ID: 1126763780

View in Genome Browser
Species Human (GRCh38)
Location 15:51993280-51993302
Sequence GGATCTTTTGTTCTAATATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 662
Summary {0: 2, 1: 48, 2: 95, 3: 155, 4: 362}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126763780_1126763785 11 Left 1126763780 15:51993280-51993302 CCAAATATTAGAACAAAAGATCC 0: 2
1: 48
2: 95
3: 155
4: 362
Right 1126763785 15:51993314-51993336 CTATTGCTCAGGAAATTAGAAGG 0: 1
1: 6
2: 22
3: 84
4: 328
1126763780_1126763787 20 Left 1126763780 15:51993280-51993302 CCAAATATTAGAACAAAAGATCC 0: 2
1: 48
2: 95
3: 155
4: 362
Right 1126763787 15:51993323-51993345 AGGAAATTAGAAGGGTTTTTAGG 0: 1
1: 1
2: 6
3: 43
4: 371
1126763780_1126763782 0 Left 1126763780 15:51993280-51993302 CCAAATATTAGAACAAAAGATCC 0: 2
1: 48
2: 95
3: 155
4: 362
Right 1126763782 15:51993303-51993325 TCCTAGCACCACTATTGCTCAGG 0: 1
1: 6
2: 13
3: 33
4: 128
1126763780_1126763786 12 Left 1126763780 15:51993280-51993302 CCAAATATTAGAACAAAAGATCC 0: 2
1: 48
2: 95
3: 155
4: 362
Right 1126763786 15:51993315-51993337 TATTGCTCAGGAAATTAGAAGGG 0: 1
1: 4
2: 28
3: 107
4: 453

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126763780 Original CRISPR GGATCTTTTGTTCTAATATT TGG (reversed) Intronic
900014838 1:140867-140889 GCATCTTTTGTTTTAATATTTGG + Intergenic
900738870 1:4318259-4318281 GAATCTTTTGTTCTATTATTTGG - Intergenic
903696478 1:25211072-25211094 GAATCTTTTGTTTTAATATTTGG - Intergenic
905557224 1:38896569-38896591 GGATATTTTGCAATAATATTAGG - Intronic
905990967 1:42336501-42336523 GGAGCTTTCATTCTAATATAAGG + Intergenic
906514966 1:46433507-46433529 GGCTCTTTGGTCCTGATATTAGG + Intergenic
907190023 1:52640706-52640728 GCATCATTTGTTCTAAAATTTGG + Intronic
908219808 1:61993641-61993663 ACATCTCTTGTTTTAATATTTGG - Intronic
909231073 1:73091020-73091042 GTTTCTTTTCTTCTAATTTTGGG + Intergenic
909264501 1:73539329-73539351 GCATCTTTTGTTCTAATATTTGG + Intergenic
909381669 1:75005792-75005814 GGAGTTTCTTTTCTAATATTTGG + Intergenic
909524515 1:76607565-76607587 ACATCTTTTGTTACAATATTTGG - Intronic
909935700 1:81547730-81547752 GGCTTCTTTGTTCTAATCTTGGG + Intronic
910943552 1:92563459-92563481 GGATCTTCTGTTCTAATATTGGG - Intronic
911259178 1:95666310-95666332 GTATCTTTTTTTCCAATATTTGG - Intergenic
911889197 1:103345303-103345325 GAATCCTTCATTCTAATATTTGG - Intergenic
911889205 1:103345383-103345405 GAATCTTTTCTTCCAGTATTTGG - Intergenic
911951942 1:104184544-104184566 GCATCTTTTGTTCAAATATTTGG + Intergenic
912872814 1:113325513-113325535 GGATATTTGTTTCTAATGTTGGG - Intergenic
913689238 1:121262809-121262831 GGGTTTTTTTTTCTAAAATTTGG + Intronic
914148361 1:145017471-145017493 GGTTTTTTTTTTCTAAAATTTGG - Intronic
915947457 1:160164010-160164032 GAATCTTTTGTTCTAATATTTGG - Intronic
916293524 1:163191664-163191686 GCACCTTTTATTCTAATACTTGG + Intronic
916866423 1:168864373-168864395 GGATCTCTTCTTTTAATCTTTGG - Intergenic
917018800 1:170563654-170563676 AAATCTCTTGTTCTGATATTTGG + Intergenic
917375357 1:174347348-174347370 CTTTCTTTAGTTCTAATATTTGG + Intronic
917767333 1:178236133-178236155 GTCTCTTTTGTTCAGATATTAGG + Intronic
918263469 1:182818220-182818242 GAATATTTTATTCTAATACTTGG - Intronic
918508122 1:185280441-185280463 TAATCTTTTGTTCTAATCTTTGG + Intronic
919134339 1:193489395-193489417 GCATCTTTTGTTTTAATAGTTGG + Intergenic
919509826 1:198447995-198448017 GTTTCTTTTATTCTCATATTAGG - Intergenic
920476561 1:206281284-206281306 GGGTTTTTTTTTCTAAAATTTGG + Intronic
920783551 1:209019008-209019030 GAAACTTTTTTTCTAATTTTAGG + Intergenic
920953224 1:210593210-210593232 GTTTCCTTTGTTCTAATTTTGGG + Intronic
921436961 1:215134798-215134820 GGATCTTTTATTCTAATAATCGG - Intronic
921467974 1:215513958-215513980 GCATCTTTTGTGATAATTTTAGG - Intergenic
921875124 1:220187242-220187264 GTTTCTTTTGTTCTAGTGTTTGG + Intronic
921875130 1:220187324-220187346 GAACCTTTTGTTCTAACATTTGG + Intronic
921929008 1:220738837-220738859 GTTTCTTTTCTTCTAATTTTAGG + Intergenic
922101911 1:222483980-222484002 ACATCTTTTGTTTTAATATTTGG + Intergenic
922229327 1:223672105-223672127 GCATCTTTTGTTGTAATATTTGG + Intergenic
922262992 1:223959102-223959124 ACATCTTTTGTTTTAATATTTGG + Intergenic
922333266 1:224596806-224596828 GAGTCTTTTGTTATAATGTTGGG + Intronic
923074624 1:230598688-230598710 ACATCTTTTGTTCTAATACTTGG - Intergenic
923437293 1:233979436-233979458 GGACATTTTGTCCTTATATTTGG + Intronic
923450872 1:234116279-234116301 GCATCTTTTGTTCTAATATTTGG - Intronic
923869200 1:237972602-237972624 GTATAATTTGTTATAATATTTGG - Intergenic
924344832 1:243064103-243064125 ACATCTTTTGTTTTAATATTTGG + Intergenic
924365838 1:243292402-243292424 GCATCTTTCGTTAAAATATTTGG - Intronic
924390531 1:243550627-243550649 TCATTTTTTGGTCTAATATTTGG - Intronic
924712021 1:246537396-246537418 GTGTGTTTTGTACTAATATTTGG + Intergenic
924758637 1:246964440-246964462 GAATCTTTTGTTCTGATATTTGG - Intronic
1063276375 10:4572790-4572812 ACATCTTTTGTTGTAATGTTGGG - Intergenic
1064411506 10:15108757-15108779 GGATCTTTTGTTCTGTTACATGG + Exonic
1064646165 10:17461938-17461960 GGTTCTTGTGTTGTAATTTTGGG - Intergenic
1065034479 10:21623438-21623460 GCATTTTTTGTTATAATATTTGG - Intronic
1065036109 10:21640052-21640074 GTATCTTTTGTTAAAGTATTTGG - Intronic
1065210621 10:23398876-23398898 GCATCTTCTGTTATAATATTTGG - Intergenic
1065395414 10:25231526-25231548 GAATCTGTTGCTCTAATGTTAGG + Intronic
1066374368 10:34844125-34844147 GCAGCTTTCGTTATAATATTTGG + Intergenic
1066731503 10:38440972-38440994 ACATCTTTTGTTTTAATATTTGG - Intergenic
1067007878 10:42681839-42681861 GCATCTTTTGTTTCAATATTTGG + Intergenic
1067840349 10:49671426-49671448 GGATCCTTTTTTCTAATTCTGGG + Intergenic
1068312560 10:55296538-55296560 AAATCTTTTGTTATAATACTTGG - Intronic
1068389881 10:56381509-56381531 GGATCATTTGTTTTTATGTTGGG + Intergenic
1068757617 10:60672205-60672227 GCATCTTTTGTTTTGATATTGGG + Intronic
1068758594 10:60682485-60682507 CAGTCTTTTGTTATAATATTGGG + Intronic
