946-1166968 ATGGAGAGCCAGAAGGGGCATGG - Intronic
925352251 2:3209472-3209494 GTTAAGATGCACAAGGTGCCTGG - Intronic
925682923 2:6442042-6442064 GTGAACAGACAGAAGGGGAATGG - Intergenic
925762649 2:7200510-7200532 GTGAAGAGACAGCATGCGCCAGG - Intergenic
925924072 2:8658162-8658184 GGGAAGAGGCAGCAGGGGCCCGG + Intergenic
926194701 2:10755682-10755704 GTGAGGAGGCAGAATTGCCCAGG - Intronic
926210413 2:10865211-10865233 GTGAAGATGTGGAAGGGGCCGGG + Intergenic
926390678 2:12388968-12388990 GAGAAGAGACAGAATGGGACAGG - Intergenic
926647989 2:15310738-15310760 GTTTAGAGGCAGAAGGAGCCAGG - Intronic
927337090 2:21937641-21937663 GTGAAGAGGAAGAAGAGGCATGG + Intergenic
927399497 2:22694825-22694847 GTCAAGAGGCAGAGGTAGCCAGG + Intergenic
927651057 2:24914043-24914065 GTGAGGAGGAAGGAGGGGACTGG - Intronic
927782651 2:25951994-25952016 GCCAAGAGGCAGAGGGGGCTGGG + Intronic
927906844 2:26864710-26864732 GTGAAGCTGCAGGAAGGGCCAGG + Intronic
928960367 2:36919561-36919583 GAGAAGGGACAGAAAGGGCCTGG + Intronic
929040343 2:37738417-37738439 GTCAGGAGGCAGAAGGAGCCAGG + Intronic
929898279 2:45980178-45980200 GCTCAGTGGCAGAAGGGGCCTGG + Intronic
930171745 2:48258505-48258527 GTGAAGATGCAGAAGTGGCCAGG - Intergenic
930711924 2:54558009-54558031 GTGAAGAGCCCCAAGGGTCCCGG - Intronic
930777986 2:55194108-55194130 TTGGAGAGGAAGAAGAGGCCAGG + Intronic
932375256 2:71229636-71229658 GTGAAGAGCAGGAAGGGGCTGGG + Intergenic
932433092 2:71686998-71687020 GAGAGGAGGCAGAGGAGGCCGGG - Intergenic
932741398 2:74293542-74293564 TGGAAGAGGCAGAAAGGGCTGGG + Intronic
932830022 2:74980325-74980347 ATGCTGAGGCAGAAGGGGCATGG + Intergenic
933657127 2:84897949-84897971 ATGAAGAAGCAAAACGGGCCTGG + Intronic
933661589 2:84931836-84931858 GTCAAGAGGCAGAGTGAGCCAGG - Intergenic
933793119 2:85899407-85899429 TTGAAGAAGCAGCAGAGGCCTGG - Intergenic
934276332 2:91575219-91575241 GTGCAGAGGCAGCAGGTGGCAGG + Intergenic
935116819 2:100143978-100144000 CTGAAGAGGTAGAATGGGCAGGG - Intergenic
935133904 2:100281805-100281827 GAAAAGAGGCAGAAGGGGGCAGG + Exonic
935618202 2:105107121-105107143 GTGGGGAGGCAGAAGGAGCGAGG - Intergenic
936401762 2:112169943-112169965 AAGAAAAGGAAGAAGGGGCCAGG + Intronic
937085718 2:119170451-119170473 GTGCAGAGTGAGAAGGGGCAAGG - Intergenic
937319655 2:120953547-120953569 GTGAAGAGGTGGAAGGAACCTGG + Intronic
937953946 2:127408613-127408635 GTGAAGAGGAGGACGAGGCCCGG - Intergenic
938306747 2:130261842-130261864 GTGAGGAGGGAGAAGGGGACAGG - Intergenic
938343239 2:130549173-130549195 GTGAAGTGAGAGGAGGGGCCTGG - Intronic
938346594 2:130571549-130571571 GTGAAGTGAGAGGAGGGGCCTGG + Intronic
939939886 2:148336680-148336702 GTGAAAGGGAAGAAGAGGCCAGG - Intronic
940859958 2:158761200-158761222 GAGAGGAGGCAGCAGTGGCCAGG + Intergenic
942413020 2:175731391-175731413 GTGAAGAGGCAGAAAGAGGGTGG + Intergenic
943321556 2:186450410-186450432 TTGAAGAAGAAGATGGGGCCAGG + Intergenic
943797652 2:192017209-192017231 CTGGAGAGGCAGGTGGGGCCAGG + Intronic
944072284 2:195685576-195685598 GTGAAGAGGGAGAAAGGGATGGG - Intronic
944992448 2:205253557-205253579 CTGAAGAGGCAGAGGAGGCAGGG - Intronic
945569977 2:211454871-211454893 GTGAGGAGGCAGAACCGTCCTGG - Intronic
945988292 2:216371884-216371906 GTGGAGAGGAGGAAGGGGCGGGG - Exonic
946276292 2:218634222-218634244 GTGAGGAGGCAGCAGGGACTGGG + Intronic
