ID: 1126765682

View in Genome Browser
Species Human (GRCh38)
Location 15:52008812-52008834
Sequence CTGGTGTCCTGGAAGAAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 373
Summary {0: 1, 1: 1, 2: 2, 3: 34, 4: 335}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126765682_1126765691 28 Left 1126765682 15:52008812-52008834 CCATTTTTCTTCCAGGACACCAG 0: 1
1: 1
2: 2
3: 34
4: 335
Right 1126765691 15:52008863-52008885 AATGCAGATAAAGACTCCAGAGG 0: 1
1: 0
2: 2
3: 24
4: 246
1126765682_1126765688 -3 Left 1126765682 15:52008812-52008834 CCATTTTTCTTCCAGGACACCAG 0: 1
1: 1
2: 2
3: 34
4: 335
Right 1126765688 15:52008832-52008854 CAGACCTAGGGGATTGCCAGAGG 0: 1
1: 0
2: 2
3: 9
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126765682 Original CRISPR CTGGTGTCCTGGAAGAAAAA TGG (reversed) Intronic
900086535 1:900695-900717 CTGGGATCCTGGAAAAGAAAAGG + Intergenic
900091440 1:922502-922524 CTGGTGTCCTGGATGCAGACAGG + Intergenic
900644775 1:3703936-3703958 CTGGTCACCTGGAAGAGAGAGGG + Intronic
900908968 1:5580601-5580623 CTGGGGTCCTGGAAGGAAGAGGG - Intergenic
900947077 1:5837104-5837126 CAGAAGTCCTGGAAGAAACAGGG + Intergenic
901857061 1:12051351-12051373 CTGGGGGCCTGGAGGCAAAATGG + Intergenic
901901207 1:12364581-12364603 CTGGTGTCAGGAAAGTAAAATGG - Intronic
902609199 1:17587445-17587467 CTGATCTCCTGGAAGAGAGAAGG - Exonic
902892002 1:19451280-19451302 CTGGAGTCATGGGACAAAAAGGG + Intronic
902969276 1:20034873-20034895 CTGGTGAATTGGAAGAAATAGGG + Intronic
903356201 1:22749357-22749379 TTGGTGCCCTGGAAAAAAAGAGG + Intronic
908149937 1:61289300-61289322 CTGGTGGCCATGAATAAAAATGG - Intronic
908931452 1:69320892-69320914 GTGGTGTGCTTGAAGAAAAAGGG + Intergenic
909129148 1:71713389-71713411 CTAGTGGCCTAGAACAAAAAGGG - Intronic
910668043 1:89745176-89745198 CTGGTGTCCTGAATGACCAAAGG - Intronic
911113021 1:94211984-94212006 CAGGTGTCAAAGAAGAAAAAAGG + Intronic
911835317 1:102611541-102611563 CTGGTTTTCTGAAATAAAAAAGG + Intergenic
911888614 1:103337752-103337774 TTTGTGTTCTAGAAGAAAAAAGG - Intergenic
912924183 1:113899105-113899127 CAGGTGTGCTGCAACAAAAAGGG - Intronic
913123315 1:115762168-115762190 CTGGAGTCTTGGCACAAAAATGG - Intronic
913478898 1:119265708-119265730 TTGATGGCCTGGAAGATAAAAGG + Intergenic
913671920 1:121105049-121105071 CTGGTGACCAGAAAGAACAAGGG - Intergenic
914023695 1:143892494-143892516 CTGGTGACCAGAAAGAACAAGGG - Intergenic
914662171 1:149800441-149800463 CTGGTGACCAGAAAGAACAAGGG - Intronic
915839572 1:159203527-159203549 CTAGTGTCTTGGGAGAAAAGGGG + Intronic
916561140 1:165934918-165934940 CTGGGGTGCTGGAAGAAAGGAGG + Intergenic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
918497138 1:185153520-185153542 CTGGTGACCTTTAAGAAAACAGG + Intronic
919845291 1:201638530-201638552 CTGGGATCCTGGCAGAGAAATGG - Intronic
919983064 1:202654397-202654419 CTGGTGCCTTCGAAGAAACAGGG - Intronic
920013047 1:202884106-202884128 CTGGGGTCCTGACAGAACAAAGG - Intronic
920666613 1:207967306-207967328 CTGGTGTCCTCGAAAGAAGAGGG + Intergenic
921081567 1:211742810-211742832 CAGGAGTGCTGGAAGACAAAAGG - Intergenic
921104385 1:211961111-211961133 CTGATGTCCTGAAAGAGATAGGG + Intronic
922679283 1:227578353-227578375 CTGGTGTCCCTGAAGGAAATGGG - Intronic
923645320 1:235814745-235814767 CTGGTGTCCTGGTTGTGAAAAGG + Intronic
924954523 1:248913984-248914006 TTGGTGTCCAGGAAGTATAAAGG + Intronic