1069660239 10:70118749-70118771 GAATCATTTGTTCTAATATTTGG + Intronic
1071842863 10:89490984-89491006 GCATCTTTTGTTATAGTATTTGG - Intronic
1071887414 10:89966234-89966256 GAATCTTTTGTTTTAACCTTTGG + Intergenic
1071908129 10:90197700-90197722 CTATCTTGTGTTCTAGTATTTGG + Intergenic
1072311178 10:94156852-94156874 GCATGTTTTTTTCTAATATATGG - Intronic
1073629315 10:105132523-105132545 GGCCCTTTGGTTCTAATTTTTGG + Intronic
1074137613 10:110642093-110642115 AGATCTATTGTATTAATATTTGG + Intergenic
1074989237 10:118687863-118687885 GGAACTTATGTTCTGATGTTGGG - Intronic
1075596325 10:123732253-123732275 GTATCTTTTGTTTGAATGTTTGG - Intronic
1076111714 10:127864873-127864895 GCATCTTTTGTTATAATATTTGG + Intergenic
1076627078 10:131828438-131828460 GGATTTTTTTTTCTAATTCTGGG + Intergenic
1076971433 11:135967-135989 GCATCTTTTGTTTTAATATTTGG + Intergenic
1076977237 11:183115-183137 GCATCTTGTGTTCTAATATTTGG - Intronic
1078301287 11:10133876-10133898 GCATCTTTTGTTCTAATATTTGG + Intronic
1078301916 11:10140137-10140159 CCATCTTTTGTTTTAATATTTGG + Intronic
1078388234 11:10912030-10912052 GTATCTTTTGTTATAATATTTGG + Intergenic
1078490334 11:11762339-11762361 AAATCTTTTGTTCTAATACTTGG - Intergenic
1078575089 11:12494532-12494554 GCATCTATGGTTATAATATTTGG - Intronic
1078805936 11:14703437-14703459 GAATCTTTTGTTTAAATTTTAGG + Intronic
1078880147 11:15440011-15440033 GAATCTTTTATTTTAACATTTGG + Intergenic
1079723788 11:23853291-23853313 GGATCTTTTGTTTTCATTTAAGG + Intergenic
1079841563 11:25407696-25407718 GGAGCTTTTGCTACAATATTTGG + Intergenic
1079973913 11:27069090-27069112 GGATTTTTTTTTCTAATTCTGGG + Intronic
1080007674 11:27426995-27427017 TGATGTTTTGTTGTAACATTAGG - Intronic
1080052091 11:27868523-27868545 GTGTCTTTTATTCTAATATTTGG - Intergenic
1080289881 11:30658879-30658901 GAATATTTTATTCTAATATTTGG - Intergenic
1080302866 11:30804033-30804055 ATATCTTTGGTTCTGATATTGGG + Intergenic
1080625606 11:34028060-34028082 GAGTCTTTTGTTCTGCTATTTGG - Intergenic
1080699692 11:34634188-34634210 GGATTTTTTTTTCTCTTATTTGG + Intronic
1080999747 11:37654658-37654680 ACATCTTTTGTTATAATGTTGGG + Intergenic
1081027399 11:38032789-38032811 GGAGCTTGTGTTCTAATGGTGGG + Intergenic
1081443661 11:43108325-43108347 GCATCTATTCTTCTCATATTGGG + Intergenic
1081723957 11:45313404-45313426 GCCTCTTTTGCTCTACTATTTGG + Intergenic
1082731524 11:56803794-56803816 GGATTTTTTTTTCAAATTTTTGG - Intergenic
1083082958 11:60112695-60112717 GGATCATTGGTTCTCATACTTGG - Intergenic
1084993840 11:72955759-72955781 GAATCTTTTGTTCCTATATTTGG - Intronic
1086491795 11:87363235-87363257 GAATCTTTTGTTCTAATATTTGG - Intergenic
1087434451 11:98095901-98095923 GAATGTTTTGATCTAATATTTGG - Intergenic
1087638220 11:100727344-100727366 ACATCTTCTGTTCTAATATTTGG + Intronic
1087663794 11:101019116-101019138 GCATCTTTTGTTCTAATATTTGG + Intergenic
1087825954 11:102764986-102765008 ATATCTTTTGTTCCAATATTTGG + Intergenic
1087965802 11:104413789-104413811 GCATCTTTTGTTCTAATATTTGG + Intergenic
1088000608 11:104875982-104876004 TAATTGTTTGTTCTAATATTTGG + Intergenic
1088967544 11:114738822-114738844 GGATGTTTTTTTTTCATATTTGG + Intergenic
1089364550 11:117913419-117913441 AGATCTTTTCTTCTTATATCTGG - Intronic
1090125472 11:124078941-124078963 TGGTCTTTTGTTATAATGTTGGG - Intergenic
1090492265 11:127175312-127175334 ATGTCTTTTGTTCTAATATTTGG + Intergenic
1090986666 11:131773041-131773063 TGATATTTTGTTCTAACATCAGG - Intronic
1091170153 11:133512814-133512836 GAATCTTCTGTTCTGATATTTGG - Intronic
1091581828 12:1795022-1795044 GCATCTTTTGTTATAGTGTTTGG - Intronic
1092806936 12:12232923-12232945 GCATCTTTTGTTATAATATTTGG - Intronic
1092807417 12:12237161-12237183 GCATCTTTTGTTCTAATATTTGG - Intronic
1093043454 12:14413115-14413137 ATATCTTTTGTTCTGATCTTAGG + Intronic
1093482469 12:19619054-19619076 CTATATTTTGTTCTAGTATTCGG + Intronic
1094116955 12:26926704-26926726 GCATCTTTTGCTCTAATATTTGG + Intronic
1094314855 12:29128503-29128525 TAATTTTTTGTTCTAATATTTGG + Intergenic
1094668551 12:32546175-32546197 GGAGCTGTACTTCTAATATTTGG - Intronic
1094724429 12:33099143-33099165 GCATTTTTTGTTCTAAAATTTGG + Intergenic
1095159201 12:38896588-38896610 TGTTCTTTTGTTCTAAAACTTGG + Intronic
1095687788 12:45055067-45055089 GGATTGTTTTTTCTAATTTTGGG - Intergenic
1097535118 12:60859364-60859386 TGATCTTTTTTTTTATTATTTGG - Intergenic
1097541214 12:60946034-60946056 GAATCTTTTGTTCTAATATTTGG + Intergenic
1098132125 12:67361911-67361933 ACATCTTTTGTTATAATATTTGG + Intergenic
1098157868 12:67618818-67618840 GAATCTTTTGTTCTAATATTTGG - Intergenic
1098506228 12:71253807-71253829 GCATCTTTTGTTATAATATTTGG - Intronic
1098909706 12:76196400-76196422 GCATTTTGTGTTCTAATATTTGG - Intergenic
1099420383 12:82451056-82451078 GGTTCTTTGGTTCTATTACTTGG - Intronic
1100096602 12:91046765-91046787 TAATCTTTTGTTCTAATATTTGG + Intergenic
1100100984 12:91105512-91105534 CAATGTTTTTTTCTAATATTAGG - Intronic
1100164339 12:91899517-91899539 AGATCTATTTTTCTAATATTGGG - Intergenic
1100647222 12:96544348-96544370 GAGTCTTTTGTTATAATGTTGGG + Intronic
1100707722 12:97219757-97219779 GGAGCTTCTGTTCTAATAAAGGG - Intergenic
1101491572 12:105214646-105214668 GCATATTTTGTTATAATACTTGG + Intronic
1102664005 12:114554429-114554451 ATATCTTTTATTCTAGTATTTGG - Intergenic
1102731217 12:115112161-115112183 GGATTTTTTTTTTTAATTTTTGG + Intergenic
1103653832 12:122454895-122454917 GCATCTTTCGTTCTACCATTTGG + Intergenic
1103674323 12:122643723-122643745 GCCTCTTTTGTTCTAATATCTGG - Intergenic
1104276982 12:127338136-127338158 GGATCTATCTTTCTAATATGTGG - Intergenic
1104704916 12:130936352-130936374 GGCTTTTTTTTTCTAATATATGG + Intergenic
1105513062 13:21067217-21067239 GAATCTTCTGTTCTAATATTTGG + Intergenic
1106272950 13:28171996-28172018 GCATCTTTGGTTCAAATATTTGG - Intronic
1106272954 13:28172027-28172049 GCATCTTTTGTTCAAATATTTGG - Intronic
1106378518 13:29213089-29213111 GAATCTTTTGTTCTAACATTTGG - Intronic
1106392517 13:29348309-29348331 GAATCTTTTGTTCTAACATTTGG - Intronic
