ID: 1126773614

View in Genome Browser
Species Human (GRCh38)
Location 15:52081003-52081025
Sequence ATTCTAGTCTGGGGCAGCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126773607_1126773614 25 Left 1126773607 15:52080955-52080977 CCAGATTATGTTCTGTAAGTACT No data
Right 1126773614 15:52081003-52081025 ATTCTAGTCTGGGGCAGCAAAGG No data
1126773610_1126773614 -3 Left 1126773610 15:52080983-52081005 CCACGGAAAGGAAACAGCTCATT No data
Right 1126773614 15:52081003-52081025 ATTCTAGTCTGGGGCAGCAAAGG No data
1126773606_1126773614 26 Left 1126773606 15:52080954-52080976 CCCAGATTATGTTCTGTAAGTAC No data
Right 1126773614 15:52081003-52081025 ATTCTAGTCTGGGGCAGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126773614 Original CRISPR ATTCTAGTCTGGGGCAGCAA AGG Intergenic
No off target data available for this crispr