ID: 1126767063

View in Genome Browser
Species Human (GRCh38)
Location 15:52019635-52019657
Sequence CGCCTGGCCGGCCCCACGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 129}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126767063_1126767081 28 Left 1126767063 15:52019635-52019657 CCCCGCGTGGGGCCGGCCAGGCG 0: 1
1: 0
2: 1
3: 13
4: 129
Right 1126767081 15:52019686-52019708 CCCTCGCCGGTCGCCCTGCCAGG 0: 1
1: 0
2: 1
3: 15
4: 172
1126767063_1126767069 0 Left 1126767063 15:52019635-52019657 CCCCGCGTGGGGCCGGCCAGGCG 0: 1
1: 0
2: 1
3: 13
4: 129
Right 1126767069 15:52019658-52019680 GCCAGCGCGCCCCTCCCACCCGG 0: 1
1: 0
2: 5
3: 59
4: 415
1126767063_1126767076 15 Left 1126767063 15:52019635-52019657 CCCCGCGTGGGGCCGGCCAGGCG 0: 1
1: 0
2: 1
3: 13
4: 129
Right 1126767076 15:52019673-52019695 CCACCCGGCACGCCCCTCGCCGG 0: 1
1: 0
2: 0
3: 12
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126767063 Original CRISPR CGCCTGGCCGGCCCCACGCG GGG (reversed) Intronic
900114827 1:1023994-1024016 CCCCTGGCCAGCCCCACCCCAGG - Intronic
900151048 1:1179547-1179569 CGCCTGGCTGGCACCACCCCTGG + Intronic
900237079 1:1598056-1598078 CGCCTGACCGGCGCCACGCAGGG + Exonic
900383834 1:2400108-2400130 TGACTGGCCAGCCCCAGGCGAGG + Intronic
900669465 1:3841726-3841748 TGCCTGTCCTGCCCCACGCCCGG - Intronic
900713789 1:4131261-4131283 CGCCTGCCCGTTGCCACGCGAGG + Intergenic
900777289 1:4594608-4594630 CTCCAGGCCGCCCCCACGCCTGG + Intergenic
902940914 1:19799776-19799798 CTCCCCGCCGGCCCCACGCGGGG - Intronic
903325703 1:22567445-22567467 CCCCAAGCCGGCCCCACGCCAGG - Intronic
903750586 1:25618055-25618077 CGCCGCGCCGGCCCCGGGCGAGG + Exonic
905177914 1:36149496-36149518 CGCCTGCGCGGCCTCCCGCGGGG + Intronic
905182621 1:36176347-36176369 CCCCTGCCCGGCCCCACGTGGGG - Exonic
905541420 1:38763314-38763336 CTCCTGCCCTGCCCCAAGCGTGG - Intergenic
906324500 1:44836414-44836436 CGCCTGGCCGGCCCCCAGGCTGG - Intronic
915592433 1:156878362-156878384 CACCTGGCAGGCACCACGGGTGG - Intronic
915637046 1:157194818-157194840 CGCCTGGGCGTCCGCACCCGAGG - Intergenic
915932793 1:160070277-160070299 CGCCTGCCCGGCCCCCCTCCGGG - Intergenic
917974443 1:180230024-180230046 CGCCCCGCCGGCCTCACTCGGGG + Intergenic
921094447 1:211874583-211874605 GGCCTGGCGGGCCCCACACTCGG - Intergenic
922423054 1:225472030-225472052 GGCCTGGCCTGCCCCCCGCCAGG - Intergenic
924502799 1:244652993-244653015 CGCCGGGCCGGCCCCGCCCCCGG + Exonic
1067338049 10:45379993-45380015 CGTCGGGCCTGCCCCACGCCAGG - Intronic
1076329125 10:129652201-129652223 CGCATGGCCGGCCCCCCGAGTGG - Intronic
1077048264 11:555564-555586 CCCCTGCCCCGCCCCAGGCGCGG - Intronic
1077254643 11:1574702-1574724 CGCCTCCCCGGCCCCTCGCAAGG - Intergenic
1081831614 11:46120403-46120425 CCCCCGGCCGGCCCCCCGCCGGG + Intronic
