ID: 1126761168

View in Genome Browser
Species Human (GRCh38)
Location 15:51971519-51971541
Sequence TCCTCCTCCGGCGGGCAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 141}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126761168_1126761179 1 Left 1126761168 15:51971519-51971541 CCATCCTGCCCGCCGGAGGAGGA 0: 1
1: 0
2: 0
3: 13
4: 141
Right 1126761179 15:51971543-51971565 GGCACCTCCGGGAGTGCAGGGGG 0: 1
1: 1
2: 1
3: 14
4: 204
1126761168_1126761184 18 Left 1126761168 15:51971519-51971541 CCATCCTGCCCGCCGGAGGAGGA 0: 1
1: 0
2: 0
3: 13
4: 141
Right 1126761184 15:51971560-51971582 AGGGGGCGCTGAGGCAGGAGTGG 0: 1
1: 0
2: 7
3: 110
4: 1015
1126761168_1126761185 21 Left 1126761168 15:51971519-51971541 CCATCCTGCCCGCCGGAGGAGGA 0: 1
1: 0
2: 0
3: 13
4: 141
Right 1126761185 15:51971563-51971585 GGGCGCTGAGGCAGGAGTGGAGG 0: 1
1: 0
2: 8
3: 98
4: 869
1126761168_1126761177 -1 Left 1126761168 15:51971519-51971541 CCATCCTGCCCGCCGGAGGAGGA 0: 1
1: 0
2: 0
3: 13
4: 141
Right 1126761177 15:51971541-51971563 ATGGCACCTCCGGGAGTGCAGGG 0: 1
1: 0
2: 0
3: 11
4: 120
1126761168_1126761175 -10 Left 1126761168 15:51971519-51971541 CCATCCTGCCCGCCGGAGGAGGA 0: 1
1: 0
2: 0
3: 13
4: 141
Right 1126761175 15:51971532-51971554 CGGAGGAGGATGGCACCTCCGGG 0: 1
1: 0
2: 2
3: 14
4: 163
1126761168_1126761183 13 Left 1126761168 15:51971519-51971541 CCATCCTGCCCGCCGGAGGAGGA 0: 1
1: 0
2: 0
3: 13
4: 141
Right 1126761183 15:51971555-51971577 AGTGCAGGGGGCGCTGAGGCAGG 0: 1
1: 0
2: 2
3: 59
4: 574
1126761168_1126761182 9 Left 1126761168 15:51971519-51971541 CCATCCTGCCCGCCGGAGGAGGA 0: 1
1: 0
2: 0
3: 13
4: 141
Right 1126761182 15:51971551-51971573 CGGGAGTGCAGGGGGCGCTGAGG 0: 1
1: 0
2: 0
3: 52
4: 453
1126761168_1126761176 -2 Left 1126761168 15:51971519-51971541 CCATCCTGCCCGCCGGAGGAGGA 0: 1
1: 0
2: 0
3: 13
4: 141
Right 1126761176 15:51971540-51971562 GATGGCACCTCCGGGAGTGCAGG 0: 1
1: 0
2: 0
3: 11
4: 118
1126761168_1126761178 0 Left 1126761168 15:51971519-51971541 CCATCCTGCCCGCCGGAGGAGGA 0: 1
1: 0
2: 0
3: 13
4: 141
Right 1126761178 15:51971542-51971564 TGGCACCTCCGGGAGTGCAGGGG 0: 1
1: 0
2: 1
3: 26
4: 685

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126761168 Original CRISPR TCCTCCTCCGGCGGGCAGGA TGG (reversed) Intronic