ID: 1126762413

View in Genome Browser
Species Human (GRCh38)
Location 15:51981181-51981203
Sequence TCAGACTTATCGGCCGGGTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 279}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126762408_1126762413 -1 Left 1126762408 15:51981159-51981181 CCAATATGCTTCCTATGAAAATT 0: 1
1: 0
2: 1
3: 40
4: 325
Right 1126762413 15:51981181-51981203 TCAGACTTATCGGCCGGGTGCGG 0: 1
1: 0
2: 0
3: 32
4: 279

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126762413 Original CRISPR TCAGACTTATCGGCCGGGTG CGG Intronic
901487089 1:9571565-9571587 AGAGCCTTCTCGGCCGGGTGGGG - Intronic
902234681 1:15049731-15049753 TCAGAACTATAGGCCAGGTGTGG + Intronic
902441894 1:16435960-16435982 TCCCATTTATCGGCCTGGTGCGG + Intronic
903531531 1:24034104-24034126 TAAGACTTATGGGCCGGGATCGG - Intergenic
903636678 1:24823482-24823504 TGAGACATACAGGCCGGGTGTGG + Intronic
903713654 1:25346076-25346098 GAAAACATATCGGCCGGGTGTGG - Intronic
905378994 1:37546381-37546403 TAAGCCATAACGGCCGGGTGTGG + Intronic
907155418 1:52329613-52329635 TCTTACATATCGGCCGGGCGCGG + Intronic
909056738 1:70829872-70829894 TCAGAGTTATCAGCCTGGAGGGG - Intergenic
909584177 1:77270647-77270669 TCTGACATCTCTGCCGGGTGCGG - Intergenic
909853199 1:80495579-80495601 GCAGATTTTTGGGCCGGGTGCGG - Intergenic
910231274 1:84990004-84990026 TCAAACTTCTGGGCCGGGCGTGG + Intronic
911133875 1:94418654-94418676 AGAGACCTGTCGGCCGGGTGGGG - Intronic
911249245 1:95556603-95556625 TAAGATTTATGGGCTGGGTGTGG - Intergenic
912349298 1:108996825-108996847 TTAGACTCATGGGCCAGGTGCGG + Intronic
913060867 1:115206175-115206197 TAAAAATTATTGGCCGGGTGCGG - Intergenic
916803260 1:168233991-168234013 GAAGACTTATTGGCCGGGTGTGG + Intronic
917564846 1:176203045-176203067 TCAACCTTCTCGGCCGGGCGCGG + Intronic
919485848 1:198146273-198146295 TAAGATATATAGGCCGGGTGCGG - Intergenic
919900132 1:202038064-202038086 TCACACTTATCTGACTGGTGTGG - Intergenic
920242634 1:204564427-204564449 ACAGAGTGATAGGCCGGGTGCGG + Intergenic
920780694 1:208988281-208988303 GCTGACTTAGAGGCCGGGTGCGG - Intergenic
921644297 1:217595788-217595810 TAAGAAGGATCGGCCGGGTGCGG - Intronic
922040704 1:221893596-221893618 ACAAACTTATAGGCTGGGTGCGG + Intergenic
922402332 1:225273140-225273162 TAAAAATTATTGGCCGGGTGTGG + Intronic
923178446 1:231492580-231492602 TAAGATTTCTCGGCCGGGCGCGG + Intergenic
1064852907 10:19730025-19730047 ATAGACTTATAGGCCGGGCGTGG - Intronic
1065231294 10:23601226-23601248 TAAGAATCAACGGCCGGGTGAGG - Intergenic
1065291461 10:24234371-24234393 ACATATATATCGGCCGGGTGCGG + Intronic
1065922095 10:30401901-30401923 GCAGAATATTCGGCCGGGTGCGG + Intergenic
1066085964 10:31972167-31972189 TCAAACTTTTAGGCTGGGTGTGG + Intergenic
1068508960 10:57939146-57939168 TCAGCCTTTTTGGCTGGGTGCGG + Intergenic