1083997196 11:66278364-66278386 TGCCCGGCCGGCCCTAAGCGCGG + Exonic
1084284136 11:68120853-68120875 CGCCTGGCGGGGCCTCCGCGAGG - Exonic
1089180592 11:116580557-116580579 CGCCTCGCGGGCCCTGCGCGGGG - Intergenic
1096253794 12:50050927-50050949 TCCCTGGCCGGCCCCACCCGGGG - Intergenic
1096710436 12:53452016-53452038 CGCCTCGCCGGCCCCCGGGGTGG + Intergenic
1103321111 12:120093377-120093399 CGCCTGGCCAAGCCCACGCCTGG + Exonic
1103547518 12:121712708-121712730 CGCCCGCCCCGCCCCACGCCTGG - Intergenic
1104866938 12:131961350-131961372 CTGCAGGCCGGCCCCACCCGCGG - Exonic
1104885487 12:132104718-132104740 CTGCAGGCCGGCCCCACCCGCGG - Exonic
1104902767 12:132198118-132198140 CGCCGGGCAGGGCCCACGTGGGG + Intronic
1104996838 12:132663485-132663507 CGCCTGGCCGGCACCACCAGAGG + Intronic
1106719996 13:32427531-32427553 GGCCCGGCTGGCCCCAGGCGGGG + Intronic
1113378288 13:109783504-109783526 CGCCTGGCTGGGCCCTGGCGTGG + Exonic
1115755097 14:36521138-36521160 GGCCTGGCCGGAGCAACGCGGGG - Intronic
1119480914 14:74956999-74957021 TGCCTGGCCGGCCCTAAGCCTGG + Intergenic
1122430239 14:101635642-101635664 CGCCAGGACCGCCCCACGCTGGG - Intergenic
1122971660 14:105154710-105154732 GGCCTGGCCTGCGCCACGCGGGG - Intronic
1123007914 14:105333305-105333327 CCCCTGGCCTGCCCCAGGCGGGG + Intronic
1125674393 15:41494569-41494591 CGCCTGGCCGACCTCTCGCCTGG + Intronic
1126592431 15:50354351-50354373 AGCCTGGCCAGTCCCGCGCGGGG - Intronic
1126767063 15:52019635-52019657 CGCCTGGCCGGCCCCACGCGGGG - Intronic
1126823639 15:52528855-52528877 CGCCTGGGCGGCCGCCCGAGCGG + Exonic
1127309586 15:57740321-57740343 CGCCTGGCTTGCCCCACCCCAGG + Intronic
1132843557 16:1990031-1990053 CGTCCGGCCGGCCCCGCCCGAGG - Exonic
1132851439 16:2026741-2026763 CGCCCGGCCAGCCCGAGGCGGGG - Intronic
1133284104 16:4682703-4682725 CGCCTGCCAGGACCCACGCAAGG - Intronic
1138619235 16:58198164-58198186 AGCCTGGGCGGCCCCAGGCCGGG - Intergenic
1139545762 16:67648827-67648849 CGCCTGCCCCTCCCCACTCGCGG + Intronic
1142415177 16:89937219-89937241 TGCCTGGCCGACCCCTCGCATGG + Intergenic
1143166357 17:4899147-4899169 CCCCTGGCAGGCACCCCGCGCGG + Intronic
1144822871 17:18087827-18087849 AGCCTGGCCGGCCCAGCGGGCGG + Intergenic
1147015666 17:37489795-37489817 CGCCTGGCCGCCCTCTCCCGAGG - Intergenic
1148878561 17:50707686-50707708 CGCCTGCCCCGCCCCGCCCGGGG + Exonic
1151345581 17:73499407-73499429 CATCTGGCCGGCCCCAGGCTGGG - Intronic
1151674088 17:75589086-75589108 CGCCTGGCGGGGGCCTCGCGAGG - Intergenic
1151711524 17:75809725-75809747 CTCCCGGCCTGCCCCACGCGGGG + Intronic
1151956234 17:77381483-77381505 GGCCTGGCCTGCCCCTCGCAGGG - Intronic
1154197821 18:12279260-12279282 GGCCAGGCCGGCCACACGCCTGG - Intergenic
1160380465 18:78450956-78450978 CACCTGGCCAGTCCCACGCTGGG - Intergenic