1106427855 13:29650272-29650294 GAGTCTTTTGTTATAATGTTGGG + Intergenic
1107185537 13:37515025-37515047 GGATCTTTTATTCTAGTCTTTGG - Intergenic
1109205364 13:59477442-59477464 GTATCTTTGGTTATAATATTTGG + Intergenic
1109498014 13:63200280-63200302 GAATCTTTTGTTCTAATATTTGG + Intergenic
1109775698 13:67038783-67038805 GGATCTTTTGTTATAGTATTGGG + Intronic
1110339156 13:74368798-74368820 AAGTTTTTTGTTCTAATATTAGG - Intergenic
1110348394 13:74476243-74476265 GCATCTTTTGTTCTAATATTTGG - Intergenic
1110488366 13:76072860-76072882 CAATCTTTTGTTATAATGTTGGG + Intergenic
1112074271 13:95892323-95892345 GGATGTTCTGTTCTATTCTTGGG - Intronic
1112169309 13:96953489-96953511 GTGTTTTTTGTTGTAATATTGGG + Intergenic
1113049935 13:106199525-106199547 GCATCTTTTGCTGTAATATTTGG - Intergenic
1114714666 14:24812602-24812624 GCTTCTTTTTTTCCAATATTTGG - Exonic
1115205675 14:30900763-30900785 GGATTTTTTTTTCTATTATTTGG + Intronic
1117238315 14:53801785-53801807 GTATCTCTTTTTCTAATCTTTGG - Intergenic
1117937833 14:60926994-60927016 GAATCTTTTGTTCTAATATTTGG - Intronic
1117951490 14:61087004-61087026 GAATGTTTTCTCCTAATATTAGG + Intergenic
1118017323 14:61673229-61673251 GCATCTTTTGTTCTAATATTTGG - Intergenic
1119064444 14:71511592-71511614 GCATCTTTTGTTACAGTATTTGG + Intronic
1120083434 14:80241457-80241479 GAATCTTCTGTTATAACATTTGG + Intronic
1120180488 14:81338053-81338075 GAATCTTCTGTTCTAATACTTGG + Intronic
1121459549 14:94064293-94064315 GCATCTTTTGTTGAAATATTTGG + Intronic
1202942288 14_KI270725v1_random:162428-162450 CAGTCTTTTGTTATAATATTGGG - Intergenic
1123460170 15:20462626-20462648 GTATCTTTTGTTTTAATACTTGG - Intergenic
1123657892 15:22537791-22537813 GTATCTTTTGTTTTAATACTTGG + Intergenic
1123859093 15:24445336-24445358 CAATCTTTTCTTCTAATATCTGG - Intergenic
1124079837 15:26481959-26481981 GGATATTTTCTTCTAACATCAGG + Intergenic
1124192755 15:27594747-27594769 GAATCTTTTGTTCTAATATTTGG - Intergenic
1124266390 15:28238397-28238419 GCATTTTTTGTTTTAATACTTGG - Intronic
1124311803 15:28632990-28633012 GTATCTTTTGTTTTAATACTTGG + Intergenic
1124383657 15:29188618-29188640 GAATCTTCTGTTTTAGTATTTGG + Intronic
1124649237 15:31462817-31462839 GGGTCTTTTGTTATAACGTTGGG + Intergenic
1125059143 15:35398158-35398180 GAATCTTTTGTTCTAACATTTGG + Intronic
1125100899 15:35911444-35911466 TCATCTTTTTTTTTAATATTGGG + Intergenic
1125439783 15:39689589-39689611 GCAACTTTTGTTATAATAGTTGG - Intronic
1125848732 15:42884411-42884433 GCATCTTTTGGTATAATATTTGG + Intronic
1126134098 15:45374533-45374555 CTATCTTTGGTTCTGATATTTGG - Intronic
1126136471 15:45397183-45397205 GAATCTTTGGTTCTAATGTTTGG + Intronic
1126187232 15:45841984-45842006 GCATCTTTTGTTCTAATGTTTGG - Intergenic
1126291129 15:47081037-47081059 CAGTCTTTTGTTATAATATTGGG + Intergenic
1126763780 15:51993280-51993302 GGATCTTTTGTTCTAATATTTGG - Intronic
1126861511 15:52887862-52887884 GAATGTTTTATTCTATTATTTGG - Intergenic
1127182391 15:56435899-56435921 TGATCTATTTTTCTAATATTGGG - Intronic
1127443211 15:59032756-59032778 GTAACTTTTATTCTAATACTAGG + Intronic
1130303067 15:82694925-82694947 AGAACTTCTGTTCTAATATTTGG + Intronic
1130416352 15:83698075-83698097 GAATCTTTTGTTCTACTATTTGG - Intronic
1130566782 15:85002890-85002912 TTATCTTTTGTTAAAATATTTGG - Intronic
1130692490 15:86095519-86095541 GTATCTTTTGTTATAATATTTGG - Intergenic
1131332870 15:91518413-91518435 TCATCTTTTGTTCTAATATTTGG + Intergenic
1131654780 15:94444641-94444663 ACATCTTTTGCTATAATATTTGG - Intronic
1132048043 15:98581833-98581855 TGATTTTTTTTTCTTATATTTGG + Intergenic
1132919767 16:2380851-2380873 GCATCTTTTGTTCTAATATTTGG - Intergenic
1133838483 16:9387300-9387322 GCATCTTTTGTTATAATATTTGG + Intergenic
1134164938 16:11922276-11922298 GCATCATTTGTTCTAATATTTGG - Intergenic
1134755227 16:16660956-16660978 GCATCTTTTGTTCCAATATTTGG - Intergenic
1134990839 16:18698215-18698237 GCATCTTTTGTTCCAATATTTGG + Intergenic
1135079903 16:19425059-19425081 GTGTCTTTTGTTCTAGTATTTGG - Intronic
1135741489 16:24979217-24979239 GGATCATTTGTTCTTGTTTTGGG - Intronic
1135801039 16:25495889-25495911 GGTTCTTCTGTTCTCATTTTGGG - Intergenic
1136114249 16:28084749-28084771 GACTCTTTTGTTCTAATATTTGG + Intergenic
1136704585 16:32175810-32175832 GCATTTTTTGTTTTAATACTTGG - Intergenic
1136763328 16:32753596-32753618 GCATTTTTTGTTTTAATACTTGG + Intergenic
1136804772 16:33116790-33116812 GCATTTTTTGTTTTAATACTTGG - Intergenic
1137372647 16:47922869-47922891 GCATCTTCTGTTCTAGTATTTGG + Intergenic
1138592730 16:58011122-58011144 GCATCTTTTGTTCTATTATCTGG - Intronic
1138787781 16:59867178-59867200 GTATCCTTTGTTAGAATATTTGG + Intergenic
1139259954 16:65582124-65582146 ATATCTTTTGTTCCCATATTTGG + Intergenic
1140545547 16:75805364-75805386 TGATCTTTTGTTTCACTATTTGG + Intergenic
1140598246 16:76441783-76441805 GGATTTATTGTTAGAATATTGGG - Intronic
1140880973 16:79197850-79197872 GGATCTTGTGTCCTGATATAAGG + Intronic
1141459237 16:84167590-84167612 GGCTCTTTTGTTCTAATATTTGG - Intronic
1142443018 16:90113565-90113587 GCATCTTGTGTTCTAATATTTGG + Intergenic
1142448818 16:90161555-90161577 GCATCTTTTGTTTTAATATTTGG - Intergenic
1203065478 16_KI270728v1_random:1013917-1013939 GCATTTTTTGTTTTAATACTTGG + Intergenic
1142458669 17:73734-73756 GCATCTTTTGTTTTAATATTTGG + Intergenic
1142464376 17:121284-121306 AGCTCTTGTGTTCTAATATTTGG - Intergenic
1142924870 17:3226601-3226623 AGAGCTTTTCTTCTAAGATTTGG + Intergenic
1143397924 17:6617539-6617561 TCATCTTTTTTCCTAATATTTGG + Intronic
1144248079 17:13387360-13387382 GCATCTTTTGTTCTAATACTTGG - Intergenic
1145093231 17:20003026-20003048 GATTTTTTTGGTCTAATATTTGG + Intergenic
1145237982 17:21222441-21222463 GGATTTTTAGTTTTAATATTGGG + Intergenic
1146102668 17:29999685-29999707 GGCTCTTTTTTTTTAGTATTTGG + Intronic
1147807143 17:43139891-43139913 ACATCTTTTGTTCTAACGTTTGG + Intergenic
1148169041 17:45504153-45504175 ACATCTTTTGTTCTAACATTTGG + Intergenic
1148279778 17:46338855-46338877 ACATCTTTTGTTCTAACATTTGG - Intronic
1148301996 17:46556711-46556733 ACATCTTTTGTTCTAACATTTGG - Exonic