946360072 2:219214020-219214042 GTGTTGGGGTAGAAGGGGCCTGG - Intronic
946416923 2:219544315-219544337 GTGCAGAGGCCCGAGGGGCCGGG - Exonic
946528970 2:220550943-220550965 CTGACTTGGCAGAAGGGGCCAGG + Intergenic
946593017 2:221272418-221272440 GTGATTAGTCATAAGGGGCCTGG + Intergenic
947534604 2:230933068-230933090 GGGAAGAGGCAGGAAGGGGCAGG - Intronic
947908575 2:233785568-233785590 GTGAGGAGGCAGAGGGAGTCAGG + Intronic
948601612 2:239110902-239110924 CTGAGGAGGCAGGAGGGGCCGGG - Intronic
948671563 2:239571784-239571806 GGGAAGAGGGAGAAGAGGCCAGG + Intergenic
948933344 2:241146789-241146811 GGGAAGAGGCACAAGGGCACAGG + Intronic
949019623 2:241734128-241734150 CTGAACAGGCAGAAGGGACAGGG + Intergenic
1168768434 20:397897-397919 GCCAAGAGACAGAAGGAGCCTGG - Intergenic
1168834098 20:865700-865722 GTGGAGGGTCAGAAGGGGCCTGG - Intergenic
1168991939 20:2102814-2102836 GGGATGAGGCAGGGGGGGCCCGG + Exonic
1169476102 20:5932589-5932611 TTAGAGAGGCAGCAGGGGCCAGG + Intergenic
1170030117 20:11935749-11935771 GAGAGGAGTCAGGAGGGGCCTGG - Intergenic
1170156552 20:13274431-13274453 GGGAAGGGGCAGATGAGGCCAGG - Intronic
1170203331 20:13768599-13768621 AAGAAAAGGGAGAAGGGGCCAGG + Intronic
1171128304 20:22624077-22624099 GTTAAGAGGAAAAATGGGCCAGG + Intergenic
1172098559 20:32472673-32472695 CAGAAGAGGCAGCAGAGGCCAGG + Intronic
1172223312 20:33288259-33288281 GAGCAGAGGAAGAAGGAGCCAGG - Intronic
1172439868 20:34957783-34957805 TTAAAGAGTCAAAAGGGGCCGGG - Intergenic
1172468395 20:35173872-35173894 CAGAAAAGGCAGCAGGGGCCAGG + Intronic
1172590165 20:36112225-36112247 CTGAAGCGGCAGCAGGGGCCAGG - Intronic
1172841483 20:37904855-37904877 ATGGTGAGGCAGAAGGGGGCGGG - Intronic
1173198648 20:40937771-40937793 AAGAAAAGGAAGAAGGGGCCAGG + Intergenic
1173540619 20:43848260-43848282 GCCAATAAGCAGAAGGGGCCTGG + Intergenic
1173672756 20:44809912-44809934 GTGAGGAGGGAGATGGGTCCTGG + Intronic
1173722969 20:45276200-45276222 ATGAACAGGCAGTAGGGGACTGG - Intergenic
1173829014 20:46066707-46066729 TTGAAGAGGCAGAATGGCACTGG - Intronic
1174158635 20:48534433-48534455 GTGAAGATGAAGATGGGGACAGG + Intergenic
1174382139 20:50162838-50162860 GTGACCAGATAGAAGGGGCCTGG - Intergenic
1175300815 20:57941466-57941488 GGGAAGAGGCAGGACGTGCCAGG + Intergenic
1175764138 20:61581452-61581474 ATGAAGATGGAGGAGGGGCCAGG - Intronic
1176057159 20:63154877-63154899 GAGAAGAGGGAGAAGGGGAGAGG - Intergenic
1176084203 20:63288650-63288672 GTGGCCAGGCAGGAGGGGCCGGG + Exonic
1176095754 20:63343657-63343679 GTCCGGAGGCAGAAGGGGCTGGG + Intronic
1176275128 20:64261263-64261285 GTAAACAGGAAGCAGGGGCCAGG + Intronic
1178972244 21:37190427-37190449 TTGAAAATGAAGAAGGGGCCGGG - Intronic
1179728317 21:43353387-43353409 GTGAAGAGGGAGACAGGGACCGG + Intergenic
1179775581 21:43659773-43659795 GTGAAGACGCAGAGGGAGACAGG + Exonic
1179787043 21:43735862-43735884 GGGAGCAGGCAGAAGGGCCCCGG - Intronic
1180070852 21:45435251-45435273 GAGAAGAGGAAGAAGGGGGTGGG + Intronic
1180176898 21:46095215-46095237 GAGAAGGGGCTGACGGGGCCAGG - Intergenic
1180197897 21:46208393-46208415 CTGGAGAGGCAGAACGTGCCTGG + Intronic
1181944258 22:26503440-26503462 TTGAAATGGCAGAAGGTGCCAGG - Intronic
1182460118 22:30477613-30477635 GTGAAAAGGCACCAGGGGCCGGG + Intergenic