1160531413 18:79567158-79567180 CCCCTGGCCGGCGCCAAGCCCGG + Intergenic
1161280325 19:3442165-3442187 CTCCTGGCCGCCTCCACCCGAGG + Intronic
1162442520 19:10701719-10701741 CGCCTCGCCGCCTCCCCGCGCGG - Intronic
1163754353 19:19097609-19097631 CGCCTGGCCAGCCCCAAGGTGGG + Intronic
1164693820 19:30228765-30228787 CGCCCAGCCGCCCACACGCGAGG - Intronic
1166276769 19:41759150-41759172 TGCCTGGCCGGCTCCACCTGGGG - Intronic
1166669884 19:44703538-44703560 CTCCTGGCCCGGCCCACACGGGG + Exonic
1167269610 19:48499596-48499618 ACCCCGGCCGGCCCCACGCCGGG + Exonic
925384194 2:3450574-3450596 TGCCTGGCAGGCACCATGCGAGG - Intronic
927685690 2:25168870-25168892 TGCCCGGCCTGCCCCACACGGGG - Exonic
934522032 2:95025685-95025707 GGCCTGGGCGCCCCCGCGCGCGG - Exonic
941367035 2:164621602-164621624 CGGCTGGCCGGCCCCGCGCGTGG + Exonic
944114465 2:196171747-196171769 CGCCTGGCTGGCCCGAGGCGGGG + Intronic
1169244588 20:4015570-4015592 CGGCGGGCCCGCCCCTCGCGAGG - Intronic
1169327400 20:4686837-4686859 CGCTGGGCCGGACCCGCGCGGGG - Intronic
1169457887 20:5768366-5768388 TGGCTGGCCTGCCCCACGCTTGG + Intronic
1170889146 20:20364478-20364500 CGCCTGGCCGCCACCCCGCCCGG - Intergenic
1171374045 20:24680054-24680076 GGCCTGGCAGGCCCCAAGAGGGG - Intergenic
1171374826 20:24685384-24685406 CACCTGGCAGGCCCCAGGCAGGG - Intergenic
1173824009 20:46035767-46035789 TCCCTGGCAGGCCCCACGCATGG + Exonic
1173831488 20:46091921-46091943 GGCCTGGCGGGCCCCACACTCGG + Intergenic
1175399741 20:58693342-58693364 CGCCAGGCGGGGCCGACGCGCGG - Intronic
1175439606 20:58981421-58981443 CGGCGGGCCGGCCCCACTCCCGG + Intronic
1176087941 20:63306584-63306606 TGCCCAGCCGGCCCCAGGCGTGG + Intronic
1176146909 20:63569570-63569592 CGCCAGGCCGGCTCTACGCACGG - Exonic
1178910390 21:36669002-36669024 GGCCTGGCCGGCCCCACCGCTGG + Intergenic
1179912092 21:44455806-44455828 CTCCCGGCCGGCTCCGCGCGCGG + Intronic
1180868943 22:19135205-19135227 CGCCAGGCCTGCCACACGCCAGG + Intronic
1181030522 22:20147150-20147172 CGCCGGGGCACCCCCACGCGGGG + Exonic
1181461462 22:23088537-23088559 TGCCTGGCATGCCCCAAGCGGGG - Intronic
1183250341 22:36725811-36725833 CCTCTGGGCGGCCCCACGGGCGG + Intergenic
1184361974 22:44024314-44024336 CCCGCCGCCGGCCCCACGCGCGG + Intronic
1185409677 22:50674979-50675001 CGCCCCGCCGGCCCCATGCGGGG - Intergenic
950449153 3:13055862-13055884 TGCCTGGCCTGCCCCACCCCGGG - Intronic
954395785 3:50292571-50292593 CGGCTGGTGGGCCCCAGGCGTGG - Exonic
968051682 3:195658609-195658631 CGCCCCGCCGGCCCCACCCACGG - Intergenic
968104134 3:195989724-195989746 CGCCCCGCCGGCCCCACCCACGG + Intergenic
968199558 3:196740263-196740285 CGGCTCCCCGGCCCCGCGCGGGG - Intronic
968473540 4:792405-792427 CGCCGGGCCGGCCCCGCCTGCGG - Intronic