1148366481 17:47059224-47059246 ACATCTTTTGTTCTAACGTTTGG - Intergenic
1149385061 17:56134568-56134590 GAATCTTTAGTTCTAATATTTGG - Intronic
1149390789 17:56188704-56188726 TCATCTTTTGTGCTAATATTTGG + Intronic
1150400234 17:64850619-64850641 ACATCTTTTGTTCTAACATTTGG + Intergenic
1150596581 17:66611036-66611058 GACTTTTTTGTTCTAATATTTGG - Intronic
1151790286 17:76301239-76301261 GGCTCATTTGTTGTAATGTTAGG - Intronic
1151851173 17:76690927-76690949 GCATGTTTTGTTCTAACATTTGG + Intronic
1152851842 17:82641416-82641438 CAATCTTTTGTTATAATATTGGG + Intronic
1153062568 18:1009175-1009197 GGATTTTTTGTTCCAAAATGGGG + Intergenic
1153099214 18:1445809-1445831 GCATTTTTTATTCTAATATTTGG - Intergenic
1153717217 18:7862184-7862206 GCAAATTTTGTTTTAATATTTGG - Intronic
1153775343 18:8448334-8448356 TAATCTTTTGTTCTAATATTTGG - Intergenic
1154359915 18:13651621-13651643 TGTTCTTTTGTTTTAAAATTAGG - Exonic
1154472686 18:14720443-14720465 GCATCTTTTGTTTCAATATTTGG - Intergenic
1155151550 18:23127351-23127373 ACATCCTTTGTTCTAATATTTGG + Intergenic
1155760298 18:29556776-29556798 ACATCATTTGTTCTCATATTTGG - Intergenic
1156213037 18:34967627-34967649 GCATCTTTTGTGCTGATGTTTGG - Intergenic
1156741553 18:40336528-40336550 GACTCTTTTCTTCAAATATTGGG - Intergenic
1156790732 18:40970338-40970360 AGATTTTTTTTTTTAATATTAGG - Intergenic
1156868122 18:41911833-41911855 ACATCTTTTGTTTTAATATTTGG + Intergenic
1157705669 18:49803704-49803726 GATTCTTTTATTCTAATACTAGG - Intronic
1157775619 18:50393706-50393728 ACATCTTTTGTTCTAGTATTTGG + Exonic
1157996566 18:52564648-52564670 ATATCTTTTATTATAATATTGGG + Intronic
1158365652 18:56731982-56732004 GTATCATTTGTTTTAAAATTAGG + Intronic
1158881062 18:61780152-61780174 ATATCTTTTGTTCAAGTATTTGG + Intergenic
1159131812 18:64288383-64288405 GAATCTTTTCTTCTAATATTTGG + Intergenic
1160490182 18:79330967-79330989 GTATCTTATGTTCTAATTTTAGG - Intronic
1160648387 19:206247-206269 GCATCTTTTGTTTTAATATTTGG + Intergenic
1161774704 19:6253921-6253943 GCCTGTTTTGTTTTAATATTGGG + Intronic
1161884011 19:6979424-6979446 AAATCTTTTGTTCTGATATTTGG + Intergenic
1162055568 19:8061694-8061716 TGGCCTTTTGTGCTAATATTTGG - Intronic
1162712115 19:12603199-12603221 GTATCTTTTGTTAAAATATTTGG + Intronic
1163739430 19:19001959-19001981 GGATCTTTTGTTATAAATGTGGG - Intronic
1163960800 19:20689906-20689928 GGCCATATTGTTCTAATATTTGG + Intronic
1164553676 19:29233414-29233436 GGATCTTACGATCTAATAATGGG - Intergenic
1165284009 19:34823471-34823493 GGTGCTTTTCTTCTAATACTGGG + Intergenic
1165508399 19:36249813-36249835 GGATCATTTGTTCTAATATCTGG - Intergenic
1165632144 19:37310967-37310989 GGATCATCTGTTCTAATATCTGG + Intergenic
1166128636 19:40731932-40731954 CAATCTTTTGTTATAATTTTAGG - Intronic
1166175807 19:41068769-41068791 GAATCTATTGTTCTAATGTTTGG + Intergenic
1167972867 19:53199651-53199673 GAATCTTTGGTTCTCATATTTGG - Intergenic
1168455627 19:56506194-56506216 GTATCTTTTGTTAAAATATCTGG + Intergenic
1168496643 19:56857360-56857382 GGAACTGTTCTTTTAATATTTGG - Intergenic
1168638718 19:58016218-58016240 GGATCTCTTGTTCTAATGACTGG - Intergenic
1202646421 1_KI270706v1_random:146089-146111 GCATCTTCTGTTTCAATATTTGG + Intergenic
926160280 2:10482930-10482952 GAATCTTTGGTTCTAATATTCGG - Intergenic
926160292 2:10483012-10483034 GAATTTTTTGTTCTAACATTTGG - Intergenic
926208617 2:10852012-10852034 AGATCTTTTGTTAGGATATTTGG + Intronic
926961861 2:18365779-18365801 GGGTCTTTTGTTATAATATAAGG - Intergenic
927108118 2:19844990-19845012 GCATCTTTTGTGCTCATAGTGGG - Intergenic
927745440 2:25615560-25615582 GAATCTTTTGTTCTAGTATTTGG - Intronic
927898013 2:26797892-26797914 AGTTCTTTTGTTGTAATATTGGG + Intronic
928046989 2:27944639-27944661 GGATTTTTTTTTCTATTTTTTGG + Intronic
928338831 2:30423813-30423835 GGGTCTTTTGTTCAAATAGCAGG - Intergenic
928746161 2:34418510-34418532 TCATCTTTTGTTCTAACATTTGG + Intergenic
929421835 2:41798627-41798649 GGCACTTTTCTTCTAAGATTGGG - Intergenic
930765766 2:55083885-55083907 GCATTCTTTGTTCTAATATTTGG + Intronic
931297658 2:60944829-60944851 GGATTTTTTTTTTTAATATGAGG - Intronic
932081368 2:68718706-68718728 GCATCATTTGTTCTAACATTTGG + Intronic
932535716 2:72592746-72592768 GCATCTTTAGTTATAATATTTGG + Intronic
933011537 2:77070582-77070604 GTATCTTTTTTTATAACATTAGG + Intronic
934692058 2:96369369-96369391 CGAGCTTTTGTTCTAACAGTTGG + Intronic
935294975 2:101640895-101640917 GGATTTTTTCCTCAAATATTAGG + Intergenic
935530561 2:104228028-104228050 GGATATTTTGTTTTAAAATGTGG - Intergenic
936051739 2:109229093-109229115 GTATCTTTTGTTCTGATATTTGG - Intronic
936492924 2:112989545-112989567 GAAGCTTTTATTCTAAGATTTGG - Intergenic
937088413 2:119187455-119187477 GAATCTTTTGTTCTAATATCTGG - Intergenic
937088422 2:119187537-119187559 TAATCTTTTGTTCCAATGTTTGG - Intergenic
938643941 2:133311763-133311785 TAACCTTTTGTTCTAATATTTGG - Intronic
938739111 2:134214160-134214182 GTGTCTTTTGTTATAATATTTGG + Intronic
938739168 2:134214627-134214649 GTATCTTTTGTTATAATATTTGG - Intronic
939039586 2:137172190-137172212 GAATCTTTTGTTTTCATAGTTGG + Intronic
939203082 2:139063265-139063287 GCATCTTTTATTATAGTATTTGG - Intergenic
939369009 2:141273886-141273908 AGATCCTTTGTTTTTATATTGGG - Intronic
939844252 2:147224134-147224156 ATATCTTTTGTTATAATATTTGG + Intergenic
940549799 2:155139685-155139707 TCATCTTTTGTTATAATATTGGG + Intergenic
940663951 2:156583838-156583860 GAATCTTTTGTTATCATATGTGG - Exonic
941496893 2:166216297-166216319 GGAGCTTTTCTTCTAAGATCAGG + Intronic
941532000 2:166681942-166681964 GTATCTTTCTTTATAATATTTGG + Intergenic
942221229 2:173770802-173770824 GAATCTTTTGTTCCGATATTTGG - Intergenic
942769022 2:179493956-179493978 GAAACTTGTGTTCTAATATGGGG + Intronic
942814920 2:180041787-180041809 TAACCTTTTGTTCTAATATTTGG + Intergenic
942871338 2:180737789-180737811 GTATCTTTTGTCGTAATATTTGG - Intergenic
943273355 2:185836362-185836384 AGAACTTATGTTGTAATATTGGG + Intergenic
943347555 2:186757306-186757328 GTGTCTTTTGTTCTATTATGTGG - Intronic