1072112136 10:92332872-92332894 TCACATTTGTTGGCCGGGTGCGG + Intronic
1072212993 10:93263982-93264004 TCAGACTCAGGGGCTGGGTGCGG - Intergenic
1073031686 10:100531079-100531101 TCACCCTTTTAGGCCGGGTGCGG + Intronic
1073050852 10:100666342-100666364 ACATACTTATTGGCCAGGTGCGG + Intergenic
1074156084 10:110801136-110801158 TTAGAGTTTTCGGCCGGGCGTGG + Intronic
1074449625 10:113548688-113548710 TCAGACTTTTTTGCGGGGTGAGG - Intergenic
1075744990 10:124720907-124720929 TCAGAAATCTGGGCCGGGTGCGG + Intronic
1076083590 10:127605816-127605838 TAAGAATTGTGGGCCGGGTGCGG + Intergenic
1077203072 11:1323087-1323109 AAAAACTAATCGGCCGGGTGCGG + Intergenic
1077212474 11:1378170-1378192 AAAGAGTTATAGGCCGGGTGCGG + Intergenic
1077293009 11:1808357-1808379 TAAAATTTATTGGCCGGGTGCGG + Intergenic
1079149102 11:17882123-17882145 TAAGACTGCTCAGCCGGGTGTGG + Intronic
1080358874 11:31489185-31489207 TAAAACTTTTTGGCCGGGTGCGG - Intronic
1081015786 11:37878302-37878324 TAAAATGTATCGGCCGGGTGCGG + Intergenic
1081800602 11:45856504-45856526 TCAGCCTTTTCTGCCGGGCGAGG + Intronic
1083339227 11:61947953-61947975 ACATACTTATTGGCCGAGTGTGG + Intergenic
1083905763 11:65669123-65669145 ACAGACATATAGGCCGGGCGTGG + Intergenic
1084100286 11:66943446-66943468 ATAAACTTCTCGGCCGGGTGCGG + Intronic
1084161364 11:67352217-67352239 TAAGAATTATTGGCCGGGTGTGG + Intronic
1085648687 11:78246787-78246809 TATCACTTCTCGGCCGGGTGCGG - Intronic
1085668378 11:78437684-78437706 ACAAGTTTATCGGCCGGGTGTGG + Intronic
1086926353 11:92644482-92644504 TCAGAGTTATCGGGGGGGCGGGG - Intronic
1087077214 11:94136488-94136510 TGATACATATCGGCCGGGCGCGG + Intronic
1088025787 11:105180768-105180790 TCAGGATTGTCGGCCGGGCGCGG + Intergenic
1088195860 11:107272989-107273011 TAACAATTATGGGCCGGGTGCGG + Intergenic
1088219167 11:107549139-107549161 TCAGAATTTTAGGCTGGGTGCGG - Intronic
1088248103 11:107838917-107838939 AGAAACTTATCGGCCAGGTGTGG - Intronic
1088311055 11:108461013-108461035 GCAGACTTTTTGGCCGGGCGTGG - Intronic
1090789998 11:130083954-130083976 TCCGATTTCTCGGCCGGGCGCGG + Intronic
1091878020 12:3952629-3952651 AAAGAATTATCGGCCGGGCGCGG - Intergenic
1092133637 12:6130561-6130583 ACATGCTTGTCGGCCGGGTGCGG - Intergenic
1092266706 12:6986822-6986844 TTACACCTGTCGGCCGGGTGCGG + Intronic
1092457402 12:8656336-8656358 TCAGAATTATGGGCTGGGCGCGG - Intronic
1094708894 12:32941511-32941533 AAAGAATTATGGGCCGGGTGCGG - Intergenic
1096853204 12:54456793-54456815 TAATACTTAATGGCCGGGTGTGG + Intronic
1097085326 12:56463866-56463888 TAAGAATTATAGGCTGGGTGTGG + Intronic
1097543099 12:60964727-60964749 TAAGACGTTTCGGCCGGGCGCGG + Intergenic
1099532594 12:83803347-83803369 TAAGATTTATGGGCCGGGCGCGG + Intergenic
1100797420 12:98196982-98197004 TAAACCTTATCGGCCGGGTGTGG - Intergenic
1102165097 12:110799733-110799755 CAAGACTTATGGGCCGGGTGTGG - Intergenic