1183004855 22:34892549-34892571 GGGAAGAGGCTGAAGGGGAGGGG + Intergenic
1183483633 22:38077949-38077971 GTGTAGAGACACAAGGGGCTGGG - Intergenic
1183627619 22:39014402-39014424 AGGAAGTGGCAGGAGGGGCCTGG - Intronic
1183649053 22:39144034-39144056 GTTAAAAGGCAGAAAGAGCCTGG + Intronic
1183655408 22:39181621-39181643 GTGAAAAGGCAGCAAGGCCCTGG + Intergenic
1184272197 22:43391039-43391061 GTGGAGAGGCCCATGGGGCCAGG - Intergenic
1184291741 22:43501055-43501077 GTGAGGAGGCAGAGGGGCCGTGG - Intronic
1184420979 22:44382782-44382804 GTGGAGGAGCAGGAGGGGCCTGG - Intergenic
1184482834 22:44758153-44758175 GTGAAGAGGCATCTGAGGCCGGG + Intronic
1184566189 22:45293458-45293480 GTGAAGAGGGAGCAGAGTCCTGG + Intronic
1184616184 22:45640150-45640172 GTGGGGAGGCAGAGGGTGCCAGG + Intergenic
1184678202 22:46054582-46054604 GGTGGGAGGCAGAAGGGGCCTGG + Intronic
1184818721 22:46892613-46892635 GTGGAGTGGCAAAAGAGGCCAGG - Intronic
1184829675 22:46976591-46976613 GCTAAGAGGCAGAAGCGGCCAGG - Intronic
1184920217 22:47600655-47600677 GTGCAGAGGCTGAGGGGGCAGGG - Intergenic
1185273058 22:49937449-49937471 GTGGAGGGGCAGAAGTGGCACGG - Intergenic
1185375913 22:50482487-50482509 GTGTAGAGGCAAAAGTGGGCAGG + Intronic
1203292614 22_KI270736v1_random:9959-9981 GTCAGGAGGCAGAAGGATCCAGG + Intergenic
949347141 3:3087050-3087072 TTGAAGACGCAGAAGGGGAGAGG + Intronic
949459542 3:4275431-4275453 GTCAAGAGGCAGAAGAGGGATGG + Intronic
949879714 3:8651829-8651851 GTGAAGAGGCAGAGGAGGGGAGG - Intronic
950007101 3:9698449-9698471 ATGAAGCGGCAGAACAGGCCAGG - Intronic
950179807 3:10903371-10903393 GTTCAGTGGCAGTAGGGGCCAGG - Intronic
950182894 3:10927542-10927564 GCCAAGAGGCAGACGGGCCCGGG - Intronic
950905989 3:16538740-16538762 GAGATGAGGCAGAAGGGGTGAGG + Intergenic
951360259 3:21716638-21716660 GTGAAGAGAAATAAGGGGTCAGG - Intronic
951541133 3:23783179-23783201 GTGAGGAGGCAGAAGAGGACAGG + Intergenic
951664513 3:25107194-25107216 AGGAAAAGGCAGAAGGGGCTGGG - Intergenic
951820825 3:26809459-26809481 GTGGAAAGAAAGAAGGGGCCTGG + Intergenic
951962889 3:28348829-28348851 GAGCCGAGGCAGGAGGGGCCGGG + Exonic
952944785 3:38472132-38472154 CTGAAGAGACAGATGGGGCCAGG - Intronic
953649705 3:44790974-44790996 ATTAAGAAACAGAAGGGGCCGGG - Intronic
954100635 3:48369899-48369921 GTCAGGAGGCAGAAGGGGCGGGG + Intergenic
954332827 3:49899991-49900013 GAGAAGAGCCAGCAGGGGGCAGG - Intronic
954463284 3:50639814-50639836 GTGTAGAAGCAGAAGGTGCTGGG - Intronic
954928904 3:54262699-54262721 GTGAAAAGGCAGATGGTTCCTGG + Intronic
956644110 3:71439646-71439668 TTTAAAAGGGAGAAGGGGCCAGG + Intronic
956855482 3:73270762-73270784 TTGAAGAGGCAGAAGGAAGCAGG - Intergenic
956896395 3:73665037-73665059 GTGAAAAGACAGAAGGTGGCTGG - Intergenic
960094585 3:113677021-113677043 GGGAGGAGGGAGAAGGGTCCTGG + Intronic
960223873 3:115147454-115147476 GGGAAGAGGAAGAAAGGGGCGGG - Intergenic
960417704 3:117405486-117405508 CTGAGGAGGCAGCAGGGGCATGG + Intergenic
960689785 3:120333733-120333755 GTGAAGAGCCTGAAGGGCCAGGG - Intronic
960914023 3:122679468-122679490 GTGAAGGGGAAGAAGGAGCCAGG - Intergenic
960968181 3:123120094-123120116 GGGAAGAGGCAGATGGAGACAGG - Intronic
961006085 3:123406302-123406324 GTCAGGAGGCAGAGGGAGCCAGG - Intronic
961478143 3:127161375-127161397 GAGAGCAGACAGAAGGGGCCAGG - Intergenic
961514805 3:127425844-127425866 CTCAAGATGCAGAAGGGGCCGGG + Intergenic