943619371 2:190131102-190131124 GAATCTTTTGTTCTAATATTTGG + Intronic
943679121 2:190749229-190749251 GCATCTTTTGTTTTATTGTTTGG - Intergenic
944048411 2:195439412-195439434 GCATCTTTTGTTATAATATTTGG - Intergenic
944535734 2:200707710-200707732 GAATCTTTGGTTTTAACATTTGG - Intergenic
945082180 2:206097325-206097347 GCGTCGTTTGTTCTAATATTTGG - Intergenic
945174506 2:207028974-207028996 GGATCTTTTGTACACATTTTGGG - Intergenic
945363293 2:208918648-208918670 GAATCTTCTGTTTAAATATTTGG - Intergenic
945491952 2:210466455-210466477 GGTTCCTTTGTTCTTATACTAGG - Intronic
945675406 2:212850178-212850200 GTATCTTTTGTCCTAATATTTGG + Intergenic
946082184 2:217130579-217130601 GCATCTTTCGTTCTAATATTTGG - Intergenic
946220148 2:218218511-218218533 GGATTTTGGGTTCTAATTTTTGG + Intronic
946521046 2:220465103-220465125 GGAACTTTTGTTTTTAAATTTGG + Intergenic
947163994 2:227242662-227242684 CCATCTTTTGTTCTAATATTTGG - Intronic
948083532 2:235227147-235227169 GAATCTTTTGTTCTAATGTTTGG - Intergenic
1169469714 20:5873747-5873769 GCATCTTTTGTTCTAATATTTGG + Intergenic
1169860677 20:10148229-10148251 ACATCTTTTGTTCGAATATATGG + Intergenic
1170081089 20:12476938-12476960 GGATGCTTTTTTATAATATTGGG - Intergenic
1170166263 20:13362917-13362939 GAATCTTTTGTTCTAATATTTGG + Intergenic
1170166279 20:13363001-13363023 GAATCTTTTGTTCTAATATTTGG + Intergenic
1170209578 20:13835365-13835387 GTGTCTTTTACTCTAATATTTGG + Intergenic
1170314519 20:15028549-15028571 GGATCTGTCCCTCTAATATTAGG + Intronic
1170653826 20:18267830-18267852 GAATCTATTGTTGTAATATTTGG + Intergenic
1171098272 20:22354417-22354439 GCATCTTTTGTATTAGTATTTGG + Intergenic
1171538214 20:25917565-25917587 TTGTCTTTTGTTATAATATTGGG - Intergenic
1171802927 20:29643876-29643898 CAGTCTTTTGTTATAATATTGGG + Intergenic
1172073232 20:32274326-32274348 GGCTCTTTTGTTCTACTCTGTGG - Intergenic
1172308717 20:33900508-33900530 GAATCTTTTGTTCTGATATTCGG + Intergenic
1172365580 20:34346571-34346593 AAATCTTTTGTTAAAATATTTGG - Intergenic
1172410755 20:34721074-34721096 CCATCTTTTGTTAAAATATTTGG + Intronic
1172561886 20:35896372-35896394 GGATCTTTTTTTAAAAAATTAGG - Intronic
1172863222 20:38073611-38073633 GAAGCTTTTGTTTCAATATTAGG + Intronic
1173061318 20:39664442-39664464 GAATCTTGTCTTCTAATGTTTGG + Intergenic
1173894256 20:46538350-46538372 GAACCTTTTGTTCTAATATTTGG + Intergenic
1174766732 20:53261425-53261447 GGATGTTCTTTTTTAATATTAGG - Intronic
1175972688 20:62694740-62694762 GAATCTTTTGTTCTGATACTTGG - Intergenic
1176580882 21:8524502-8524524 CAGTCTTTTGTTATAATATTGGG + Intergenic
1176605450 21:8826668-8826690 GCATCTTCTGTTTCAATATTTGG - Intergenic
1176801803 21:13437415-13437437 GCATCTTTTGTTTCAATATTTGG + Intergenic
1177591965 21:23183163-23183185 GAATACTTTGTTCTAATATTTGG + Intergenic
1178032388 21:28542725-28542747 GAATCTTTTGTTCTAATGTTTGG + Intergenic
1179041906 21:37810853-37810875 GCATCTTTTGTTCTAATATTTGG + Intronic
1180347745 22:11718273-11718295 GCATCTTCTGTTTCAATATTTGG - Intergenic
1180355521 22:11836378-11836400 GCATCTTCTGTTTCAATATTTGG - Intergenic
1180382731 22:12155947-12155969 GCATCTTCTGTTTCAATATTTGG + Intergenic
1182656733 22:31896640-31896662 GTAACTTTTGTTCTCATCTTTGG + Intronic
1182746721 22:32611597-32611619 AGATCTTTTGTACAATTATTGGG + Intronic
1182852854 22:33491077-33491099 GGATCTTCTCTTGTAAAATTAGG + Intronic
1184075908 22:42177807-42177829 GCATCTTTTCTTCTAATATTTGG + Intronic
1184908331 22:47507875-47507897 GGATTGTTTTTTCTAATTTTGGG - Intergenic
949825471 3:8160023-8160045 TGGTCTTTTGTTATAATGTTGGG - Intergenic
951257017 3:20461682-20461704 GGTTCTTTTCTGCTTATATTCGG + Intergenic
951883108 3:27498697-27498719 GCATCTTTTGTTCTAATATTTGG + Intergenic
951991139 3:28677277-28677299 GAATCCTTTGTTATAATATTTGG - Intergenic
953009094 3:39007336-39007358 GCACCTTTTGTTATAACATTGGG + Intergenic
953201866 3:40784982-40785004 GGATCTTTCATTCTAATAAGGGG + Intergenic
953573053 3:44087782-44087804 GGATCTTTTGTTCTAATATTTGG - Intergenic
954758172 3:52854167-52854189 GGAGTTTTTGTTCTAGTATTTGG + Intronic
955383618 3:58461136-58461158 GTATCTTTTGTTCTAATATTTGG + Intergenic
955506722 3:59639928-59639950 GAATCTTTTGTTCTGGTATTGGG - Intergenic
955566996 3:60258171-60258193 GGAAATTTTATTGTAATATTTGG - Intronic
955654241 3:61227637-61227659 GGTTCTTTTTCTCTAATATTTGG + Intronic
956275952 3:67501486-67501508 GAATCTTGTGTTCTAACATTTGG + Intronic
956400585 3:68875251-68875273 GAATCATTTGTTCTCATCTTTGG + Intronic
957235617 3:77585539-77585561 CTATCTTTTGTTCAAATAGTTGG + Intronic
957269948 3:78016995-78017017 TGATCAATTGTTCTAATTTTAGG - Intergenic
957992353 3:87642804-87642826 AGCTCTTTTGTACAAATATTTGG - Intergenic
958264878 3:91426577-91426599 GCATCTTTTGTTCTAATATTTGG + Intergenic
959578673 3:107962108-107962130 GCATCTTGTATTTTAATATTTGG - Intergenic
960615394 3:119591463-119591485 TAATCTTTTGTTCAAATATTTGG - Intergenic
960788696 3:121402017-121402039 GGACTTTTTGTTCAAAAATTGGG - Intronic
960843303 3:121982514-121982536 GGATTTTTGCTTCTAATTTTAGG + Intergenic
961173252 3:124814049-124814071 GAATCTTTTGTTATTATATTTGG - Intronic
961227330 3:125263649-125263671 GCATCTTTTGTTCTAATATTTGG + Intronic
961694346 3:128693939-128693961 CAATCTTTTGTTCTAACATTTGG - Intergenic
961763114 3:129186220-129186242 GAAATTTTTGTTTTAATATTAGG - Intergenic
962182367 3:133221416-133221438 GAATCTTTTGTTCTAATATTTGG - Intronic
962680998 3:137800316-137800338 GGTCTTTTTTTTCTAATATTTGG - Intergenic
962712443 3:138099457-138099479 GCACCTTTTGTAATAATATTTGG + Intronic
963155022 3:142087007-142087029 GTATCTTTTGTTGTAATATTTGG - Intronic
963334654 3:143960455-143960477 AGATCTTTTATTTGAATATTTGG + Intergenic
963361432 3:144277808-144277830 GGATATTTTATTTTTATATTAGG - Intergenic
963466568 3:145689394-145689416 GCATCTTTGGTTATAATATTTGG + Intergenic
963791388 3:149586548-149586570 GAATCTTTGGTTTTAATATTTGG + Intronic
964240300 3:154585217-154585239 CAATCTTTTATTCTAATATTTGG + Intergenic
964256466 3:154780044-154780066 GAATCTTTTGTTTTAATAACAGG - Intergenic