1104234904 12:126924562-126924584 TCAGTCTTCTCGGCCGGGCGCGG + Intergenic
1105378964 13:19869039-19869061 TAAGATTTATGGGCCGGGTGCGG - Intergenic
1107843332 13:44483369-44483391 CAAGAATTATGGGCCGGGTGCGG + Intronic
1112479709 13:99763841-99763863 TCACCATGATCGGCCGGGTGCGG - Intronic
1113071376 13:106424686-106424708 TCAGGCTTTGGGGCCGGGTGTGG + Intergenic
1113144080 13:107187444-107187466 GCAGAATTATCTGCAGGGTGAGG + Intronic
1113984563 13:114303493-114303515 GCAGAATTGTCGGCCCGGTGCGG + Intronic
1114130359 14:19784970-19784992 TAAGACTAATTGGCTGGGTGCGG + Intronic
1114843456 14:26292569-26292591 AAAGACATATGGGCCGGGTGTGG - Intergenic
1117028694 14:51648113-51648135 TCAGGCTTATTGGCTGGGCGCGG - Intronic
1117582746 14:57169275-57169297 TAAGACTTACAGGCTGGGTGTGG + Intergenic
1117826939 14:59713943-59713965 TTAGACTAATAGGCCGGGTGCGG + Intronic
1118027155 14:61781157-61781179 TAAGAATTGTTGGCCGGGTGCGG + Intronic
1119706543 14:76786450-76786472 GAAAACTTAGCGGCCGGGTGCGG - Intergenic
1120133612 14:80837426-80837448 TAAGCCTTATCGGCCGGGCGTGG + Intronic
1120302171 14:82721777-82721799 TCAGACATTTCGGCTGAGTGCGG + Intergenic
1121215829 14:92247154-92247176 TCAGCTTTCTTGGCCGGGTGTGG + Intergenic
1123737666 15:23200834-23200856 TAAGACTTTTTGGCCGGGCGCGG - Intergenic
1124474908 15:30024871-30024893 ATAGACTTATTGGCCAGGTGCGG + Intergenic
1125258919 15:37799721-37799743 TTAAACATATCGGCCGGGTGCGG - Intergenic
1125547366 15:40516121-40516143 AAAGACTTATTGGCCGGGTGGGG - Intergenic
1125970412 15:43906889-43906911 TGATGCTTCTCGGCCGGGTGCGG - Intronic
1126396072 15:48219252-48219274 GAAAACTTGTCGGCCGGGTGTGG + Intronic
1126483688 15:49155571-49155593 TCAGACATCTTGGCCGGGAGGGG + Exonic
1126598769 15:50407816-50407838 TCAGAGGGATCGGCCGGGCGCGG + Intergenic
1126762413 15:51981181-51981203 TCAGACTTATCGGCCGGGTGCGG + Intronic
1126963125 15:54020571-54020593 TAAGAAAAATCGGCCGGGTGTGG - Intronic
1128755005 15:70176885-70176907 GAAGACTTATGGGCCGGGTGTGG + Intergenic
1129611755 15:77065695-77065717 TAAAACTTATCAGCCAGGTGCGG - Intronic
1130089879 15:80811845-80811867 TCAGGCTTATGGGCTGGGTGTGG - Intronic
1130183481 15:81654179-81654201 CCAGACTTCTGGGCCGGGTGGGG - Intergenic
1133215148 16:4287799-4287821 TAACACATATAGGCCGGGTGCGG - Intergenic
1134449004 16:14352184-14352206 TTAGAGTTTTCGGCCGGGTGCGG + Intergenic
1136481932 16:30547522-30547544 ACAGACCTCTGGGCCGGGTGTGG + Intronic
1136543727 16:30943662-30943684 TAAGAATTACAGGCCGGGTGCGG - Intronic
1137448716 16:48550611-48550633 GCAGGCTTATAGGCCGGGTGTGG + Intronic
1138649827 16:58453494-58453516 TCACATTTGTGGGCCGGGTGTGG + Intergenic
1138909974 16:61384597-61384619 TCTTGCTTATGGGCCGGGTGCGG - Intergenic
1139797183 16:69492804-69492826 TCTGATATATGGGCCGGGTGTGG + Intergenic
1140353674 16:74286414-74286436 TTAGAGTTCTCGGCTGGGTGTGG + Intergenic