961623822 3:128245396-128245418 GTCAAGGGGCAGGAGGGCCCAGG - Intronic
962207714 3:133448638-133448660 ATGAAGAGGTAGGAGGGGGCTGG + Exonic
962492377 3:135907079-135907101 TAGAAGAGACAGAAGTGGCCAGG + Intergenic
963199128 3:142568849-142568871 GAGATGAGGCAGCAGGGGGCTGG - Intronic
963561889 3:146876094-146876116 GGGAAGAAGCAGCAGGGGCAGGG + Intergenic
965587320 3:170330487-170330509 GTGATGAGTCAGAGGGGGCCTGG - Intergenic
966771474 3:183507794-183507816 GGGAAGAGGAAGCACGGGCCAGG + Intronic
966887245 3:184383472-184383494 GTGGAGAGGCAGTAAAGGCCTGG - Intronic
966917424 3:184592817-184592839 GTGTAGAGGCTGAAGTGCCCAGG + Intronic
966934366 3:184696100-184696122 CTGAGGAGGCTGAAGGGCCCTGG + Intergenic
967965337 3:194956262-194956284 GAGAAGTGGCAGAAGAGGCCTGG - Intergenic
968261096 3:197324771-197324793 ATCAGGAGTCAGAAGGGGCCAGG + Intergenic
968261104 3:197324794-197324816 ATTGGGAGGCAGAAGGGGCCAGG + Intergenic
968261119 3:197324840-197324862 ATTGGGAGGCAGAAGGGGCCAGG + Intergenic
968538734 4:1151385-1151407 GTGCTGAGGCAGCAGGGGGCTGG + Intergenic
968555783 4:1245810-1245832 GGGAGGGTGCAGAAGGGGCCTGG + Intronic
968673629 4:1865361-1865383 CTCAAGAGCAAGAAGGGGCCGGG - Intergenic
968728850 4:2260532-2260554 GAGAAGCGGCAGCGGGGGCCGGG + Intronic
968818170 4:2832435-2832457 GTGGAGAGCCAGAGGGGCCCTGG - Intronic
968844441 4:3032186-3032208 GTGAAAAAGCAGAATGGGCCGGG + Intronic
968910778 4:3476056-3476078 GGGAGGAGGCAGCAGGGGCAGGG - Intronic
968943588 4:3652110-3652132 GTGCAGAAGCACAAGGGGCAAGG - Intergenic
968963339 4:3756744-3756766 GGGAAAAGGCAGAAGGGGCCAGG + Intergenic
968991571 4:3916810-3916832 GTGAAGACTAAGGAGGGGCCGGG + Intergenic
969357570 4:6639424-6639446 TTAAAAAGGCAGAAAGGGCCAGG + Intergenic
969463892 4:7343518-7343540 GTGCAGAGGGAGCAGGTGCCAGG - Intronic
969571386 4:8010741-8010763 ATGGAGAGGCAGAGGGGGCAGGG + Intronic
970275202 4:14392171-14392193 CTGAAGAAGGAGCAGGGGCCAGG - Intergenic
970582202 4:17483680-17483702 ATGAAAAGGGAAAAGGGGCCAGG - Intronic
971421774 4:26480535-26480557 GTTAAGTGGCAGAAGGTGCATGG - Intergenic
972238180 4:37158364-37158386 GTCATGAGGCAGAAGGAGCAAGG + Intergenic
972600398 4:40566941-40566963 ATGAAGACACAGAATGGGCCGGG - Intronic
973535756 4:51880414-51880436 GTGGAGGGGCAGCGGGGGCCTGG + Intronic
973646585 4:52956493-52956515 GACAAGAGACAGAAAGGGCCTGG - Intronic
973899186 4:55450136-55450158 GAGAAGAGGCAGAAGGGGTTGGG + Exonic
974091505 4:57316026-57316048 CTGTAGAGGTAGATGGGGCCAGG + Intergenic
974188028 4:58465337-58465359 GTGAGGAGGCAGCTGAGGCCTGG - Intergenic
975633136 4:76421451-76421473 GAGAAGCGGCAGAGGGCGCCGGG - Intronic
976087724 4:81423240-81423262 TTAAAGAGGAGGAAGGGGCCGGG - Intergenic
978069081 4:104444005-104444027 GTGGAGAGATAGAAGGGGCAAGG - Intergenic
978185996 4:105857869-105857891 GTGAGGAGGCACAAGGGTCAGGG + Intronic
978467839 4:109028429-109028451 ATGAAGAAGAAAAAGGGGCCAGG + Intronic
982497572 4:156110029-156110051 GTGAGGAGGCAGAAGGAGTTGGG + Intergenic
983763229 4:171440437-171440459 GTGTAGGGGCAGAAGGGGGATGG - Intergenic
985786882 5:1900610-1900632 GTGGAGAGGCAGGGAGGGCCAGG - Intergenic
986269755 5:6220392-6220414 GGGAAGAGGCAGGAGTGGCTGGG - Intergenic
986691399 5:10316625-10316647 GTCAAGAAGCAGAAGGAGCAGGG - Intergenic
