ID: 1126774265

View in Genome Browser
Species Human (GRCh38)
Location 15:52086458-52086480
Sequence GTTTTTAAGAGAATTATGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 564
Summary {0: 1, 1: 0, 2: 3, 3: 44, 4: 516}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126774265_1126774273 11 Left 1126774265 15:52086458-52086480 CCCTTCATAATTCTCTTAAAAAC 0: 1
1: 0
2: 3
3: 44
4: 516
Right 1126774273 15:52086492-52086514 ACCCCTCAGAGATGGATTCGAGG 0: 1
1: 0
2: 0
3: 3
4: 82
1126774265_1126774275 12 Left 1126774265 15:52086458-52086480 CCCTTCATAATTCTCTTAAAAAC 0: 1
1: 0
2: 3
3: 44
4: 516
Right 1126774275 15:52086493-52086515 CCCCTCAGAGATGGATTCGAGGG 0: 1
1: 0
2: 0
3: 2
4: 76
1126774265_1126774270 3 Left 1126774265 15:52086458-52086480 CCCTTCATAATTCTCTTAAAAAC 0: 1
1: 0
2: 3
3: 44
4: 516
Right 1126774270 15:52086484-52086506 AGCCCAGAACCCCTCAGAGATGG 0: 1
1: 1
2: 3
3: 28
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126774265 Original CRISPR GTTTTTAAGAGAATTATGAA GGG (reversed) Intergenic
902083905 1:13842116-13842138 CTTTTTGTGACAATTATGAATGG + Intergenic
902544305 1:17178160-17178182 ATATTTAAGACAATTATAAATGG + Intergenic
905084501 1:35359523-35359545 GATGTTAAGTGAAGTATGAACGG + Intronic
905317476 1:37092646-37092668 TTTTTGAAGAGAAGAATGAAAGG - Intergenic
907389706 1:54150292-54150314 ATTTTTTAGAAAATTATTAACGG + Intronic
907757571 1:57325706-57325728 TTGTTTAAGTGAATTATTAAAGG + Intronic
908697541 1:66860915-66860937 TTTTCTAAGAGAACAATGAAGGG - Intronic
909298000 1:73975446-73975468 GTTTTTATTAGAATTAGGACGGG - Intergenic
910413820 1:86975767-86975789 GTATTTAAAAGCATTATCAATGG + Intronic
910483420 1:87683454-87683476 TTTTTTAAAAGAATTTTTAATGG - Intergenic
910537523 1:88315597-88315619 GTTTTACAGAGAGTAATGAAAGG - Intergenic
911427533 1:97738384-97738406 GTTTGTAAGAAAATAAAGAATGG + Intronic
911584416 1:99674070-99674092 GTTTTTTAAACAATTATCAATGG + Intronic
912188068 1:107304517-107304539 GTTTTTTATAGAATTTAGAAGGG - Intronic
913118386 1:115717445-115717467 GTTTTTAAGAGGATCATGGAAGG - Intronic
913304412 1:117410937-117410959 GTTTTTGAGAGAAATTTAAAAGG + Intronic
913480610 1:119285684-119285706 GGTTTTAAGGGGATTATGGAGGG - Intergenic
913667280 1:121059991-121060013 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914018970 1:143847134-143847156 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914657521 1:149755341-149755363 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
916396105 1:164389203-164389225 GTTTTTAAAAGAGATATGACAGG - Intergenic
916640740 1:166726141-166726163 GTTTTTAAGATAATTTCGATGGG - Intergenic
916837211 1:168558479-168558501 GCTTTTAAGAGAATTCTTTATGG + Intergenic
917221493 1:172734167-172734189 TTTTTTAAAAAAATTATGACTGG + Intergenic
917524758 1:175778165-175778187 ATTTTTATGATAATTGTGAATGG - Intergenic
918677503 1:187305712-187305734 CTTTTTATGGCAATTATGAATGG - Intergenic
918747925 1:188229914-188229936 ATTTTAAAGATAAATATGAAGGG + Intergenic
919200236 1:194347457-194347479 GGTTTTAAGAAAATCATGCAAGG - Intergenic
919213121 1:194514028-194514050 GTTTTTAAAAGAACTTTGTAAGG + Intergenic
919352357 1:196473895-196473917 GTATTTAATACAATTTTGAAAGG - Intronic
919405208 1:197172198-197172220 GTTTGTAAGAAAATTTTTAAAGG - Exonic
920752931 1:208698616-208698638 GTTTTTAAAAGGATCATGGAGGG - Intergenic
920873738 1:209815756-209815778 GTTTTTAAGAGTTTTATCCAAGG + Intergenic
920894126 1:210027190-210027212 GTTATTAAGAAAATTATAAGGGG + Intronic
921242493 1:213199877-213199899 CTTTTTGTGGGAATTATGAATGG - Intronic