1140373746 16:74428492-74428514 TAAGACATCTGGGCCGGGTGTGG - Intergenic
1141191546 16:81828526-81828548 TGACGCTTCTCGGCCGGGTGCGG - Intronic
1142556230 17:779872-779894 TCATCCTTATTGGCCGGGCGCGG + Intronic
1145926101 17:28647930-28647952 TAAGATCTATAGGCCGGGTGCGG + Intergenic
1146060581 17:29604033-29604055 TAAAACTTATAGGCAGGGTGCGG - Intronic
1147150975 17:38513547-38513569 TAAGACGTGTTGGCCGGGTGTGG - Intergenic
1147488720 17:40843633-40843655 TGAGACTTCTCAGCCTGGTGTGG + Intergenic
1150705762 17:67485635-67485657 TCTAACTAATTGGCCGGGTGCGG - Intronic
1151331268 17:73410605-73410627 GCAGCATTATCGGCCGGGGGTGG - Intronic
1151851440 17:76692541-76692563 TCAGACTTCCAGGCCGGGCGCGG - Intronic
1155272454 18:24153811-24153833 TAAGATTTTTCGGCTGGGTGCGG + Intronic
1155487767 18:26365295-26365317 ACAGAATTATAGGCCAGGTGCGG - Intronic
1156109636 18:33709963-33709985 GCTGACTGATGGGCCGGGTGCGG + Intronic
1157465465 18:47940677-47940699 TCAGCTTTATTGGCTGGGTGCGG + Intergenic
1158277673 18:55786179-55786201 ACATACTTATAGGCTGGGTGTGG + Intergenic
1159814445 18:73055190-73055212 ACAGAGTTTTCGGCCGGGCGCGG - Intergenic
1160533634 18:79579499-79579521 TGACACTTATTGGCCGGGCGCGG + Intergenic
1161372238 19:3919301-3919323 TAAAAATTATCGGCCGGGTGTGG + Intronic
1161419247 19:4167050-4167072 AGACACTTATTGGCCGGGTGTGG + Intronic
1161539081 19:4838869-4838891 TCAGGAATATAGGCCGGGTGCGG - Exonic
1161542964 19:4863205-4863227 TGAGATTTAAAGGCCGGGTGCGG + Intronic
1161789568 19:6351074-6351096 TATGAGTTATAGGCCGGGTGTGG + Intergenic
1161877399 19:6922323-6922345 TCAGAGGTGTTGGCCGGGTGTGG + Intronic
1162448251 19:10737773-10737795 TCAAACAAATAGGCCGGGTGCGG - Intronic
1163068573 19:14818382-14818404 TATGACTTATCAGCCGGGCGCGG - Intronic
1163865069 19:19766632-19766654 ACAGAATTATAGGTCGGGTGTGG + Intergenic
1165048018 19:33121607-33121629 GGAGACTTGGCGGCCGGGTGCGG - Intronic
1165611924 19:37162212-37162234 TCATACTTTTAGGCCGGGCGTGG - Intronic
1165719393 19:38068317-38068339 TCTGATTTTTCGGCCGGGCGTGG - Intronic
1165796131 19:38520402-38520424 AAAGACATATAGGCCGGGTGTGG + Intronic
1167333506 19:48870695-48870717 CCAGCCTGGTCGGCCGGGTGCGG + Intergenic
1168083330 19:54026716-54026738 TCAGGGTTCTCGGCTGGGTGCGG - Intergenic
1168114867 19:54216823-54216845 ACAGACGTAAAGGCCGGGTGTGG - Intronic
1168262004 19:55200650-55200672 TCAGACTAATGTGCCGGGCGTGG + Intronic
924999391 2:392953-392975 TCAAACTTCACGGCGGGGTGAGG + Intergenic
926978177 2:18535640-18535662 TAAGACTGATTGGCCAGGTGTGG - Intergenic
927158103 2:20233623-20233645 TCTGACTTTTCGGCCAGGTGTGG + Intergenic
928946088 2:36773452-36773474 TAAAATTTATTGGCCGGGTGTGG + Intronic
929553922 2:42912222-42912244 TCAGAATTATGGGCTGGGCGTGG + Intergenic
929579514 2:43072878-43072900 TCAGACTTCTGGGCTGGGCGCGG + Intergenic