988263791 5:28926435-28926457 GTGAAGGCCAAGAAGGGGCCGGG + Intergenic
988491362 5:31708188-31708210 GGGAAGGGCCAGAAAGGGCCAGG - Intronic
989285631 5:39696220-39696242 GTGAGTAGGCAGCAGAGGCCAGG - Intergenic
989433158 5:41379178-41379200 GGGAAAAGGCAGCAGGAGCCTGG - Intronic
990597900 5:57329633-57329655 GGGAAGAAGGAGAAGGGGCGAGG + Intergenic
992032695 5:72738704-72738726 GTGAAGAGGCAGATGGGATTGGG - Intergenic
992162592 5:74017227-74017249 GGGAGGAGTCAGAGGGGGCCAGG + Intergenic
992676819 5:79112952-79112974 GTAGGGAGGCAGATGGGGCCAGG + Intronic
992937160 5:81719721-81719743 GTCAGGAGGCAGAAGGAGACAGG + Intronic
994082039 5:95717715-95717737 GAGAAGAGGAAGAACGGGCCTGG + Intronic
994111282 5:96007608-96007630 AAGAAGAGGAAGATGGGGCCGGG + Intergenic
995386545 5:111595794-111595816 GGGATGAGGCAGCAGGGGGCTGG - Intergenic
995400024 5:111730588-111730610 GTGAAAAGGCAGGAGTGGACCGG + Exonic
995518933 5:112982061-112982083 AAGAATAGCCAGAAGGGGCCTGG - Intronic
995919622 5:117295789-117295811 GTGAATAGGGAGGAGGGGTCAGG - Intergenic
996597426 5:125221748-125221770 GTGACAAGGCAGAGGGGGTCGGG - Intergenic
997512899 5:134465581-134465603 GGGAAGGGGCAGGAGGGGTCTGG + Intergenic
997893963 5:137699353-137699375 CTGGAGAGGTAGATGGGGCCAGG + Intronic
998946255 5:147342510-147342532 GTGAGGAGGCAAAAGGAGACAGG + Intronic
999143364 5:149377279-149377301 GTGAAGAGGCAGAATGCTGCAGG - Intronic
999205387 5:149844352-149844374 TTAAAGAGGAAGAAGGGTCCGGG + Intronic
999301104 5:150490961-150490983 TTGTAGAGGTAGGAGGGGCCAGG - Intronic
999978261 5:156933853-156933875 GTAAAGGGCCAGAAAGGGCCGGG - Intronic
1000290659 5:159867498-159867520 GTGAAGAGGAAGAAAGGGAGAGG - Intergenic
1001180337 5:169514237-169514259 GTGATGAGGCATTTGGGGCCTGG + Intergenic
1001593806 5:172885043-172885065 GTGAGGAGGCAGCAGTGGCTCGG - Intronic
1001600681 5:172926345-172926367 AGCAAGAGGCAGCAGGGGCCTGG - Intronic
1002449761 5:179311980-179312002 GGGAGGAGGGAGAAGGGGCATGG + Intronic
1002623085 5:180503898-180503920 GTTAAGAAGAAAAAGGGGCCAGG - Intronic
1002703067 5:181140955-181140977 GTAAGGAGGCAGCTGGGGCCTGG - Intergenic
1002815333 6:675062-675084 GTCAGGAGGCAGAGGGAGCCAGG - Intronic
1002917833 6:1543051-1543073 TCGGAAAGGCAGAAGGGGCCTGG + Intergenic
1003170547 6:3718683-3718705 GTCAGGAGGCAGAAGGAGCAGGG - Intergenic
1004277893 6:14254258-14254280 GTAAAGAGTCAGACAGGGCCGGG - Intergenic
1004629499 6:17407845-17407867 ATGAAGAAGCAAAAGGGGGCTGG + Intronic
1004784741 6:18955121-18955143 ATGAAGAAGGAGAAGGGGCTGGG - Intergenic
1004984079 6:21059917-21059939 GTGAAGACTCAGAAGGGGGAGGG - Intronic
1006034546 6:31201334-31201356 GTGCAGAGCCAGAAGCAGCCAGG - Intronic
1006372172 6:33651952-33651974 GAGAAAAGGCAGAAAGGGACAGG - Intronic
1006656892 6:35602984-35603006 TTGAAGTGGCAGAATGGGACTGG - Intronic
1006730926 6:36235706-36235728 GTGATGAGGAAGAAGGGCCAGGG + Intergenic
1006803591 6:36774747-36774769 GTGAAGAGGCAGACATTGCCGGG + Intronic
1007313904 6:40968996-40969018 GTGAACAGGGAGAAGAGCCCAGG - Intergenic
1007389127 6:41540047-41540069 GGAAAGAGGCAGAAGTGGGCTGG + Intergenic
1007649891 6:43412858-43412880 GGGACGAGGCAGCAGGGGGCTGG - Intergenic
1007702788 6:43774255-43774277 GTGAGGAGGGAGGAGGGGCTGGG + Intronic
1008493277 6:52107546-52107568 GTGGAGAGGTAGAAAGAGCCTGG + Intergenic