1062821263 10:536261-536283 CTGGTGTCCTTGGAGAGGAAAGG - Intronic
1063597146 10:7445759-7445781 CTGTTGTTCTAGAAGAAAAAAGG - Intergenic
1064332999 10:14411285-14411307 CTGCTTTCTTGGAAGAAAAAAGG - Intronic
1065490559 10:26277758-26277780 CTGGAGGCCTGGAAGGAAAATGG + Intronic
1066321685 10:34309037-34309059 CTGGTGACCTGGACGAGAACAGG + Intronic
1069091806 10:64208343-64208365 CTGGTGTCCTTAAAAGAAAAGGG - Intergenic
1070283689 10:75068606-75068628 GTGGTGTCATGGAAGAAACGTGG - Intergenic
1071347968 10:84711424-84711446 CTGGAGTCCAGGAAGAAAGAAGG + Intergenic
1071791571 10:88959735-88959757 ATGGTATCCTTGAACAAAAAAGG - Intronic
1071836512 10:89423678-89423700 CTGGAGTCCTGGGAGAAAAGGGG - Intergenic
1072571119 10:96658294-96658316 CTGGTTTCCTGGAAGAAAATTGG + Intronic
1073483546 10:103802318-103802340 CTGGTCTTCTGGATGAGAAACGG + Intronic
1073855715 10:107670980-107671002 CTGGAGACTGGGAAGAAAAAGGG + Intergenic
1073939394 10:108677698-108677720 CTGATGTCCTTAAAAAAAAACGG + Intergenic
1074094865 10:110302744-110302766 CTGGTGTCCTGAAACACAAAAGG + Intronic
1074679631 10:115891290-115891312 ATAGTGTTCTGGAAGAAAAAGGG + Intronic
1075189249 10:120291280-120291302 CTGGTGACCTTAAAGAAAAATGG + Intergenic
1078293459 11:10040548-10040570 ATCCTGTACTGGAAGAAAAAAGG + Intronic
1078300470 11:10125738-10125760 ATAGTGTCCTGGAACAGAAAAGG - Intronic
1078470887 11:11585728-11585750 CTGGTTTGATAGAAGAAAAATGG - Intronic
1079386523 11:19984780-19984802 CTGCTGTCAGGGAAGAAAAGAGG + Intronic
1079437925 11:20476488-20476510 CTGGGTTTCTGGAGGAAAAATGG + Intronic
1079635818 11:22739213-22739235 CTTCTGGCCTGGAAGACAAATGG + Intronic
1081783158 11:45727490-45727512 CTGGTGGCCCTGAAGAAAAGGGG + Intergenic
1082856918 11:57816524-57816546 CAGGTTTCTTGGGAGAAAAATGG - Exonic
1085455400 11:76662614-76662636 CTGGAGGCCTGGAAGAGAAGAGG - Intronic
1086068115 11:82768150-82768172 CAGGTGACCTGGATGAAAGAAGG + Intergenic
1086855588 11:91861371-91861393 CATGTGTCCTGGAGGAAACATGG + Intergenic
1088609755 11:111565805-111565827 CTGGTGTCCTCAAAAAAAAAAGG + Intergenic
1088775462 11:113078284-113078306 CTCGTGTCCTTAAAGAAAAGGGG - Intronic
1088797222 11:113274147-113274169 CTGATGTGCAGGAAGAAAAGAGG + Intronic
1089537697 11:119170754-119170776 CTGGTGGCCAAGAAGGAAAAAGG + Intronic
1090585668 11:128209395-128209417 CTGGTGACATGGCTGAAAAAAGG + Intergenic
1091416830 12:295217-295239 CTGGTGTCCTACAAGAAGAAAGG + Intronic
1093109200 12:15129005-15129027 CTGGTCTCCTCCAAGAAATATGG + Intronic
1093286559 12:17270784-17270806 CTGGTGGTGTGGAAGAGAAATGG - Intergenic
1099039315 12:77631286-77631308 CTGGTGTCCTGAAAGAGTTAAGG - Intergenic
1100372016 12:93976995-93977017 CTGGAGTCCGGGAAGAGAAACGG - Intergenic
1100667698 12:96772421-96772443 CTGCTGGCTTGGAAGATAAAGGG - Intronic
1101391738 12:104307164-104307186 CTGCTTACCTTGAAGAAAAAAGG + Intronic
1102991329 12:117318475-117318497 CTAGTGAAGTGGAAGAAAAAAGG - Intronic
1105615986 13:22012866-22012888 CTGGTGACATGGAAGAGAAATGG + Intergenic
1108020424 13:46122308-46122330 ATGCTGTCCTAGAAGAATAAAGG - Intergenic
1108026493 13:46183651-46183673 CTGGTGTCCTGAAAGAATGTAGG - Intronic
1108065850 13:46577029-46577051 CTGCTGGCCTGAAAGAAAAAAGG - Intronic
1110008446 13:70301278-70301300 ATGGTGTCCTGAAACAGAAAAGG + Intergenic
1110116936 13:71829705-71829727 CTGCTCTCCGGGAAGCAAAATGG - Intronic
