ID: 1126760442

View in Genome Browser
Species Human (GRCh38)
Location 15:51965128-51965150
Sequence GGGGGCAAATCTAGCGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 52}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126760442_1126760447 -9 Left 1126760442 15:51965128-51965150 CCATCCACGCTAGATTTGCCCCC 0: 1
1: 0
2: 0
3: 3
4: 52
Right 1126760447 15:51965142-51965164 TTTGCCCCCGGGGAAACATATGG 0: 1
1: 0
2: 1
3: 13
4: 130
1126760442_1126760449 -7 Left 1126760442 15:51965128-51965150 CCATCCACGCTAGATTTGCCCCC 0: 1
1: 0
2: 0
3: 3
4: 52
Right 1126760449 15:51965144-51965166 TGCCCCCGGGGAAACATATGGGG 0: 1
1: 0
2: 0
3: 5
4: 61
1126760442_1126760454 1 Left 1126760442 15:51965128-51965150 CCATCCACGCTAGATTTGCCCCC 0: 1
1: 0
2: 0
3: 3
4: 52
Right 1126760454 15:51965152-51965174 GGGAAACATATGGGGTGATAAGG 0: 1
1: 0
2: 0
3: 9
4: 154
1126760442_1126760448 -8 Left 1126760442 15:51965128-51965150 CCATCCACGCTAGATTTGCCCCC 0: 1
1: 0
2: 0
3: 3
4: 52
Right 1126760448 15:51965143-51965165 TTGCCCCCGGGGAAACATATGGG 0: 1
1: 0
2: 0
3: 2
4: 44
1126760442_1126760455 2 Left 1126760442 15:51965128-51965150 CCATCCACGCTAGATTTGCCCCC 0: 1
1: 0
2: 0
3: 3
4: 52
Right 1126760455 15:51965153-51965175 GGAAACATATGGGGTGATAAGGG 0: 1
1: 0
2: 1
3: 15
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126760442 Original CRISPR GGGGGCAAATCTAGCGTGGA TGG (reversed) Intronic
918462976 1:184795257-184795279 GGGGGCAAGTGTACCGAGGAAGG - Exonic
1072475776 10:95758492-95758514 GGGGGCTAATCTAGACTTGAAGG - Intronic
1072779934 10:98242508-98242530 GGAGGCAAATCTAACTTGAAAGG - Intronic
1081751640 11:45515352-45515374 GGTGGCAAATGGAGCCTGGAAGG + Intergenic
1085821685 11:79800763-79800785 TGGGGGAAATCTAGGGAGGAGGG - Intergenic
1087735474 11:101827825-101827847 GGCTGCAATTCTAGCCTGGAGGG - Intronic
1093484644 12:19640147-19640169 GGGCCCAAATGTAGTGTGGAAGG - Intronic
1097041556 12:56158889-56158911 GGGATCAGATCTAGAGTGGAAGG - Intronic
1103844553 12:123892417-123892439 GGGGGCAGATCTCTCATGGATGG - Intronic
1107359239 13:39602264-39602286 GGGTGGAATTCTAGGGTGGATGG - Intronic
1116217179 14:42031840-42031862 GTGGGAAAATCTAGCATGTATGG + Intergenic
1124338007 15:28871646-28871668 TGGGGAAAATCTAGCTTGGGAGG + Intergenic
1124486560 15:30122375-30122397 GGGGGCCTATTTAGGGTGGAGGG - Intergenic
1124541635 15:30591354-30591376 GGGGGCCTATTTAGGGTGGAGGG - Intergenic
1124548300 15:30653155-30653177 GGGGGCCTATTTAGGGTGGAGGG - Intronic
1124757024 15:32416231-32416253 GGGGGCCTATTTAGGGTGGAGGG + Intergenic
1126760442 15:51965128-51965150 GGGGGCAAATCTAGCGTGGATGG - Intronic
1128747751 15:70126460-70126482 GGGGGCAAAGCTGGGGTGGTGGG - Intergenic