1008879911 6:56371526-56371548 GTGAACAGGCAGAAGAGGAAAGG - Intronic
1010579325 6:77574737-77574759 GTGAAGAGGCAGAAAGACACAGG + Intergenic
1011664580 6:89622120-89622142 GAGGAGAGGCAGAGAGGGCCGGG - Intronic
1012454108 6:99385670-99385692 TTGAAAAGGAAGAAAGGGCCAGG + Intronic
1012550731 6:100463247-100463269 TTTCAAAGGCAGAAGGGGCCGGG - Intronic
1013180415 6:107712561-107712583 GAGCAGAGGCAGCAGGGGCCTGG + Intronic
1013599541 6:111691586-111691608 TTTACGAGGCAGAAAGGGCCTGG - Intronic
1015494794 6:133869233-133869255 CTCATGAGGCAGAAGGGGCAAGG - Intergenic
1015732198 6:136360754-136360776 GTGAAGAAGCAGAGAGGGTCCGG - Exonic
1015969355 6:138728728-138728750 GGGAAGGGGCAGGAGGAGCCTGG + Intergenic
1017166320 6:151411486-151411508 CAGTAGAGGCAGAAGGGGCTTGG + Intronic
1017953943 6:159162547-159162569 GTGGAAAGGCAGAAAGGGACGGG + Intergenic
1018444185 6:163840257-163840279 GTGAAAAAGCAGAAGGGTCCTGG + Intergenic
1018931234 6:168241724-168241746 GTGCAAAAGCAGAAGGTGCCAGG + Intergenic
1019017139 6:168888134-168888156 GTGACGATGGGGAAGGGGCCGGG + Intergenic
1019575234 7:1734552-1734574 GGGAGGAGGCAGAGGGGACCAGG + Intronic
1019979643 7:4612015-4612037 GAAAAGAGACACAAGGGGCCAGG + Intergenic
1020140762 7:5610479-5610501 GTGAAGATGGAAAGGGGGCCCGG + Intergenic
1020354311 7:7260203-7260225 GTGATGATGGAGAAGGGGGCCGG - Intergenic
1021981927 7:26063836-26063858 GAAAAGAGGCTGAAGAGGCCGGG + Intergenic
1022395772 7:29987144-29987166 GTGCAGAGGGAGAAGGTGGCAGG - Intronic
1022969730 7:35505872-35505894 GTGAAGAGCCAGGAAAGGCCTGG + Intergenic
1025990986 7:66496709-66496731 TTTAAGAAGCAGAAGTGGCCGGG + Intergenic
1026198947 7:68197502-68197524 GTGAAGGGGAAGGAGGAGCCAGG - Intergenic
1026890584 7:73979429-73979451 GTCAAGAGGCAGAAGCAGGCAGG + Intergenic
1026902057 7:74042922-74042944 GTGGGGAGGCAGAAGGGCCCGGG - Intronic
1026906507 7:74065919-74065941 GAGAAGAGGCAGGTGGGGTCAGG - Intronic
1026952393 7:74356330-74356352 CTGAAGAGGCAGAGGAGGCAGGG + Intronic
1027055158 7:75044656-75044678 GTTCAGAGGCAGATGGGGACTGG - Intronic
1027257449 7:76440140-76440162 TTAAAGAGTGAGAAGGGGCCGGG - Intronic
1027269600 7:76512458-76512480 GTGAGAGGGCAGAAGGGGGCTGG - Intronic
1027281398 7:76611901-76611923 TTAAAGAGTGAGAAGGGGCCGGG + Intronic
1027320310 7:77006352-77006374 GTGAGAGGGCAGAAGGGGGCTGG - Intergenic
1029539430 7:101174023-101174045 CTCAAGAGGTGGAAGGGGCCGGG - Intronic
1029627889 7:101731770-101731792 GTGAAGAGGCTGAAGGGCAGTGG - Intergenic
1029704403 7:102268467-102268489 GAGAAGAGGCAGCAGGAGGCAGG - Intronic
1029858725 7:103545929-103545951 TTAAATAGACAGAAGGGGCCGGG - Intronic
1030597400 7:111556514-111556536 GAGATGAGGCTGAAGGGGGCTGG - Intronic
1031031016 7:116735269-116735291 GTTAAGAGGCAGAAGAGAACAGG - Intronic
1031214811 7:118877133-118877155 GGGAAGAGGAAGAAGGGGAAGGG + Intergenic
1031327587 7:120421384-120421406 GTGAAAATGCAGAAGTGTCCTGG - Intronic
1031859035 7:126957647-126957669 GGGCTGAGGCAGCAGGGGCCTGG - Intronic
1032906845 7:136377957-136377979 GTGCTGAGGAAGATGGGGCCAGG - Intergenic
1033355706 7:140597772-140597794 AGGAAGAGCCAGAAGGGGCGTGG + Intronic
1034306487 7:150048440-150048462 GTGAAGAGGGTGGAGGGGCGGGG + Intergenic
1034441013 7:151086228-151086250 GTGAGGAGGCGGAAGGGCCGAGG + Intronic
1034545674 7:151787086-151787108 TTCAAGAGGAAGAAGGGGCAGGG - Intronic