964671023 3:159226408-159226430 GCATCTTTCGTTATAATATTTGG - Intronic
964914110 3:161818443-161818465 TAATTTTTTGTTCTAATATTTGG - Intergenic
965110947 3:164421412-164421434 CTATCTTTTCTTCTAATATTGGG - Intergenic
965122079 3:164572891-164572913 GGATTTATTTTTCTAATATTTGG + Intergenic
965208239 3:165749715-165749737 GGATCATTTTATCTAATGTTTGG + Intergenic
965306057 3:167065045-167065067 GCAATCTTTGTTCTAATATTTGG + Intergenic
966732963 3:183165584-183165606 GAATCTTTTGTTTTAATACTTGG - Intergenic
966765001 3:183453022-183453044 GGGTACTTTGTTCTAAGATTTGG + Intergenic
966985591 3:185177467-185177489 GGATCATTTGTTCTATAATTAGG + Intergenic
967776482 3:193391404-193391426 GAATCCTTTGTTCTAGTATTTGG - Intergenic
968097732 3:195943742-195943764 GGAGCTGATGTTCTAATTTTAGG - Intergenic
968304560 3:197641042-197641064 GGAGCTGATGTTCTAATTTTAGG - Intergenic
968363332 3:198164943-198164965 GCATCTTGTGTTCTAATATTTGG + Intergenic
968369461 3:198213868-198213890 GCATCTTTTGTTTTAATATTTGG - Intergenic
968723687 4:2228080-2228102 AGAGCTTTTGTGCTAATATTCGG + Intronic
970185700 4:13450290-13450312 GGATTTTATGTTATAATTTTAGG - Intronic
971108032 4:23548727-23548749 AGATCTTTCATTCTAATTTTAGG + Intergenic
971400176 4:26268974-26268996 TGCTCTTTTTCTCTAATATTCGG + Intronic
971743254 4:30546902-30546924 GGATCTTATGTTATAAACTTTGG - Intergenic
971787947 4:31129495-31129517 GGCTCTTTTGTGCTAAAATAAGG + Intronic
971956759 4:33430367-33430389 GCATCTTTTTTTCTATCATTGGG - Intergenic
971970251 4:33610267-33610289 GGATTTTTTTTTATAATTTTGGG - Intergenic
972586477 4:40441768-40441790 GGATTTTTTCTTATATTATTGGG - Intronic
973372649 4:49264236-49264258 GCATCTTCTGTTTCAATATTTGG + Intergenic
973388343 4:49530824-49530846 GCATCTTCTGTTTCAATATTTGG - Intergenic
974666870 4:64973195-64973217 GGATCACTTGTAATAATATTTGG - Intergenic
974855876 4:67459850-67459872 GGATATTTTGTTATTACATTTGG - Intergenic
975536736 4:75459138-75459160 GAATCTTTTGTTCTAGTATTTGG + Intergenic
976808077 4:89070997-89071019 GAATCTTTTGTTAAAATATTTGG + Intronic
976865738 4:89723997-89724019 TCATCTTTTGTTCTAATATTTGG - Intergenic
976913529 4:90339861-90339883 GTATCTTTTGCTCCAGTATTGGG - Intronic
977340242 4:95749115-95749137 GCATCTTTTGTTCTAATATCTGG + Intergenic
978232165 4:106412701-106412723 AGATCTTTTGTTCTAATGTTTGG - Intergenic
979257885 4:118623582-118623604 ACATCTTTTGTTTTAATATTTGG - Intergenic
979330465 4:119416982-119417004 ACATCTTTTGTTTTAATATTTGG + Intergenic
979933307 4:126659946-126659968 GTATGTTTTCTTCTAATAATTGG - Intergenic
980011854 4:127604776-127604798 TGATCTTATTTTCTAATATCTGG - Intergenic
981231092 4:142356669-142356691 GCATCTTTTGTCCTTTTATTTGG + Intronic
981592368 4:146377624-146377646 GACTCTTTTGTTCTAATATATGG - Intronic
982111278 4:152057645-152057667 AAATCTTTTATTCTAAGATTAGG - Intergenic
983626179 4:169804122-169804144 GCATCTTTGGTTATAATATTTGG + Intergenic
983867882 4:172789861-172789883 GAGTCTTTTGTTATAATGTTGGG - Intronic
983873660 4:172851285-172851307 GAATCTTAGGTTCTAATATTTGG - Intronic
984425323 4:179577462-179577484 AGAACTTTTTATCTAATATTAGG + Intergenic
985506776 5:285999-286021 GGAGCTGTTGTTCTAGTTTTAGG + Intronic
986512675 5:8524916-8524938 AAATCTTTTGTTATTATATTGGG + Intergenic
986531582 5:8742233-8742255 GTATCTTTTGTTCTAAAATCGGG - Intergenic
987421032 5:17720127-17720149 GCTTCTTTAGTTCTCATATTTGG - Intergenic
987907805 5:24101265-24101287 AGATCTTTTATTCTAATTTATGG - Intronic
988137731 5:27196798-27196820 GTATATTTTGTTCTGATATTTGG + Intergenic
988280727 5:29143300-29143322 GAATCTTCTGTTCCAATATTTGG + Intergenic
988829969 5:34977722-34977744 GCACCTTTTTTTCTATTATTTGG - Intergenic
989126135 5:38054160-38054182 GAATCTTTTGTTCTAATATTTGG + Intergenic
989381173 5:40810751-40810773 AAATCTTTTCCTCTAATATTTGG - Intergenic
989800842 5:45536999-45537021 GGAGATTTTGTACTAAAATTTGG + Intronic
990156648 5:52885455-52885477 GTATCTTTTGTTCTAATATATGG - Intronic
991532864 5:67634978-67635000 GCACCTTTTCTTCTAATAGTGGG + Intergenic
991917046 5:71615694-71615716 GGCTCTTTTGTTCCAATATTTGG + Intronic
991917059 5:71615776-71615798 GAATCTTTTGTTCTATGATTTGG + Intronic
991947171 5:71910514-71910536 ACATCTTTTATTATAATATTTGG + Intergenic
992302446 5:75397306-75397328 GGATTTTTTTCTCTAATATATGG - Intronic
992556182 5:77905922-77905944 GCATTTTTTATTCTAATATTTGG + Intergenic
992872379 5:81019983-81020005 TGAGCTTGTGTTCTCATATTGGG + Intronic
993210947 5:84950806-84950828 GCATCTTTTGTTCTAACATTTGG + Intergenic
993721454 5:91325226-91325248 GGTTCTTTCTGTCTAATATTGGG + Intergenic
994265537 5:97711548-97711570 GGATCTTTAGGACTAAGATTAGG + Intergenic
995100023 5:108289347-108289369 CCATTCTTTGTTCTAATATTTGG + Intronic
995130355 5:108623778-108623800 CAATCTTTTGTTATAATTTTGGG + Intergenic
995481739 5:112599868-112599890 AGACCTTTTCTTCTAATAGTAGG + Intergenic
996041252 5:118814856-118814878 GGGTCTTTTGTGCTAATGTATGG - Intergenic
996092476 5:119364344-119364366 GCATCTTTTGTTGTAATATTTGG - Intronic
996101111 5:119446890-119446912 TGATCTTTTGTTTTAAATTTGGG - Intergenic
996458148 5:123708775-123708797 TTATCATTTGTTTTAATATTTGG - Intergenic
996700334 5:126444432-126444454 AGATTTTTTGTTCTAAGAATTGG + Intronic
997837914 5:137211485-137211507 GAATGTTTTGTTCTACTATTTGG + Intronic
998088346 5:139345374-139345396 GAATTTTTTGTTTTACTATTTGG - Intronic
999011459 5:148045684-148045706 TGATTTTTTTTTCTAAAATTAGG + Intronic
999208122 5:149864702-149864724 GGATTTGCTGTTCTTATATTGGG - Intronic
999267442 5:150276104-150276126 GCATCTTTTGTTCTAATATTTGG - Intronic
999808465 5:155106100-155106122 GTATCTTTTTTTCTAATTTGGGG + Intergenic
1000456452 5:161455473-161455495 GGACCTTTTGTTCTATTATCTGG - Intronic
1001945125 5:175772317-175772339 GGATCTTTGGTTCTGATATTTGG - Intergenic
1001974364 5:175984757-175984779 GAATCTTTTGTTGTAACAGTTGG - Intronic
1002124057 5:177028592-177028614 GTATCTTCTGTTAAAATATTTGG + Intronic
1002243070 5:177859022-177859044 GAATCTTTTGTTGTAACAGTTGG + Intergenic
1003238231 6:4317736-4317758 GAATATTTTGTCCTAATATTTGG + Intergenic