1110308947 13:74023879-74023901 CTGGTGATCTTGAAGAAAAGGGG + Intronic
1111413538 13:87909705-87909727 ATGATGTCCTTAAAGAAAAAGGG + Intergenic
1114737415 14:25056841-25056863 CTTGTGTCCTAGCAGAATAAGGG - Intergenic
1115257054 14:31414561-31414583 CTGATGTGCTGGAGGAATAATGG - Intronic
1117953079 14:61102111-61102133 TTTGTGTCCTGAATGAAAAATGG + Intergenic
1118327911 14:64793860-64793882 CTGGTACCCTGGAAGAAATAGGG + Exonic
1119738840 14:77000798-77000820 GTGGTGGCGTGGAAGGAAAAGGG - Intergenic
1120029884 14:79629458-79629480 CTGGAATACTGGAAGAAGAAAGG - Intronic
1120352488 14:83380722-83380744 TTGGTTGCCAGGAAGAAAAATGG + Intergenic
1121292981 14:92792869-92792891 CCTTGGTCCTGGAAGAAAAAGGG - Intergenic
1122218881 14:100222679-100222701 CTGGGGTCCTGGAAGAAGACTGG - Intergenic
1122384278 14:101333430-101333452 CTGGTGACCCAGAAGAAAAAGGG + Intergenic
1124217578 15:27820626-27820648 ATGGGGTCCTGGAACAGAAAAGG + Intronic
1126765682 15:52008812-52008834 CTGGTGTCCTGGAAGAAAAATGG - Intronic
1126913382 15:53438232-53438254 CTGCTGCCCAGGAAGAAAAGGGG + Intergenic
1127362261 15:58254639-58254661 CTGGTGTCCTTGTAAAAGAAAGG - Intronic
1127401621 15:58592574-58592596 CTGGTTCCCTTGAAGAAAAATGG + Exonic
1127713358 15:61623763-61623785 CTTGTGTCCAGGAAAAAGAAGGG - Intergenic
1128552906 15:68609684-68609706 AGGATGTCCTGGAAGAAGAATGG - Intronic
1128911153 15:71516153-71516175 GTGGTGTCCTGGAAGAGGAGAGG + Intronic
1129708394 15:77807603-77807625 CTGTGGTCCTGGGAGAGAAATGG - Intronic
1131027837 15:89159858-89159880 CAGGTGACCTAGAAAAAAAATGG + Intronic
1132136771 15:99349301-99349323 TTGGTGTACTGGAGTAAAAATGG + Intronic
1133330055 16:4967310-4967332 CTGGTGTCCTTATAAAAAAACGG - Intronic
1133656638 16:7871256-7871278 ATGGTGTCCTGGAAGTTACAGGG + Intergenic
1134683489 16:16142743-16142765 CTGTGTTCCTGGAAGAAAACAGG + Exonic
1136629451 16:31481005-31481027 CTGATGCCTTGGAAGAAAGAAGG + Intergenic
1137549118 16:49424705-49424727 CTGGGGTTCTGGAAGGAAAGGGG + Intergenic
1138354603 16:56367198-56367220 CTCATGTGCTGGAAGAGAAAGGG - Intronic
1139633754 16:68245745-68245767 CTCCTGTCCTGGTAGAAAATGGG + Intronic
1140095180 16:71869083-71869105 CTGGTCTCCTGGAAATAAAAGGG - Intronic
1140754440 16:78055092-78055114 CTGAGGTCCTGAAAGAAAATAGG + Intronic
1141053818 16:80797559-80797581 CAGGTATGCTGGAAAAAAAAAGG - Intronic
1142682732 17:1559998-1560020 CTGCTGTTCTTGAAGATAAAAGG - Intronic
1142844900 17:2666041-2666063 CTGGTCTTTTGGAAAAAAAATGG + Exonic
1143711512 17:8739193-8739215 CTGGTGGCCTGGATGAGGAAGGG + Intronic
1143952181 17:10641969-10641991 CTGGTGTCCTTTAGGAAAATTGG + Intronic
1144524375 17:15977906-15977928 CTGCAGTCCTGGAGGGAAAAGGG + Exonic
1145843601 17:28018034-28018056 CTGGGATCCTGGAACCAAAAAGG + Intergenic
1145997395 17:29112512-29112534 CTGCTCTCCTGGAAGAACACTGG + Intronic
1146308839 17:31751470-31751492 CTGGTGTCCAGGAAGACACTCGG - Intergenic
1146974959 17:37103271-37103293 CTGTTCTCCTGAAAGAAAGAAGG + Intronic
1148583600 17:48760997-48761019 CTCGTGACCAGGAAGAAAAGGGG + Intergenic
1148963799 17:51417413-51417435 CTGGTGACCTGGATCAAACAGGG + Intergenic
1151349701 17:73524503-73524525 TGGGTGTCCTGGCAGGAAAAAGG - Intronic
1151420661 17:73995059-73995081 CTGGAGTCCTTGAAAAAAGAGGG - Intergenic
1153922454 18:9803875-9803897 GTTGTGTCCTGTAAGAAAATAGG + Intronic
1155183826 18:23370640-23370662 CTGTAGTCCTGGGGGAAAAACGG - Intronic