1034728884 7:153366050-153366072 CTGAAGCAGCACAAGGGGCCTGG + Intergenic
1034800360 7:154052203-154052225 GTGAAGAGGGTGGAGGGGCTGGG - Intronic
1035205743 7:157292902-157292924 GTGAAGGGGCAGACAGGGCGCGG + Intergenic
1035317816 7:158007616-158007638 ATGAAGACACAGAAGGGGACAGG + Intronic
1035458936 7:159027503-159027525 GGGAAGGGGGAGAAGGGGCTGGG - Intergenic
1035773897 8:2172531-2172553 CTTAAGAAGCAGAAGCGGCCAGG - Intergenic
1035976856 8:4322698-4322720 TTGAAAATGCAGTAGGGGCCAGG + Intronic
1036632583 8:10525744-10525766 GTACAGGGGCAGAAGGGGCATGG + Intronic
1036751564 8:11446818-11446840 GCAAAGAGGCAGACGGCGCCTGG - Intronic
1037728743 8:21505973-21505995 ATGAAGAGCCAGGAGTGGCCTGG + Intergenic
1037843547 8:22262868-22262890 TTGAAGAGGCAAATGGGGCCGGG - Intergenic
1037939978 8:22944035-22944057 GTCAGGAGGCAGGAGGAGCCGGG - Intronic
1037994743 8:23343853-23343875 GGGAAGAGACAGAAGAGGGCCGG - Intronic
1038280674 8:26161405-26161427 GGAGAGAGGCAGAAGGTGCCAGG - Intergenic
1038483738 8:27919151-27919173 GGGAAGAGGAAGAAGGGGATGGG + Intronic
1039380443 8:37079941-37079963 CTGAAGAGTCAGAATGGGGCGGG + Intergenic
1039406698 8:37319018-37319040 GGGATGAGGAAGAAGGGGCAGGG - Intergenic
1040350268 8:46559531-46559553 GAAAAGAGGCTGAAGGAGCCAGG + Intergenic
1040387095 8:46921037-46921059 GGGGAGAGGCACAGGGGGCCAGG + Intergenic
1041176586 8:55203275-55203297 GTGAAGATGCAGTTGGGGACTGG - Intronic
1041452008 8:58015548-58015570 TTGAAAAGGCATGAGGGGCCGGG + Intronic
1041558116 8:59182733-59182755 GCTAAGAGGCAGAAGCTGCCAGG + Intergenic
1042590833 8:70397161-70397183 GTCAAGAGCAAGAATGGGCCAGG + Intronic
1042688254 8:71465325-71465347 GTTAAAAGGAAGAAGAGGCCGGG + Intronic
1043380293 8:79695290-79695312 ATGAAGAGGCAGAAGGACTCAGG + Intergenic
1043684170 8:83066864-83066886 GTGCAAAGACTGAAGGGGCCTGG + Intergenic
1046584049 8:116129678-116129700 GAGAAGAGGGAGAAGGGGCTGGG + Intergenic
1047501315 8:125443930-125443952 GTGATGAGGCTGATGGGGCCAGG + Intergenic
1047510639 8:125512938-125512960 GTAAAAAGGAAGAAGGGGACAGG - Intergenic
1048972124 8:139651034-139651056 GGGAAGAAGCAGAAGGGGGTGGG - Intronic
1049253929 8:141604045-141604067 GGGCAGAGGCTCAAGGGGCCTGG + Intergenic
1049268372 8:141681463-141681485 GTGATGGGGGAGGAGGGGCCAGG + Intergenic
1049269658 8:141687563-141687585 ATGAGGAGGCAGGAGGGGCAGGG + Intergenic
1049437027 8:142591318-142591340 GCGATGAGGAAGAAGGGGCGTGG + Intergenic
1049584188 8:143425418-143425440 AGGGAGAGGCTGAAGGGGCCGGG - Intronic
1049642364 8:143721450-143721472 CAGCACAGGCAGAAGGGGCCCGG - Intronic
1049728534 8:144163315-144163337 GTGAAGAGGCAGAGGGAACTTGG + Intronic
1049764963 8:144350895-144350917 TTGAAAAGGCAGAAAGGCCCTGG - Intergenic
1050108591 9:2191476-2191498 GCGAAAAGGCTGAAGGGGCATGG - Intronic
1050176849 9:2877095-2877117 ATGAGGAGGCAGAAGAGACCTGG - Intergenic
1050498397 9:6268207-6268229 TAGAAGTGGCAGGAGGGGCCCGG + Intergenic
1051031716 9:12688493-12688515 ATGAAGAGGTAGAAGGGGTCAGG + Intronic
1051215247 9:14790808-14790830 GTGAAAATGCAGATGGGTCCAGG - Intronic
1053294077 9:36900791-36900813 GTGCAGAGGCAGTGGGGGCGGGG - Intronic
1053316713 9:37058379-37058401 GAGAAGAGGCTGAAGAGACCAGG - Intergenic
1054927255 9:70601464-70601486 GTGAAGAGGCAGGAAGGGCATGG + Intronic