1003507697 6:6753133-6753155 ACATCTTTTGTTCTAACGTTTGG + Intergenic
1003946544 6:11081074-11081096 GCACCTTTTATTCTAATATTTGG - Intergenic
1004435271 6:15586524-15586546 GGATTTTTTTTTTTAATTTTGGG - Intronic
1004507228 6:16256773-16256795 GAATCTTTTGTTCTAATATTTGG + Intronic
1004601067 6:17150388-17150410 AAATCTTTTGTTCTAATGTTTGG - Intergenic
1004699591 6:18066547-18066569 CAATCTTTTGTTATAATATTGGG + Intergenic
1004801911 6:19157797-19157819 TAATTTTTTGTTCTAATGTTAGG - Intergenic
1005023098 6:21436340-21436362 GGATTTTTTTTTCTTATATAGGG - Intergenic
1005360496 6:25027080-25027102 TGCTTTTTTGTTTTAATATTTGG - Intronic
1005410307 6:25538588-25538610 GCATCTTTTGTTATAGTATTTGG + Intronic
1005818626 6:29578418-29578440 GAGTCTTTTGTTCTAATATTTGG + Intronic
1005879646 6:30046023-30046045 CGGTCTTTTGTAATAATATTGGG - Intergenic
1007360106 6:41349288-41349310 TAATCTTTTGTTCTCATATTTGG + Intronic
1008008625 6:46439337-46439359 GGAGCTTTTGAACTGATATTTGG - Intronic
1008095401 6:47334740-47334762 GAATCTTTTGTTCTAATATTTGG + Intergenic
1008897620 6:56575762-56575784 GAATCTTTTGTTCTGATATTTGG + Intronic
1008990509 6:57596083-57596105 GCATCTTCTGTTCTAATATTTGG - Intronic
1009179082 6:60494629-60494651 GCATCTTTTGTTCTAATATTTGG - Intergenic
1009756736 6:67949650-67949672 GTATCTTTTTTTCTATTGTTTGG + Intergenic
1010065183 6:71674146-71674168 GAATCTTTTGTTCTAATATTTGG - Intergenic
1010207874 6:73339126-73339148 GGATCTATTTTTCTTAGATTTGG - Intergenic
1010248931 6:73688335-73688357 GAATCTTTCATTCTAATGTTTGG + Intergenic
1010248937 6:73688417-73688439 GAATCTTTTGTTCTAATATTTGG + Intergenic
1010868418 6:81008607-81008629 ATATCTTTTGCTATAATATTTGG + Intergenic
1011118911 6:83928060-83928082 GAATCTTCTATTCTAATATTTGG - Intronic
1011356400 6:86476545-86476567 GGAGCTTTCTTTCTAATATCTGG - Intergenic
1011449860 6:87481104-87481126 TGATCTTTTGTTTTAAATTTGGG + Intronic
1012219081 6:96626312-96626334 GGATCAATTGTGCTTATATTTGG - Intergenic
1012709827 6:102584858-102584880 AGATGTCTTGTTCTAATATGTGG - Intergenic
1013238256 6:108218597-108218619 GGACATTTTGTTCTACTTTTTGG - Intronic
1013395573 6:109735603-109735625 GGATAATTTTTTTTAATATTAGG + Intronic
1013587277 6:111590916-111590938 GTATTTTTTGTTCTAATCTTTGG - Intronic
1013971920 6:116030361-116030383 GCATATTTTATTTTAATATTTGG - Intronic
1014096596 6:117468197-117468219 CAATCTTTTGTTATAATGTTGGG - Intronic
1015009560 6:128328618-128328640 AGAACCTTTGTTCTAATATAAGG - Intronic
1015976759 6:138798456-138798478 GAATCTTTTGTTCTAATATTTGG - Intronic
1016487562 6:144558823-144558845 TAGCCTTTTGTTCTAATATTGGG - Intronic
1016909324 6:149181748-149181770 GGATTTATTGCTGTAATATTAGG + Intergenic
1017234405 6:152104682-152104704 GGCTCTTTTGTTCTAATATTTGG + Intronic
1017358153 6:153534488-153534510 GCATCTTTTGTTCTAATGAGGGG - Intergenic
1017801232 6:157898030-157898052 GTATCTTTTGTTCTGATATTTGG - Intronic
1018047186 6:159975589-159975611 TGGTCTTTTGTTATAATGTTGGG - Intronic
1018082330 6:160269491-160269513 GCATCTTTTATTCTGATGTTTGG + Intronic
1019252367 7:23730-23752 GCATCTTGTGTTCTAATATTTGG - Intergenic
1020181741 7:5927963-5927985 GCATCTTTTGTTCTAATATTTGG - Intronic
1020301191 7:6796977-6796999 GCATCTTTTGTTCTAATATTTGG + Intronic
1020468747 7:8511568-8511590 TCTTCTTTTGTTCTACTATTAGG - Intronic
1021105852 7:16638830-16638852 GCATCTATTGTTCTAATATTTGG - Intronic
1021583245 7:22179027-22179049 GCATCTTTTGTTTTAGTATTTGG - Intronic
1021881759 7:25101803-25101825 GTATTTTTTTTTCTAATAGTAGG - Intergenic
1021991355 7:26144408-26144430 GCATCTTTTGTTATGATATTTGG + Intergenic
1022194419 7:28050158-28050180 ATATCTTTAATTCTAATATTTGG - Intronic
1022228679 7:28391721-28391743 TGATTTGTTGTTCTGATATTTGG - Intronic
1022271534 7:28812511-28812533 GGATCTTTTTTTCTGGTTTTGGG - Intronic
1023399873 7:39784868-39784890 ACATCTTTTGTTTTAATATTTGG - Intergenic
1023426269 7:40039911-40039933 GGAACTTTTTTTCTACTCTTAGG + Intronic
1023437684 7:40155521-40155543 GGATCTTGTCTTCTAATGTTGGG - Intronic
1023551979 7:41379919-41379941 GGAAGTTTTATTCTAACATTGGG - Intergenic
1024072810 7:45800657-45800679 ACATCTTTTGTTTTAATATTTGG - Intergenic
1024165805 7:46728795-46728817 GGAACTTTTGTGCTGAGATTAGG - Intronic
1024445233 7:49470143-49470165 GCATCTTGTTTTGTAATATTTGG + Intergenic
1024650530 7:51399523-51399545 ACATCTTTTGTTTTAATATTTGG + Intergenic
1025132720 7:56385332-56385354 ACATCTTTTGTTTTAGTATTTGG + Intergenic
1025289670 7:57704392-57704414 CAGTCTTTTGTTATAATATTGGG - Intergenic
1025754313 7:64321431-64321453 ACTTCTTTTGTTCTAAAATTAGG - Intronic
1025804678 7:64819529-64819551 GGATATTTTGTTGTATTTTTAGG + Intronic
1025909772 7:65818994-65819016 GCACCTTCTGTTTTAATATTTGG - Intergenic
1025911268 7:65830741-65830763 GCATCTTTTGTTTTAATATTTGG - Intergenic
1025978392 7:66387714-66387736 GCATCTTTTGTTTTAATATTTGG + Intronic
1026629893 7:72029105-72029127 GCATCTTTTGTTCTAATATTTGG + Intronic
1026861505 7:73793033-73793055 GAATCTTTAGTTCTAATATTTGG - Intergenic
1027203970 7:76082385-76082407 GCATCTTTTGTTTTAATATTTGG + Intergenic
1027414324 7:77958877-77958899 GAATCTTTTCTTCTAATATTTGG - Intergenic
1027785767 7:82577182-82577204 GAATCTTTTGTTCTGATATTTGG + Intergenic
1027866610 7:83656047-83656069 GAATCTGTTGTTTTATTATTGGG + Intergenic
1028235818 7:88360729-88360751 GCATCTTTTGTTCTAATATTTGG + Intergenic
1028446254 7:90927385-90927407 GCATCTTTTGTTATAATATTTGG - Intronic
1029029003 7:97449104-97449126 GAATCTTTTGTCCTATTACTTGG - Intergenic
1029263485 7:99320490-99320512 ACCTCTTTTGTTATAATATTTGG + Intergenic
1029263548 7:99320926-99320948 ACATCTTTTGTTATAATATTTGG + Intergenic
1029289497 7:99491365-99491387 GCATCTTTTCTTATCATATTTGG + Intronic
1029791259 7:102845325-102845347 GTATCTTTTGTTCTAATATTTGG - Intronic
1029937166 7:104438092-104438114 GCATCTTTTGTTCTAATATTTGG - Intronic
1031353824 7:120766182-120766204 GAATATTTTGTTCTAATATTTGG - Intergenic
1031461013 7:122048827-122048849 GGATTTTTTATGCTAACATTTGG - Intronic