1155946057 18:31852657-31852679 TTGGTATCTAGGAAGAAAAAGGG + Exonic
1156969429 18:43137276-43137298 CTGGAGTGCTGGGAGAAAAATGG - Intergenic
1157073647 18:44439805-44439827 CTGGTGAGGTGGAAGAGAAAAGG - Intergenic
1158713775 18:59860183-59860205 CAGCTGTCCTGGAAGACAGATGG - Intergenic
1159938688 18:74388992-74389014 CTGCTTTCCTGGCAGAGAAATGG - Intergenic
1160037228 18:75312802-75312824 TTGGATTCCAGGAAGAAAAATGG - Intergenic
1160596647 18:79980067-79980089 CTGGTGTCCTTAGAGGAAAATGG + Intronic
1161345437 19:3766825-3766847 CTGGTGTGCTGGAGGAACAGCGG + Intronic
1161410371 19:4113611-4113633 GTGGTGTCCTGGAAAGAATACGG - Intronic
1167240305 19:48339405-48339427 CCTGTGTCTTGGAAGAAAGAGGG + Intronic
1168684194 19:58338089-58338111 TTGGTGTCTTGGATGACAAAGGG - Intronic
925021616 2:574055-574077 CTGGTGTGCTGGGAGAAGATGGG + Intergenic
925648576 2:6064230-6064252 GAGGTCTCTTGGAAGAAAAAAGG + Intergenic
925859110 2:8157825-8157847 CTGGGGTCCTGGAAGGGAGAGGG - Intergenic
925912551 2:8583119-8583141 TTGCTGTCCTGGAAGGAAAGGGG - Intergenic
926107551 2:10161930-10161952 CTGTTGTCCAGGCAGAAAACCGG + Intronic
926865683 2:17355760-17355782 ATGGTGTCCTGAAAGCAGAATGG - Intergenic
926936667 2:18092677-18092699 CGGTTGTCCTGGAAAAAGAATGG - Intronic
927082560 2:19644853-19644875 CTGGGATCCTGGAAAAGAAAAGG + Intergenic
927083573 2:19653532-19653554 CTGGTGTCCAGGCTGAAATATGG + Intergenic
928016428 2:27662359-27662381 CTGGGGTACTGGAAGCACAAAGG + Intronic
928287825 2:30008776-30008798 CTAGTGTCTTTGGAGAAAAAGGG - Intergenic
928432064 2:31228285-31228307 CTGGTGTTGTGGATGAGAAAGGG + Intronic
928897837 2:36284995-36285017 CTGGTGACCAGGAAGAAAATAGG + Intergenic
929926076 2:46210914-46210936 TTGGAGTCCTAGAAGAAGAAGGG - Intergenic
929966051 2:46537513-46537535 CTTCTTTCCTGGAAGCAAAATGG - Intronic
931151590 2:59580207-59580229 CTGGAGTCCTGGAAAAAAAACGG - Intergenic
932539845 2:72640391-72640413 TTGGTGTCCTGAAAGAGATAGGG + Intronic
933448313 2:82411702-82411724 ATGGTTTCCTGGAGGAATAACGG + Intergenic
933510482 2:83234788-83234810 TAGTTTTCCTGGAAGAAAAATGG + Intergenic
935359966 2:102238656-102238678 CTGGTTTCCTTGAAGAACAGAGG + Intronic
937002737 2:118482999-118483021 CTGGGGTTCTGGAAGGAAATGGG + Intergenic
938146472 2:128838801-128838823 CTGGTGTCATGAAAGAAGCAAGG - Intergenic
938792974 2:134692951-134692973 CTGAGGTGCTGGAAGAAAGATGG - Intronic
939218009 2:139265074-139265096 CTAGTTTCCTTGTAGAAAAATGG + Intergenic
939989644 2:148865185-148865207 CAGCTCTCCTGGAAGAGAAAGGG + Intergenic
941302977 2:163827598-163827620 CTGGGGTCATGGAAGATACAGGG - Intergenic
941889210 2:170560689-170560711 ATTGTGTCCTGGCATAAAAACGG - Intronic
942125296 2:172818807-172818829 CTGTTGACCTGGAAAAGAAAAGG - Intronic
942297480 2:174531801-174531823 CCTGTTTCCAGGAAGAAAAAGGG + Intergenic
942701172 2:178712476-178712498 TCGGTTACCTGGAAGAAAAATGG - Exonic
942764281 2:179435463-179435485 TTGGTGAACTGGAAAAAAAAAGG - Intergenic
942876200 2:180801835-180801857 CTGGTTTCCAATAAGAAAAAAGG + Intergenic
942897583 2:181076118-181076140 CTGTTGGCCTGGAGGAAACATGG - Intronic
944521345 2:200571653-200571675 CTGATGTCCTGGATGGCAAAAGG + Exonic
944822646 2:203446114-203446136 GTGGTGTCCTGGATCAGAAAAGG - Exonic
946007678 2:216539431-216539453 CTGGTGTCCTTGAAAGAAGAGGG - Intronic
948235193 2:236383074-236383096 CTGGGATCCTGGAAAACAAAAGG - Intronic
948534743 2:238637513-238637535 CTGCTGGCCTGGAAGAAGGAAGG + Intergenic