1055205302 9:73722683-73722705 GTGAAAAGGCTGATGGGTCCAGG - Intergenic
1055478266 9:76685045-76685067 AATAAGAGGCAGAAGTGGCCGGG - Intronic
1056152040 9:83800629-83800651 GTAAGGAGGCAGTGGGGGCCGGG - Intronic
1056199225 9:84258341-84258363 GGGAAGGGGCAGAACTGGCCAGG + Intergenic
1057236584 9:93366258-93366280 GTGAAGCTGCAGCAGGGACCAGG + Intergenic
1057627017 9:96686867-96686889 GTGAAGAAGCGGAAAGGCCCGGG - Intergenic
1057643704 9:96853562-96853584 CTGACAATGCAGAAGGGGCCAGG + Intronic
1059330608 9:113533167-113533189 GTGAAGAGGCAGGAAGGGCATGG - Intronic
1060410675 9:123398190-123398212 GGGAAGTGGCAGTAGGGGCTGGG - Intronic
1060785954 9:126451705-126451727 GAGAGGAGGCACAAGGGTCCTGG + Intronic
1061161543 9:128898405-128898427 GTAAAGAGACAGGCGGGGCCTGG - Intronic
1061493996 9:130961351-130961373 GTCCTGAGGCAGAAGGGGGCCGG + Intergenic
1061562701 9:131416400-131416422 TAGAAGAGGTAGAAGAGGCCAGG - Intronic
1061614925 9:131773330-131773352 GTCAAGAGGCAGAGGGAGCCAGG - Intergenic
1061625570 9:131838942-131838964 GTGGAGAGGGAGAGGGGGCTGGG + Intergenic
1061720666 9:132549186-132549208 GTGGAGAGGCAGAGGCGGCAGGG - Intronic
1061772029 9:132932657-132932679 ATGAAGAGGCAGAGGGGGGTTGG - Intronic
1062452829 9:136622699-136622721 GTGATGAGGCAGAAGAGGCAGGG - Intergenic
1062513866 9:136922574-136922596 GAGGACAGGCAGAATGGGCCTGG + Intronic
1062545123 9:137058995-137059017 GGGAAGAGGCAGCAGGTGGCAGG - Intergenic
1185586611 X:1245949-1245971 TCTAAGAGACAGAAGGGGCCGGG + Intergenic
1186085680 X:5988118-5988140 GAGAAGTTGCAGAAGGGGCTGGG - Intronic
1186815005 X:13227647-13227669 GTGAAGAGGGAGAAAATGCCAGG - Intergenic
1186966617 X:14793837-14793859 GTCAGGAGTCAGAAGGGGCATGG + Intergenic
1187764867 X:22630369-22630391 GTGAAGAGGCAGGCGGGGATAGG + Intergenic
1188642670 X:32525395-32525417 GTGAAGAGGAAGCAGAGGCAGGG + Intronic
1189647424 X:43148801-43148823 AAAAAGAGGCAGCAGGGGCCAGG - Intergenic
1189943732 X:46155261-46155283 GTGAAGTGGCAGAAGAGGATGGG + Intergenic
1190369438 X:49727093-49727115 GGGCAGAGGCAGCAGGGGGCTGG - Intergenic
1190929245 X:54934268-54934290 GTGAAGAGGTGGAAGAGTCCTGG + Intronic
1192735035 X:73842788-73842810 GCAAAGAGGCAAAAGGGGCAGGG + Intergenic
1192948480 X:75990739-75990761 GTGAAAAAGCTGAAGGGGGCAGG + Intergenic
1193490474 X:82143146-82143168 GGGAAGAGTGAGAAGGGGACTGG - Intergenic
1194155169 X:90379325-90379347 GTGAAGAGCCCTAAGAGGCCAGG + Intergenic
1194225407 X:91250464-91250486 GTAAAGAATCAGAGGGGGCCGGG - Intergenic
1195107803 X:101617386-101617408 GTGTGGAGAAAGAAGGGGCCAGG + Intronic
1195954890 X:110318200-110318222 GTGGCTAGGCAGACGGGGCCGGG - Exonic
1197432047 X:126378021-126378043 GGGAATAGGCAGAATGAGCCTGG + Intergenic
1198440626 X:136659798-136659820 GTGAAGATGCAGAAGGGAAATGG + Exonic
1199945788 X:152665965-152665987 GAGAAGACTCAGTAGGGGCCTGG + Intergenic
1199966786 X:152826817-152826839 GTGGGGAGGCAGAAGGGGTGAGG - Intergenic
1200324052 X:155218871-155218893 GTTAAGAGACAGGAGGTGCCTGG - Intronic
1200501520 Y:3956261-3956283 GTGAAGAGCCCTAAGAGGCCAGG + Intergenic
1200561944 Y:4715373-4715395 GTAAAGAATCAGAGGGGGCCGGG - Intergenic
1201268969 Y:12236000-12236022 GTCAAGACTTAGAAGGGGCCGGG - Intergenic
1201748972 Y:17411956-17411978 AGGAAGAGGTAGAAGTGGCCAGG - Intergenic
1202058227 Y:20857987-20858009 GTGAGGAAGCACAAGGGGTCAGG - Intergenic