1032050188 7:128644340-128644362 ACATCTTTTGTTTTAATATTTGG - Intergenic
1032658479 7:133956465-133956487 GGCTGGTTTGTTCTAATACTAGG - Intronic
1032670083 7:134074437-134074459 GAATCTTTTATCCTAATTTTGGG + Intergenic
1033021456 7:137729208-137729230 TTATCTTTTTTTCTTATATTTGG - Intronic
1033079175 7:138279050-138279072 GAATCTTTTATTCTAATATTTGG + Intergenic
1033096708 7:138438633-138438655 GTACCTTTTGTTCTAATATTTGG + Intergenic
1033458585 7:141524979-141525001 GCATCTTTTATTCTAATATTTGG + Intergenic
1033501567 7:141955716-141955738 GTATCTTTTGTTGTATTTTTTGG - Intronic
1033568295 7:142601440-142601462 GGATCCTTGGTTCAAATATTTGG - Intergenic
1036007785 8:4686750-4686772 GGATCTTTTCTTCTGATCTTAGG - Intronic
1036141584 8:6214067-6214089 GGATCTTAGATTCTAATATAAGG - Intergenic
1037667275 8:20980975-20980997 AGATCTTTTATTCTAATATTTGG + Intergenic
1037695255 8:21217794-21217816 AACTCTTTTGTTCTGATATTTGG - Intergenic
1038820509 8:30947871-30947893 GAATCTTTTGTTCTAATATTTGG + Intergenic
1038820528 8:30948017-30948039 GCATCTTTTGGTCTAAAATGTGG + Intergenic
1038865473 8:31434718-31434740 GAATCTTTTGTTCTAATATTTGG + Intergenic
1039266328 8:35828148-35828170 GTATCTTTTGTTCTACTTTTTGG - Intergenic
1039339640 8:36633429-36633451 CTTTCTTTTGTTCTAATTTTTGG + Intergenic
1039991805 8:42494708-42494730 GGATATTTTATTCAACTATTAGG + Intronic
1040932415 8:52748791-52748813 GAATCTTTTGTTCTAATATTTGG - Intergenic
1041507150 8:58612034-58612056 CCATCTTTTGTTCTAATATTTGG + Intronic
1041548584 8:59075478-59075500 TGACCTTTTGTTCTAACATGAGG + Intronic
1042096103 8:65217595-65217617 GAATCTTTTGTTCTAATATATGG + Intergenic
1042897927 8:73691789-73691811 AGCATTTTTGTTCTAATATTTGG + Intronic
1043824722 8:84912263-84912285 GCATCTTTCATTATAATATTTGG - Intronic
1044103619 8:88173394-88173416 AGAGTTTTTTTTCTAATATTAGG - Intronic
1044448549 8:92306883-92306905 GCATCATTTTTCCTAATATTAGG + Intergenic
1044606782 8:94054692-94054714 GAATCTTTTGTTCTAATATTTGG - Intergenic
1044702597 8:94977981-94978003 ACATCGTTTGTTCTAATACTTGG + Intronic
1045302716 8:100927921-100927943 GGTTCTTTTGGTCTATCATTAGG - Intronic
1045347914 8:101311141-101311163 GAGTCTTTTGTTCTAAAATTTGG - Intergenic
1046544372 8:115630010-115630032 TGATCTTTTGTTTTAATCTTTGG - Intronic
1046592952 8:116227774-116227796 TGAAGTTTTGTTCTAATTTTGGG - Intergenic
1047059616 8:121209981-121210003 GTATCTTTTATTCTGATATAAGG - Intergenic
1047093262 8:121596634-121596656 CGTTCTTTTGTTATAATGTTGGG + Intergenic
1047249463 8:123170807-123170829 GTACCTTTTGTTGTAATATTTGG + Intergenic
1047572077 8:126110193-126110215 GAATATTTTGTTCTAATGTTTGG + Intergenic
1050448502 9:5753834-5753856 GGATCTTGTGTTGAAATAGTTGG + Intronic
1052816914 9:33108945-33108967 GAATCTTTTGTTCTAATATTTGG + Intronic
1053608612 9:39686751-39686773 GTATCTTTTGTTCTTATATTTGG + Intergenic
1053655845 9:40217741-40217763 CCATCTTTTGTTTGAATATTTGG - Intergenic
1053866464 9:42443109-42443131 GTATCTTTTGTTCTTATATTTGG + Intergenic
1053906200 9:42846949-42846971 GCATCTTTTGTTTGAATATTTGG - Intergenic
1054244913 9:62655659-62655681 GTATCTTTTGTTCTTATATTTGG - Intergenic
1054352226 9:64027774-64027796 GCATCTTCTGTTTCAATATTTGG - Intergenic
1054367958 9:64363968-64363990 GCATCTTTTGTTTGAATATTTGG - Intergenic
1054528762 9:66158549-66158571 CCATCTTTTGTTTGAATATTTGG + Intergenic
1054559038 9:66690190-66690212 GTATCTTTTGTTCTTATATTTGG - Intergenic
1054675579 9:67853712-67853734 CCATCTTTTGTTTGAATATTTGG - Intergenic
1055456428 9:76476494-76476516 AGATCTTTTATTCTCATTTTTGG + Intronic
1056339536 9:85612092-85612114 ACATCTTTTGTTCTAATATTTGG + Intronic
1057372800 9:94489293-94489315 GCATCTTTTGTTTCAATATTTGG - Intergenic
1057816617 9:98300636-98300658 GAGTCTTTTGTTATAATGTTGGG + Intronic
1058146093 9:101413165-101413187 GGATTTTTGGGTTTAATATTTGG - Intergenic
1058876241 9:109247349-109247371 GGATGTTTTGGTCAAATGTTTGG - Intronic
1059108168 9:111529886-111529908 GTATCTTTTGTTAAAATATTTGG + Intronic
1059228761 9:112697600-112697622 GAATGTTTTGTTCTGATATTTGG - Intronic
1060142996 9:121226659-121226681 GCATCTTTTATTCTAATATTTGG + Intronic
1062747975 9:138228185-138228207 GCATCTTGTGTTCTAATATTTGG + Intergenic
1062753800 9:138276552-138276574 GCATCTTTTGTTTTAATATTTGG - Intergenic
1203552853 Un_KI270743v1:178760-178782 GCATCTTCTGTTTCAATATTTGG - Intergenic
1203576316 Un_KI270745v1:11331-11353 GCATCTTTTGTTTTAATATTTGG - Intergenic
1186110551 X:6250763-6250785 CGATCTTGAGTTTTAATATTTGG + Intergenic
1187996161 X:24929177-24929199 GGATCCTTGGATCTAATACTTGG + Intronic
1188274688 X:28185145-28185167 TCATCTTTTGTTTTACTATTTGG - Intergenic
1188595543 X:31895420-31895442 GTATTTTTTGTTGTAGTATTTGG + Intronic
1189019092 X:37316094-37316116 ACATCTTTTGTTCTGATACTTGG - Intergenic
1189081599 X:37978742-37978764 GGTTATTTTGTTCTCATATTTGG - Intronic
1189664627 X:43340577-43340599 GGATCTTTTGTTCCATGATTTGG + Intergenic
1189890876 X:45600944-45600966 GCATTTTTTGTTATAATATTTGG - Intergenic
1189904591 X:45744549-45744571 GCATCTTTTGTTAAAGTATTTGG - Intergenic
1189920290 X:45896741-45896763 GCATCCTTTGTTCCAATATTTGG - Intergenic
1190142437 X:47860069-47860091 ACATCTGTTGTTCTAATATTTGG + Intronic
1190361990 X:49658184-49658206 GCATCTTTTGCTATAATATTTGG - Intergenic
1192054551 X:67759865-67759887 GAAACTTTTGTTTTTATATTAGG + Intergenic
1194477923 X:94382277-94382299 AGATCTTTTGTTTAAATTTTTGG - Intergenic
1195746660 X:108125346-108125368 GCATCTTTTCTTCTGAAATTTGG - Intronic
1196303662 X:114074797-114074819 GGTTTTTTTTTTCTTATATTCGG + Intergenic
1197330722 X:125151241-125151263 AGATATTTTATTTTAATATTTGG - Intergenic
1197832808 X:130662984-130663006 GGAAGTTTTGTTACAATATTGGG + Intronic
1197896484 X:131320885-131320907 GGACCCTTTGGTCTAATATCTGG - Intronic
1199175067 X:144777684-144777706 GCATCTTTTAGTCTAGTATTTGG - Intergenic
1199797922 X:151219805-151219827 GGATGTTTTCTTCTAGTAATTGG + Intergenic
1200392947 X:155962956-155962978 GCATTTTTTGTTCTCATATTTGG + Intergenic
1201154116 Y:11114334-11114356 GCATCTTCTGTTTCAATATTTGG - Intergenic