948918056 2:241048300-241048322 ATGGTCTCCTGCAAGAAAGACGG - Exonic
1169126127 20:3128187-3128209 CTGGTGTCCTGGCCAAAAAGAGG - Intronic
1169609445 20:7362651-7362673 CAGCTGTACTGGAACAAAAAAGG - Intergenic
1169744372 20:8928579-8928601 CTGGTTACTTGGAAGAAAGAGGG - Intronic
1170157347 20:13280639-13280661 CTGGTGTCCAGGGAAAGAAAGGG + Intronic
1171995281 20:31725990-31726012 ATGGTGTCCTGGAAATAAATTGG + Intergenic
1173007207 20:39149352-39149374 CTGGGCTCCAGGAAGAGAAATGG - Intergenic
1173627160 20:44481468-44481490 TTGGTGTCATGGAAGAGAACAGG - Intronic
1173730787 20:45327048-45327070 CAGTTGCCCTGGCAGAAAAATGG - Exonic
1174055633 20:47796284-47796306 CTGCTGTCCTGGTAGAGAAGGGG + Intergenic
1174322716 20:49754705-49754727 TTGTTGTCCTGGCAGAGAAATGG + Intergenic
1175405637 20:58724373-58724395 GTGGTATCCTAGAACAAAAAAGG + Intergenic
1177102022 21:16909960-16909982 CTGGTATCCTGGAAGGAACAAGG - Intergenic
1177498558 21:21919954-21919976 CTGGTTTCTTGGAAAAAAATAGG - Intergenic
1177868712 21:26544627-26544649 CTGGTGACCCTGAAGAAACACGG + Intronic
1177919434 21:27132537-27132559 CTGAGGTCCTGGAAGCAACAAGG + Intergenic
1179470519 21:41606991-41607013 CCTGTGTCCTGGAAGAACAAAGG - Intergenic
1179646552 21:42779497-42779519 CCGGTGCCCTGGCAGAAACACGG + Intergenic
1181879112 22:25963495-25963517 CTGGTGTCCTTGAGGACACATGG - Intronic
1182668467 22:31975918-31975940 CAGGTGTACTGGAAGTATAAAGG + Intergenic
1182766946 22:32764543-32764565 CTCGTGGCCTGGAAGAACACTGG + Intronic
1183372577 22:37442386-37442408 CTAGTGTCCTGGAAGCCAGAAGG - Intergenic
1184639198 22:45860120-45860142 CTGGTGTCCTTGTAAGAAAAGGG - Intergenic
1184810259 22:46826580-46826602 CTGGTGTCCTGGAAGGTGGATGG + Intronic
1185007980 22:48295885-48295907 GTGGGATCCTGGAAGAGAAAAGG + Intergenic
1185173680 22:49307363-49307385 CTGGTGTCCTGGTGGACACAGGG - Intergenic
949118995 3:362806-362828 CTGCTGTCCTGGGAGAACATTGG - Intronic
949843301 3:8343546-8343568 CTGGTGTTCTGGAAGAAAAATGG + Intergenic
951199757 3:19863416-19863438 CTGGCTGCCTGGAAGAAAAGTGG - Intergenic
953022619 3:39125356-39125378 CTGATGTCCAGGAAGCACAAGGG + Exonic
954005349 3:47586268-47586290 CTGGAGTCCGAGAAGGAAAATGG - Exonic
956185931 3:66562030-66562052 CTGGTATCCAAGAAGAAAAGAGG + Intergenic
956937055 3:74114826-74114848 CAGGTTTCCTGAAAGCAAAATGG - Intergenic
957286076 3:78219103-78219125 CTGGTGTCCTTGTAAAAAGAGGG - Intergenic
957459121 3:80494526-80494548 CTGGTTTCCTGGAAGAAGTTGGG - Intergenic
957693404 3:83600668-83600690 CTGGCTTTCTGGAAGAACAAAGG + Intergenic
961560287 3:127723952-127723974 CTGGTGTCCTGTAAGGAGAGGGG + Intronic
962650425 3:137483358-137483380 ATAGAATCCTGGAAGAAAAAAGG + Intergenic
962777968 3:138681482-138681504 GTGGTGTCGTGACAGAAAAAAGG - Intronic
964530151 3:157658713-157658735 CTGGTGGCCTAGCAGAAAAGGGG + Intronic
965400357 3:168206026-168206048 CTGCTGTTCTGGATGACAAAGGG - Intergenic
965599191 3:170438513-170438535 TTGGTGGCCTGGCAGAGAAAGGG + Intronic
965935204 3:174100808-174100830 CTGGTGAACTAGAAAAAAAATGG - Intronic
966028380 3:175314270-175314292 ATGGTGCCCTGCAAGAAATATGG + Intronic
966379737 3:179332093-179332115 GTGGTATCCTGGAACAGAAAAGG + Intronic
967109048 3:186277035-186277057 CTCATGTCCTGGAAGAAGCAGGG - Intronic
968227545 3:196984090-196984112 CTGGGGTCCTGGAACAGAATTGG - Intergenic
969449152 4:7263268-7263290 CTGGTGTAATGGAAGGAAAATGG + Intronic