930756746 2:54982244-54982266 TCATACTTGTGGGCCGGGTGTGG - Intronic
931054530 2:58454120-58454142 TTATAATTATCGGCCGGGTGCGG - Intergenic
931301506 2:60983181-60983203 TTAGACTTAAGGGCTGGGTGTGG - Intronic
931394976 2:61879566-61879588 TGAGAAGTATCGGCCAGGTGCGG - Intronic
931468602 2:62514963-62514985 TCATCCATTTCGGCCGGGTGTGG + Intergenic
934663588 2:96155702-96155724 TCATACTTCTCAGCCAGGTGCGG + Intergenic
934960206 2:98666400-98666422 TCAGAATTTAAGGCCGGGTGTGG + Intronic
937294368 2:120800794-120800816 TCATCCCTTTCGGCCGGGTGCGG - Intronic
938028786 2:127973782-127973804 TAAGACATATGGGCAGGGTGCGG + Intronic
940677501 2:156743021-156743043 TTAAAAATATCGGCCGGGTGCGG + Intergenic
941181312 2:162262678-162262700 TAATACTTATGGGCCGGGCGCGG + Intergenic
942795124 2:179808320-179808342 TAAAAATTATAGGCCGGGTGCGG - Intronic
943959382 2:194242055-194242077 AAAGAATTATAGGCCGGGTGCGG + Intergenic
944710932 2:202334457-202334479 TAGTAATTATCGGCCGGGTGTGG - Intergenic
946315886 2:218911935-218911957 TCAGAGTTGTAGGCCAGGTGTGG + Intergenic
946627706 2:221632175-221632197 ATAGACTTGTCGGCCAGGTGCGG + Intergenic
946900169 2:224364609-224364631 ACAGAGCTATCGGCCGGGCGCGG + Intergenic
947000483 2:225449905-225449927 TATGGCTTATCGGCCGGGTGTGG - Intronic
949005511 2:241644657-241644679 TCAGAAGTGTCGGCCGGTTGCGG + Intronic
1170632191 20:18075163-18075185 TAAGAATTATTGGCCGGGCGTGG + Intergenic
1173497786 20:43531735-43531757 TCAGTCTTACTGGCTGGGTGCGG + Intronic
1174798378 20:53541473-53541495 TCAGAAATATGGGCCAGGTGCGG - Intergenic
1174853265 20:54017684-54017706 TCACACATATTGGCCGGGCGTGG - Intronic
1176114171 20:63423886-63423908 CCAGACTTGTGGGCGGGGTGGGG + Intronic
1178016040 21:28347126-28347148 AAAGAGTTATTGGCCGGGTGTGG + Intergenic
1178467734 21:32863910-32863932 TCACACTTGTAAGCCGGGTGCGG + Intergenic
1178850750 21:36210215-36210237 TCTGACTTCCCGGCTGGGTGCGG + Intronic
1179318392 21:40267604-40267626 TCTGGATTATGGGCCGGGTGTGG + Intronic
1179418439 21:41216782-41216804 CCAGCCTGACCGGCCGGGTGTGG + Intronic
1180319779 22:11309409-11309431 TCAGAAGTAAAGGCCGGGTGCGG + Intergenic
1181773551 22:25143878-25143900 TGAGAATGATAGGCCGGGTGTGG + Intronic
1181817704 22:25451017-25451039 TAAGAAGTATAGGCCGGGTGCGG - Intergenic
1182337461 22:29593744-29593766 TAATATTTATCGGCCGGGCGCGG - Intergenic
1183711629 22:39507533-39507555 TAAGCCTTTTCGGCCGGGTACGG - Intronic
949967214 3:9367773-9367795 TCAGACTTAAGGGCCTGGCGTGG + Intronic
950461785 3:13127120-13127142 TCAGAGTTCTCGGCTGGGGGCGG + Intergenic
951589975 3:24254071-24254093 TCAGATTTACCGGCCGGGCGTGG + Intronic
951872690 3:27382403-27382425 TCAGTCTTAGAGGCCTGGTGTGG - Intronic
952802473 3:37308958-37308980 TAACAATTATAGGCCGGGTGTGG + Intronic
954187719 3:48931724-48931746 TCACAATTTTCAGCCGGGTGCGG + Intronic