1129880819 15:79005069-79005091 GGGGGTAAATCCATCCTGGATGG + Intronic
1135857631 16:26026502-26026524 TGGGGCAAAGCTAGCCTGCATGG - Intronic
1137922287 16:52502251-52502273 GGAGGAAAATCTAACATGGATGG + Intronic
1151069199 17:71188921-71188943 GAGGGCAAATCTAGCCTGTGCGG - Intergenic
1155081172 18:22411350-22411372 GGGGGAAAATCTAGAATGGTAGG - Intergenic
1160810484 19:1010978-1011000 GCGGGCAGAGGTAGCGTGGATGG - Intronic
1167475655 19:49699494-49699516 GGGGGTAAATCTAGCGTTCCAGG - Intronic
1168362665 19:55755441-55755463 GGGGGCAACTCGAGGGTAGAGGG - Intergenic
924966476 2:81093-81115 GGGGTCAAAGCCAGAGTGGAGGG + Intergenic
931382755 2:61768505-61768527 GGGGGCAGATCTCTCGTGAATGG - Intergenic
945052844 2:205841903-205841925 GGGGGCAAATCTTTCATGAATGG - Intergenic
947569020 2:231216465-231216487 AGGGGGAAATTTAGGGTGGATGG + Intronic
1168829810 20:839685-839707 GGGGGCAGATGTAGGGTGGCAGG + Intronic
1169216460 20:3797137-3797159 GGGGGCAGAACTGGGGTGGAGGG - Intronic
1174601215 20:51726519-51726541 GGGGTAAAATCTAACATGGAGGG + Intronic
1179607573 21:42527231-42527253 TGGGGCAGATGTAGCGTGTAAGG + Intronic
966452846 3:180081788-180081810 GGGGGCAAATCTCTCATGAATGG - Intergenic
976304688 4:83548104-83548126 GGGGACAAAACTAGGGTAGAAGG - Intronic
977518789 4:98055700-98055722 GGGAGCAAATCAAGCCTAGAGGG - Intronic
983420250 4:167507327-167507349 GGGAGCAAATCTAGCCTAGAGGG + Intergenic
983757986 4:171365726-171365748 GGGGGCAGTGCTAGTGTGGATGG + Intergenic
992850717 5:80804824-80804846 GGTGGCAAATCCAGCCTGAAGGG + Intronic
1004571551 6:16850551-16850573 GGGGGCAGATGGAGGGTGGAGGG - Intergenic
1004732855 6:18375347-18375369 GAGGGGAAATCTAGGTTGGATGG - Intergenic
1011017469 6:82772984-82773006 GGGGGCAGATTTAGCGGTGAGGG - Intergenic
1017935871 6:159004411-159004433 TGGGGCACATCAAGCTTGGAAGG + Intergenic
1026105233 7:67415643-67415665 GGGGCCTACTCTAGGGTGGAGGG - Intergenic
1031923719 7:127619586-127619608 AGGGGCAGATCTAGCGGGGAGGG - Intergenic
1032036080 7:128522413-128522435 GCGAGCAAATATAGCGTGAAAGG + Intergenic
1032607404 7:133370394-133370416 TGGGGCAAGTCAAGCGAGGAGGG + Intronic
1039257385 8:35734254-35734276 GAGGCCACATCTAGCATGGATGG - Intronic
1056226512 9:84500875-84500897 GGAGGCAACTCCAGAGTGGATGG + Intergenic
1059359971 9:113734553-113734575 GGGGCCAAGTCTAGGGTGGAAGG - Intergenic
1061449418 9:130660416-130660438 GGGGGAAAATCCACCCTGGAGGG - Intergenic
1061824109 9:133247202-133247224 TGGGGCAAACCTAGTGTGGGTGG + Intergenic
1189040521 X:37537838-37537860 GGGAGCAAATCTAGCCTAGGGGG + Intronic
1189746830 X:44177166-44177188 GGGGGCAACACCAGGGTGGAAGG + Intronic
1199226381 X:145379758-145379780 GGGGCCAACTCAAGGGTGGAGGG - Intergenic