969449790 4:7266413-7266435 CGGGTCTCCTGAAAGAAAGAAGG - Intronic
969467968 4:7368803-7368825 CAGGTGTCCTGGGAGAAACCCGG + Intronic
970813975 4:20131330-20131352 CTAGTGTCCTGAAAGAATCAGGG + Intergenic
972007140 4:34123717-34123739 TCAGGGTCCTGGAAGAAAAAAGG + Intergenic
972097194 4:35363357-35363379 TTGGTGTTCTTGAGGAAAAAGGG - Intergenic
972716201 4:41648733-41648755 CTGTTGTACTGGAAAAACAACGG - Intronic
973300175 4:48573236-48573258 TTAGTTCCCTGGAAGAAAAATGG + Exonic
973804436 4:54512197-54512219 TTGGTGTTCAGGAGGAAAAAAGG + Intergenic
973897566 4:55430090-55430112 CTGGGGTTCTTGAATAAAAATGG - Exonic
974248218 4:59350279-59350301 TTGGTGAACTGAAAGAAAAAGGG + Intergenic
974405150 4:61458022-61458044 CTGGTATCTTTGAAGCAAAAAGG - Intronic
975318580 4:72983186-72983208 TTGATGTCCTGGAAGCTAAAGGG - Intergenic
975321663 4:73015416-73015438 CTGGTGTTCTGGAGGAAGAGTGG - Intergenic
976311801 4:83620542-83620564 CTGGTGTTCTTGTAAAAAAAAGG - Intergenic
976519950 4:86015136-86015158 CTTGTCCCCTGGAATAAAAATGG - Intronic
977424775 4:96853687-96853709 ATGGTTGCCTGGAAGAAAACTGG + Intergenic
978634852 4:110792316-110792338 CTTTTGTCCTGGAAGTTAAATGG + Intergenic
978815351 4:112898281-112898303 TTGGTATCCTAGAAGAGAAAAGG - Intronic
979817069 4:125121825-125121847 CAGCTGTTCTGGAAAAAAAAAGG + Intergenic
981353799 4:143764047-143764069 CTGGGATCCTGGAATAGAAAAGG - Intergenic
982265245 4:153532910-153532932 CTGGTAACCTGGAAGAAGCAGGG + Intronic
982465678 4:155727977-155727999 CTGCTTTCCAGGAAGGAAAATGG + Intronic
983073356 4:163295189-163295211 CCAGTGTTCTGGAAGATAAATGG + Intergenic
984734062 4:183094474-183094496 CTGATCTCCTTGAAGAAACAAGG + Intergenic
984878286 4:184388850-184388872 CTGGGGTCATGGAGGAAGAAAGG + Exonic
984928708 4:184827721-184827743 CTGGTGTCCTTATAGAAAGAAGG - Intergenic
984946241 4:184970750-184970772 GTGGGGTCCTGGAACAGAAAAGG + Intergenic
985077335 4:186229014-186229036 CTTTTTTCCTGGAAAAAAAAAGG - Intronic
986315729 5:6585149-6585171 CTGGTGTCCCTACAGAAAAAGGG + Intergenic
986573955 5:9193487-9193509 CTAGTGTGCTGGAACAAGAATGG - Intronic
987592127 5:19943307-19943329 ATGGTGTAGTGGAATAAAAATGG - Intronic
988025510 5:25682615-25682637 CTGGTATTATGCAAGAAAAAAGG - Intergenic
990532849 5:56690928-56690950 TTGGTTGCCAGGAAGAAAAAAGG + Intergenic
990803251 5:59629370-59629392 CTGGTGTCCTTGTAATAAAAGGG + Intronic
993299579 5:86191185-86191207 CTTGTGTTCTAGTAGAAAAATGG - Intergenic
993797984 5:92293705-92293727 ATTGTGTCCTTGAAGAGAAATGG + Intergenic
994076161 5:95652122-95652144 GTGGTAACCTGGAAAAAAAAAGG - Exonic
994491851 5:100457875-100457897 CTACTGTCTTGGAAGAAATAAGG + Intergenic
995379649 5:111517878-111517900 CTGGTGTCCAGGGGGAAACAGGG + Intergenic
995962407 5:117858437-117858459 GTGGTACCCTGGAAGAAAAACGG - Intergenic
996614562 5:125425192-125425214 CTGGTGTTCTGGAACCAGAAAGG + Intergenic
997153574 5:131526723-131526745 CTGGTGGGCTGGAAGGACAATGG - Intronic
998009962 5:138687028-138687050 ATGGTGTCCTGGAAGCCAAGAGG - Intronic
998535298 5:142924807-142924829 CTTGAGTATTGGAAGAAAAAGGG + Intronic
999324063 5:150632122-150632144 CTGATGCCCAGGGAGAAAAAGGG - Intronic
999331404 5:150675996-150676018 CCAGTGTCCTGGAGGAGAAATGG + Intronic
999380690 5:151119110-151119132 CAGGTGTCCTGGTAGGACAAAGG - Intronic
1000068525 5:157718090-157718112 CATGTGTCCTAGGAGAAAAAAGG - Intergenic