954273670 3:49528573-49528595 TCACACTTATTGGCTGGGCGTGG - Intronic
955878573 3:63520382-63520404 TCAGGGTAATCGGCCGGGTGCGG + Intronic
959049553 3:101512108-101512130 ACAGATTTATTGGCCGGGCGCGG - Intronic
960244957 3:115390075-115390097 TCAGACTAATTGGCCAGGTCTGG + Intergenic
960666205 3:120111522-120111544 ACACACTTCTCGGCCGGGCGCGG + Intergenic
960850917 3:122052857-122052879 TCTGACTTTTTGGCCGGGCGCGG - Intergenic
961153077 3:124656318-124656340 TAAAAGTTCTCGGCCGGGTGCGG + Intronic
962075900 3:132081343-132081365 TAAGATTTGTCGGCCGGGCGCGG - Intronic
962790422 3:138806194-138806216 TAAGAGAAATCGGCCGGGTGAGG + Intronic
963145249 3:141987635-141987657 ACATTCTTCTCGGCCGGGTGCGG + Intronic
964082607 3:152777214-152777236 TCTAACTTATAGGCCGGGCGCGG - Intergenic
964358061 3:155868634-155868656 ACAGACTTGTTGGCCAGGTGCGG - Intergenic
966138407 3:176727169-176727191 TCAAATTTATTGGCCGGGCGCGG - Intergenic
966276176 3:178172830-178172852 TAAGAATTCTAGGCCGGGTGTGG + Intergenic
966796002 3:183714091-183714113 TTAAAATTATGGGCCGGGTGTGG - Intronic
966840862 3:184086260-184086282 TCAGTCTTCTTGGCCGGGCGTGG + Intergenic
968786980 4:2629839-2629861 TGTGCATTATCGGCCGGGTGCGG + Intronic
971016612 4:22495616-22495638 TCAAAGTTATAGGCCGGGCGTGG + Intronic
974577637 4:63748217-63748239 TGGAACTTTTCGGCCGGGTGTGG - Intergenic
974888598 4:67851517-67851539 TCAGATTTATAGTCCGGGTGAGG - Intronic
975246515 4:72127010-72127032 TAAGACATATAGGCCGGGTGCGG + Intronic
976193286 4:82509503-82509525 TCAAAATTCACGGCCGGGTGGGG + Intronic
977585885 4:98774740-98774762 TTAGTCTTCTCGGCCGGGCGCGG + Intergenic
978166403 4:105613380-105613402 TCAGACTGATAGGCTGGATGTGG + Exonic
978448467 4:108803459-108803481 ACAGACTAGACGGCCGGGTGCGG + Intergenic
980435825 4:132771985-132772007 TAAGACTTAGTGGCCGGGCGCGG - Intergenic
980776784 4:137447033-137447055 TCTCTCTTATAGGCCGGGTGTGG - Intergenic
985254344 4:188055019-188055041 TTAAACTTCTAGGCCGGGTGCGG + Intergenic
985262042 4:188123653-188123675 TAAGAATTTTGGGCCGGGTGCGG - Intergenic
985272130 4:188203614-188203636 GCAGAATTATGGGCCGGGCGCGG - Intergenic
985334984 4:188882951-188882973 TAAAAATTAGCGGCCGGGTGCGG + Intergenic
986693948 5:10335503-10335525 GAAGAGTTATAGGCCGGGTGTGG - Intergenic
992760764 5:79949356-79949378 TAAGAATTATTGGCCGGGTGCGG + Intergenic
993528723 5:88999478-88999500 TAAGAGTTATAGGCCAGGTGTGG - Intergenic
994453650 5:99977879-99977901 TCACACTTAGCGGCCAGGAGCGG + Intergenic
996121588 5:119679758-119679780 AGAGACTTCTCGGCCGGGCGCGG - Intergenic
997011535 5:129883977-129883999 TCACATTTTTCGGCTGGGTGCGG + Intergenic
997539784 5:134652210-134652232 TAAGACTTTTCGGCCAGGCGCGG - Intronic
1002992729 6:2252824-2252846 TTAGAGCTATTGGCCGGGTGTGG - Intergenic
1003545567 6:7055599-7055621 TTAAACTTCTTGGCCGGGTGCGG - Intergenic
1004250847 6:14022052-14022074 TCAGACTTAACGGCTGGGTATGG - Intergenic