968625131 4:1623549-1623571 GGCCTGGCCGGCCCCTCCTGCGG + Intronic
968659556 4:1793468-1793490 AGCCTGCCCGGCCCCAAGCACGG - Intronic
968910058 4:3473023-3473045 CACCGGGCAGGCCCCACGCTGGG + Intronic
974792789 4:66712703-66712725 GGCTTGGCAGGCCCCACACGCGG - Intergenic
979455498 4:120922384-120922406 CGCCTGGCCCGGCCCGGGCGAGG + Intronic
982745928 4:159103805-159103827 CGCCTCCCCGGCTCCACTCGGGG - Intergenic
985014900 4:185623706-185623728 AGCCTCGCCGGCCCCGAGCGGGG + Exonic
985497750 5:218879-218901 CGCCCCGCCGGCCCCACCCACGG - Intronic
1001296817 5:170504308-170504330 CGCCGGGCCGGGTCCTCGCGCGG + Intronic
1002282790 5:178142734-178142756 CACGTGGCCGGCTCCAGGCGTGG + Intronic
1002784787 6:392647-392669 CCCCTGGCGGCCTCCACGCGCGG - Intronic
1006472334 6:34235997-34236019 CGCCTGGCCCGCCCGGCGCCCGG - Intergenic
1007406457 6:41638594-41638616 CGCATGGCGGGCCCCGCGCGGGG + Exonic
1015244528 6:131062569-131062591 CGGCGCGCCAGCCCCACGCGCGG - Intronic
1015831804 6:137377858-137377880 CGCCTGGCAGGCACCTCGCCTGG + Intergenic
1016802808 6:148183646-148183668 AGCCAGGCTGGCCTCACGCGTGG + Intergenic
1018598685 6:165514618-165514640 AGCCTGGCCGGCCCTCCGCTAGG + Intronic
1021828008 7:24573636-24573658 CCCCCGGCCGGCCCGGCGCGCGG - Intronic
1023382628 7:39623720-39623742 CGCCTGGAAGGCCCCGCGCCGGG - Exonic
1025738957 7:64181637-64181659 CGCCGGGCCGGCCCCGCGGTGGG + Intronic
1029697682 7:102224964-102224986 TGCCAGGCCGGCCCCTCGCATGG + Intronic
1029708231 7:102286560-102286582 CGCCGAGCCGGCCCCAGGCCAGG - Intronic
1037865652 8:22440765-22440787 GGCCGGGCCGGCCTCCCGCGCGG + Intergenic
1040471375 8:47738080-47738102 AGCCTGGACGGCCCGGCGCGCGG - Exonic
1046497753 8:115036779-115036801 GGCTTGGCCGGCCCCACACTGGG + Intergenic
1047381764 8:124371707-124371729 CGCCTGTCTGGCCCCACGCCTGG - Intronic
1049162038 8:141103811-141103833 CGCCTGTCAGGCCCCAGGTGAGG - Intergenic
1049660067 8:143815874-143815896 AGCCGGGCCCGCCCCGCGCGCGG + Intergenic
1049746415 8:144265119-144265141 CCCCTGGGCGGCCCGAAGCGGGG - Intronic
1050294889 9:4195368-4195390 GGCTTGGCCGGCCCCACACTCGG + Intronic
1053312304 9:37027484-37027506 CGCCGTGCCTGCCCCAGGCGTGG + Intronic
1055654664 9:78440378-78440400 CGCCTGTCCGGCCCCATCAGCGG - Intergenic
1057259642 9:93576596-93576618 CGCCTGGCCGGGAGCGCGCGCGG + Exonic
1057276221 9:93677215-93677237 CAGCTGGCCGGCCCCACGGCTGG - Intronic
1058053317 9:100427342-100427364 CGCCTCGCCGGCCCCTCCCCCGG + Intronic
1060221350 9:121765692-121765714 GGCCTGGCCTGCCCCAGGCTGGG + Intronic
1061028948 9:128068238-128068260 CGCCTGGCTTGCCTCCCGCGCGG + Exonic
1061802756 9:133121174-133121196 CGCGGGGCCGGCCCGGCGCGCGG + Exonic
1062374207 9:136254678-136254700 CGCAGGGCCGGCCCCCTGCGTGG - Intergenic
1062374977 9:136258008-136258030 CGCCTGGCTGGCCCCCCGAACGG + Intergenic