1000227489 5:159279672-159279694 CTGTTGACTTGGAAGAAAAGTGG + Intronic
1000939390 5:167342172-167342194 ATGGGGTCCTGGAACAGAAAAGG - Intronic
1001218332 5:169876539-169876561 CTGATGGCCTGGAAGAACAAGGG + Intronic
1001316427 5:170644253-170644275 ATGGTGTCCATGAAGAAACAAGG + Intronic
1002603328 5:180367843-180367865 GTGGTGTTCTGGAAGCAGAAAGG + Intergenic
1002827325 6:785283-785305 TTTGTGCCCTGGAAGAGAAAAGG - Intergenic
1004705089 6:18117257-18117279 CTGGTGCCCTGGAGGTAACATGG + Intergenic
1004963208 6:20816132-20816154 CTGTTGTCCTTAAAAAAAAAAGG - Intronic
1007092161 6:39191134-39191156 CTGGCGTCCTGGAAGATGAGTGG + Exonic
1007429695 6:41769632-41769654 CTGGAGTCCTAGAAGCCAAAAGG - Intergenic
1007837126 6:44682370-44682392 CTGGTTTCCTAGAAAAAAAAGGG + Intergenic
1009313036 6:62181086-62181108 TAAGAGTCCTGGAAGAAAAAGGG + Intronic
1009850867 6:69196550-69196572 CTGGTGTCCTTATAGAAAAAAGG - Intronic
1010706140 6:79113176-79113198 CTTATGTTCTGGAAGCAAAAAGG - Intergenic
1012197092 6:96356731-96356753 CTGTTGTCCTCCAAGAAATACGG - Intergenic
1012429860 6:99153055-99153077 CTGCTGGCCTTGAAGAAACAAGG + Intergenic
1012549259 6:100452851-100452873 TTGGTGTCTTGGAAGGAGAAAGG + Intronic
1013638691 6:112052869-112052891 CTGGTGTCCTTGGAGAACCATGG - Intergenic
1014017697 6:116552461-116552483 TAGGAGTTCTGGAAGAAAAAAGG - Intronic
1014291907 6:119568433-119568455 GAGATGTGCTGGAAGAAAAAGGG - Intergenic
1015213400 6:130722356-130722378 CAGGAGTCCTGGAAGCAAAGGGG + Intergenic
1018390007 6:163335087-163335109 CTGGTGTCCTTATAGAAAGAAGG + Intergenic
1019738944 7:2663396-2663418 CTGGTGTCTGGGACCAAAAAGGG + Exonic
1020819957 7:12954924-12954946 ATGGTTTCCTGGAAGGAACATGG + Intergenic
1021167957 7:17362990-17363012 CCCGATTCCTGGAAGAAAAATGG + Intergenic
1022595396 7:31708865-31708887 ATGGAGTGCTGGAATAAAAAAGG - Intergenic
1023723552 7:43119342-43119364 CTGGTGTCCTGGAAGAAGCCAGG - Intronic
1024435151 7:49343436-49343458 CTGGAGTTCTAGAACAAAAAGGG + Intergenic
1024448595 7:49512360-49512382 CTGCTGGCCTTGAAGAAATAAGG - Intergenic
1024535011 7:50423194-50423216 CTGGTGTCCTTATAGGAAAAGGG + Intergenic
1024827588 7:53410082-53410104 ATGCTGTCCTTGAAGAAAATAGG - Intergenic
1025021211 7:55481514-55481536 CTGGAGCCCTGGAAGAACAGAGG + Intronic
1026581957 7:71625935-71625957 CTGGTGTCCTCGTAAAAAGAAGG + Intronic
1026771290 7:73201581-73201603 CTGGGGGGCTGGAAGACAAAGGG - Intergenic
1027012157 7:74754978-74755000 CTGGGGGGCTGGAAGACAAAGGG - Intronic
1027075884 7:75191076-75191098 CTGGGGGGCTGGAAGACAAAGGG + Intergenic
1027452290 7:78345992-78346014 ATCCTGTCCTGGAAGCAAAAAGG - Exonic
1028069922 7:86438948-86438970 CTAGAGTACTGGAGGAAAAATGG - Intergenic
1029175111 7:98659096-98659118 CAGTTGTCATGGAAAAAAAATGG + Intergenic
1029681680 7:102115823-102115845 CTGGTGTTCTGCATGAAAGATGG - Intronic
1030095468 7:105894776-105894798 GCAGTGTCCTGGAAGAAAGATGG + Intronic
1030195828 7:106852599-106852621 CTGGTATCCTCTAAGAAAACAGG - Intergenic
1031357252 7:120801882-120801904 CTTATTTCCTGGAAAAAAAATGG + Intronic
1031756082 7:125644552-125644574 CTGGTGTTTTAGTAGAAAAATGG + Intergenic
1031869408 7:127075799-127075821 CTGGGATCCTGAAAGAAAGAGGG + Intronic
1034626320 7:152495682-152495704 CTGGAGTACTGGAAGAAGAGGGG + Intergenic
1034695671 7:153051137-153051159 CTGGTGTCCAGTAAGGAAATGGG + Intergenic
1035520652 8:273474-273496 CAGGGGTCCTGGAAGAAGCATGG - Intergenic