1005062399 6:21789110-21789132 TATCAGTTATCGGCCGGGTGTGG + Intergenic
1006859968 6:37165093-37165115 TGAAAATTATCGGCCGGGTGCGG + Intergenic
1008916024 6:56787846-56787868 TCAGACTTTGAGGCTGGGTGTGG + Intronic
1010695393 6:78967842-78967864 TAAAATTTATCGGCCGGGCGCGG + Intronic
1011448857 6:87472342-87472364 TCAGATGTATCGGCCGGGCGTGG - Intronic
1014214698 6:118741927-118741949 TAAAATGTATCGGCCGGGTGCGG - Intergenic
1014420628 6:121240596-121240618 TAAGACATATTGGCCGGGTGCGG + Intronic
1014932234 6:127348730-127348752 TGAGACTTATGGTCCGTGTGAGG + Intergenic
1016642250 6:146362387-146362409 TAAGACATTCCGGCCGGGTGCGG + Intronic
1016941583 6:149486759-149486781 TAGGAGTTGTCGGCCGGGTGCGG - Intergenic
1017733029 6:157334924-157334946 TAAGACTTCTAGGCCGGGCGTGG - Intergenic
1018863561 6:167730837-167730859 TCACCGTTACCGGCCGGGTGCGG + Intergenic
1018883207 6:167905813-167905835 TCTGTCTTATGGGCCGGATGTGG + Intronic
1021288782 7:18817322-18817344 TAATACTTCTCGGCCGGGCGCGG - Intronic
1021883097 7:25112762-25112784 TCAGAATTAGTGGCCGGGAGTGG + Intergenic
1022162849 7:27728853-27728875 ACATACTTCTGGGCCGGGTGCGG - Intergenic
1022210273 7:28202119-28202141 TGAGAGTCCTCGGCCGGGTGCGG + Intergenic
1023479693 7:40620691-40620713 TAAGAGTTATTGGCCGGGCGTGG - Intronic
1023945685 7:44801105-44801127 TTACACATATAGGCCGGGTGCGG - Intronic
1028522686 7:91749087-91749109 TAAGAATTCTCGGCCGGGCGCGG - Intronic
1029288836 7:99486025-99486047 TCAGAATTTTGGGCTGGGTGCGG + Intronic
1031177800 7:118374767-118374789 TTAGAAATATTGGCCGGGTGCGG + Intergenic
1031206101 7:118759621-118759643 TGAGGCTTATAGGCCGGGCGCGG + Intergenic
1032404252 7:131644305-131644327 TCAGACTGTTGGGCCGGGCGCGG + Intergenic
1032888719 7:136170081-136170103 ACTGAGCTATCGGCCGGGTGCGG - Intergenic
1034059825 7:148076731-148076753 TCAGAGCTATCGGCCGGGCACGG - Intronic
1035397440 7:158544343-158544365 TGAGATTTTTTGGCCGGGTGCGG + Intronic
1036221101 8:6922245-6922267 TCAGCCTTCTCAGCTGGGTGTGG - Intergenic
1036468666 8:9028912-9028934 TAAGAATTATTGGCTGGGTGTGG - Intronic
1037691992 8:21189434-21189456 TCAGACTTCGTGGCCAGGTGTGG - Intergenic
1037871211 8:22498832-22498854 GTAGAATTATTGGCCGGGTGCGG + Intronic
1038940277 8:32296824-32296846 ACATATTTATAGGCCGGGTGTGG + Intronic
1040678389 8:49780077-49780099 TAAGAGATATCGGCCAGGTGCGG + Intergenic
1040813991 8:51487081-51487103 ATAAACTTTTCGGCCGGGTGCGG - Intronic
1041849469 8:62373820-62373842 TTATACTTCTTGGCCGGGTGCGG + Intronic
1043572707 8:81623362-81623384 TAACACTGATGGGCCGGGTGTGG + Intergenic
1046691754 8:117293466-117293488 TAAGAGTTATAGGCCGGGCGTGG - Intergenic
1047237243 8:123052558-123052580 TCATATTTATTGGCCAGGTGCGG + Intronic
1047882689 8:129214090-129214112 TTATATTTATTGGCCGGGTGCGG + Intergenic
