ID: 1126764161

View in Genome Browser
Species Human (GRCh38)
Location 15:51996690-51996712
Sequence AAGAAGAAGGAGGAGGAGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 9570
Summary {0: 36, 1: 155, 2: 521, 3: 2021, 4: 6837}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126764161_1126764167 7 Left 1126764161 15:51996690-51996712 CCGTCCTCCTCCTCCTTCTTCTT 0: 36
1: 155
2: 521
3: 2021
4: 6837
Right 1126764167 15:51996720-51996742 TGTCATTCTATTTCCCAGGCTGG 0: 1
1: 7
2: 359
3: 6308
4: 52076
1126764161_1126764168 17 Left 1126764161 15:51996690-51996712 CCGTCCTCCTCCTCCTTCTTCTT 0: 36
1: 155
2: 521
3: 2021
4: 6837
Right 1126764168 15:51996730-51996752 TTTCCCAGGCTGGAGTGCAGTGG 0: 1396
1: 81579
2: 278567
3: 249597
4: 141908
1126764161_1126764166 3 Left 1126764161 15:51996690-51996712 CCGTCCTCCTCCTCCTTCTTCTT 0: 36
1: 155
2: 521
3: 2021
4: 6837
Right 1126764166 15:51996716-51996738 AAAGTGTCATTCTATTTCCCAGG 0: 1
1: 0
2: 13
3: 293
4: 3939

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126764161 Original CRISPR AAGAAGAAGGAGGAGGAGGA CGG (reversed) Intronic
Too many off-targets to display for this crispr