1035699043 8:1624199-1624221 CTGTTGTATTGGAAGAAAATTGG + Intronic
1036100903 8:5783586-5783608 CTGTTCTCCTGGAAGTAAATGGG + Intergenic
1036147636 8:6269547-6269569 TTGAGGCCCTGGAAGAAAAATGG - Intergenic
1036787032 8:11694749-11694771 CTGTGATCATGGAAGAAAAATGG - Intronic
1037135247 8:15452433-15452455 TTGTTATTCTGGAAGAAAAAAGG - Intronic
1037767660 8:21782005-21782027 CTGGTGTCCTGGAAGCAGGGAGG + Intronic
1038675410 8:29618370-29618392 CTTTTCTCCTGGAAGAAAGATGG + Intergenic
1039269678 8:35867339-35867361 CTTGTGTCCTGGAGGCAAACTGG + Intergenic
1039443537 8:37612308-37612330 AAGGAGTTCTGGAAGAAAAAAGG + Intergenic
1041119522 8:54571874-54571896 CTGGTGTCCTTACAAAAAAAGGG - Intergenic
1041632571 8:60104441-60104463 ATAGTGTCCTGGAAGAGAAAGGG + Intergenic
1042574544 8:70203381-70203403 CTGTTGTACTGGTAGAAGAAGGG - Intronic
1042966437 8:74358453-74358475 CTGGTATCCTCAAAGACAAAGGG - Intronic
1043963122 8:86440705-86440727 CTGATGTTCCTGAAGAAAAATGG - Intronic
1044391245 8:91654518-91654540 CGGGTGTCCTCTGAGAAAAAAGG - Intergenic
1045448890 8:102299404-102299426 CTAGTCATCTGGAAGAAAAAAGG - Intronic
1048296042 8:133214580-133214602 GAGGTGTCTTGGAACAAAAAAGG - Intronic
1048539718 8:135331611-135331633 CTGGCGTCCTGGAAACAAAAAGG - Intergenic
1049229317 8:141473919-141473941 CAGGTGGCCTGGTAGAAAGAGGG - Intergenic
1049415522 8:142493174-142493196 CTGCTGCCCTGGAGGACAAAGGG - Intronic
1049491777 8:142907944-142907966 CAGGTGTCCTTGGAGGAAAAGGG - Intronic
1050018699 9:1261920-1261942 CTGGTGTCCTGGGAAGAAATGGG - Intergenic
1050302987 9:4277625-4277647 CTGCTGTCCTTGGAGACAAAGGG - Intronic
1051424208 9:16917370-16917392 CATGTGTCGTGGAAGAGAAAAGG + Intergenic
1051643720 9:19247881-19247903 CTGGTGGATTGGAAGTAAAAGGG - Intronic
1052104912 9:24501663-24501685 CTGATTTCCTGAAAAAAAAATGG + Intergenic
1052477730 9:28981879-28981901 CTGGTATACTGAAAGAAAATTGG + Intergenic
1055561546 9:77526485-77526507 CTGGTGTCCTTGTAAGAAAAGGG + Intronic
1058556984 9:106179624-106179646 CAGGTTTCCAGGAATAAAAAGGG - Intergenic
1059260450 9:112971049-112971071 CTGCTTTCCCAGAAGAAAAATGG - Intergenic
1059379815 9:113914279-113914301 CTGGGATCCTGGAACAAACATGG - Intronic
1060879328 9:127106996-127107018 CAGGTGTTCTGGATGAACAAGGG + Intronic
1060976264 9:127766985-127767007 CTGGTGTCCTGGCAGAGACGGGG - Intronic
1062149896 9:135012608-135012630 GTGGTGTCCTGGACAGAAAAGGG - Intergenic
1185503345 X:615385-615407 CTGGTGTCTTTGGGGAAAAAGGG - Intergenic
1188048190 X:25452151-25452173 CTGGTGACCTGGGGAAAAAAAGG + Intergenic
1188811096 X:34655840-34655862 CTGGTGTCAGCGAAGAGAAAGGG - Intronic
1189887388 X:45562167-45562189 CTGGTGAACTGGAAGTAAAATGG + Intergenic
1189958644 X:46304064-46304086 CTGCTGTGATGGAAGTAAAATGG + Intergenic
1190129954 X:47738741-47738763 CTGATGTCTTGGAAGAAATTTGG - Intergenic
1190399280 X:50015349-50015371 AGGATGTCCTGGAAGATAAAGGG - Intronic
1191157405 X:57288679-57288701 CTGATGTCCTTTAAGAAAAATGG + Intronic
1195959152 X:110367513-110367535 ATGGTGTCCTGGAAGCCAAGTGG - Intronic
1196030107 X:111087682-111087704 CTGTGGACGTGGAAGAAAAAGGG + Intronic
1197467407 X:126821325-126821347 CTGGAGTACTGGAAGACAACGGG - Exonic
1197739640 X:129880006-129880028 CTGGTGTTCAGGAAGGCAAAGGG - Intergenic
1198885553 X:141332425-141332447 CTGTTCTCCTGGAACAACAATGG + Intergenic
1199316095 X:146379679-146379701 TTGGTACCCTGGGAGAAAAAAGG + Intergenic