1048312140 8:133332044-133332066 TAATACTTATGGGCCGGGCGCGG - Intergenic
1048942038 8:139408279-139408301 TCATAAGTATAGGCCGGGTGCGG + Intergenic
1049319861 8:141990415-141990437 TCAGATTTAGTGGCTGGGTGTGG - Intergenic
1049827898 8:144681976-144681998 TCTTACTTCTCGGCCGGGTGCGG + Intergenic
1050096164 9:2069204-2069226 TATGTCATATCGGCCGGGTGCGG - Intronic
1050479767 9:6077578-6077600 TAAGACTTTCGGGCCGGGTGTGG + Intergenic
1051675527 9:19554592-19554614 TCAGCCTTCTCGGCAAGGTGTGG + Intronic
1052251983 9:26409155-26409177 TCAGACTGTTCGGCTGGGCGCGG - Intergenic
1052948619 9:34189477-34189499 ACATAATGATCGGCCGGGTGCGG - Intronic
1054579909 9:66901652-66901674 TCAGAATTTTTGGCCAGGTGCGG + Intronic
1055057968 9:72040968-72040990 ACAAACTTATTGGCCGGGTGTGG + Intergenic
1055590313 9:77805692-77805714 GCAAACTTTTTGGCCGGGTGCGG - Intronic
1056919904 9:90778196-90778218 TCAGGATTTTCAGCCGGGTGCGG + Intergenic
1057607284 9:96508304-96508326 TCTGAAGTATGGGCCGGGTGCGG - Intronic
1057901014 9:98948306-98948328 ACACACTTGTCGGCCGGGCGCGG + Intronic
1058042553 9:100319512-100319534 TAAGACTTGTAGGCTGGGTGTGG + Intronic
1058185713 9:101852049-101852071 ACAGACTTAAGGGCTGGGTGCGG - Intergenic
1058339598 9:103878219-103878241 TCAGAATTATTGGCCGGGCGCGG - Intergenic
1059117759 9:111614791-111614813 TAAAAATTATTGGCCGGGTGCGG - Intergenic
1060917613 9:127400446-127400468 ACACACCTATCGGCCGGGCGCGG - Intronic
1061027375 9:128058758-128058780 TAACAATTATTGGCCGGGTGCGG - Intergenic
1061685601 9:132274734-132274756 TCAGACCTGTAGGCTGGGTGTGG - Intronic
1203441130 Un_GL000219v1:9605-9627 TAAGACCTATCTGCCCGGTGTGG + Intergenic
1203368009 Un_KI270442v1:275158-275180 TCAGAAGTAAAGGCCGGGTGTGG + Intergenic
1203511939 Un_KI270741v1:128513-128535 TAAGACCTATCTGCCCGGTGTGG + Intergenic
1187512001 X:19928290-19928312 TAAGAGTTATCGGCCAGGCGTGG + Intronic
1188172486 X:26944324-26944346 ACATGCTTATTGGCCGGGTGCGG - Intergenic
1189820936 X:44869900-44869922 TCGGCCTTATAAGCCGGGTGCGG - Intergenic
1190340107 X:49289776-49289798 ACAGACTTATGGGCTGGGCGCGG + Intronic
1192488459 X:71551915-71551937 TTAAACTTTTAGGCCGGGTGCGG + Intronic
1194307401 X:92265223-92265245 TTCTGCTTATCGGCCGGGTGCGG - Intronic
1195999975 X:110772346-110772368 TTACACTTTTTGGCCGGGTGTGG + Intronic
1196674687 X:118407208-118407230 AGTGACTTATCGGCCAGGTGCGG + Intronic
1196796789 X:119508298-119508320 TAAGAATTCCCGGCCGGGTGTGG - Intergenic
1196921762 X:120592738-120592760 TAAAATTTATGGGCCGGGTGTGG + Intergenic
1197642463 X:128981991-128982013 TAAGAGTTTTCGGCCAGGTGTGG - Intergenic
1197803605 X:130377645-130377667 TAAAAATTATTGGCCGGGTGTGG - Intergenic
1198304411 X:135366475-135366497 ACAGACCTATAGGCCGGGCGCGG + Intergenic
1198522699 X:137468949-137468971 ACTGGATTATCGGCCGGGTGAGG - Intergenic
1200947459 Y:8859992-8860014 ACAGACTTTTTGGCCAGGTGTGG + Intergenic