923408428 1:233685713-233685735 GTTTTTATGAGAATTATGCCAGG + Intergenic
923820738 1:237437453-237437475 GTTTTTATGGGAAATCTGAAGGG + Intronic
924034552 1:239923172-239923194 GTTTTTAAGGGGATTATGGAAGG + Intergenic
924328693 1:242921251-242921273 GTTTTTAAGGGAATTATAGAAGG + Intergenic
924402445 1:243700360-243700382 GTTATTAAGTGAAGTAAGAAAGG - Intronic
1063292424 10:4763046-4763068 GTTATTGAGAAAATGATGAATGG - Intergenic
1064599147 10:16975598-16975620 GTCTTTAAGAGAAGTTTGAATGG - Intronic
1065764286 10:29012467-29012489 GTTTTGAAGATAATTGGGAAAGG + Intergenic
1065826583 10:29577815-29577837 TTTTTTGATACAATTATGAATGG - Intronic
1066256373 10:33683047-33683069 TTTTTTTAGAGATCTATGAAGGG + Intergenic
1067486880 10:46658825-46658847 CTTTTTATGCGACTTATGAAAGG + Intergenic
1068146339 10:53075785-53075807 GTTTTTAAGAAAATTGTGGAGGG - Intergenic
1068517444 10:58041873-58041895 GATTTTAGGAGGATTATGGAGGG + Intergenic
1068997513 10:63224521-63224543 ATTTTAAAGAGGATTATTAAAGG + Intronic
1069171420 10:65234535-65234557 GTTTTTATGGGGATCATGAAAGG - Intergenic
1069232027 10:66022411-66022433 AATTTAAAGAGAATCATGAATGG - Intronic
1069439348 10:68413616-68413638 ATTATAAAGAGATTTATGAAGGG - Intergenic
1069645099 10:69990458-69990480 GTTTTTAAAAGAATAATGCAAGG + Intergenic
1070608119 10:77913896-77913918 GTCTTTAATAGAATTTTAAAAGG + Intronic
1071361598 10:84851737-84851759 GTTTTTAAGGGGATCATGGAAGG - Intergenic
1071614582 10:87063528-87063550 GATTTTAAGACACTCATGAATGG - Intronic
1071926890 10:90419684-90419706 GGTTTTATGAGAATTATCTAGGG - Intergenic
1072090615 10:92123462-92123484 GTTGTTAAGAGGATTATGTGAGG - Intronic
1074810663 10:117101943-117101965 ATTTTTAAAAAAATTATAAATGG + Intronic
1075660496 10:124192530-124192552 GTTATTAAGCGAATTAGGGAGGG - Intergenic
1077693157 11:4367796-4367818 CTTTTTAAAAGAAATATGATAGG + Exonic
1078848775 11:15144984-15145006 GATTTTCAGTGAATTAGGAAAGG + Intronic
1078958258 11:16228468-16228490 CTATTTAAGAATATTATGAATGG + Intronic
1080410080 11:32015083-32015105 GCTTAAAGGAGAATTATGAAGGG + Intronic
1080829086 11:35874601-35874623 CATTTTAATAGAATTTTGAAAGG - Intergenic
1082727373 11:56752356-56752378 GTTATTAAGAGAATTGAGATGGG + Intergenic
1083550582 11:63586438-63586460 GTTATTAACAGAATAAAGAACGG - Intronic
1084204186 11:67582013-67582035 TTTTTTAAGAGACTTATTATCGG - Intergenic
1085838073 11:79977730-79977752 GTTTTTAAGTAAATTGTTAAAGG + Intergenic
1086154749 11:83653391-83653413 CTGTTTAAGAGAATTATATATGG - Intronic
1086382626 11:86273362-86273384 ATATTTAAGACAATTATAAATGG - Intronic
1086474861 11:87161832-87161854 GTTTTAGAGAGATTCATGAATGG + Intronic
1086785102 11:90958996-90959018 GTTTTTATGGTAATTGTGAATGG - Intergenic
1087954307 11:104265907-104265929 ATTTTTAAGGCAATTATGAATGG - Intergenic
1089026487 11:115275658-115275680 GTTTTTAAGAGATTTTAGAGGGG + Intronic
1091147837 11:133295605-133295627 GTTTATTAGAGAAGTAAGAATGG + Intronic
1091192041 11:133704159-133704181 GTTTTTATAAGAAATATGGAGGG + Intergenic
1092505754 12:9097925-9097947 GTTTTTATAAGAATTATGGCTGG - Intronic
1092618886 12:10240791-10240813 GTTTTTAAGTAAATTATACAGGG + Intergenic
1093388451 12:18587446-18587468 CTTTTTATGGCAATTATGAAAGG - Intronic
1094059595 12:26299697-26299719 GGTTTCAAGAGAAAGATGAAAGG - Intergenic
1094345454 12:29463422-29463444 GTGTTTAAGAGAAAGAAGAAAGG + Intronic
1094417294 12:30230871-30230893 GTTTTTAAGAGGATCATGGAGGG + Intergenic
1094756355 12:33473871-33473893 GTTTCTAAGTAAGTTATGAATGG + Intergenic
1095127798 12:38502716-38502738 CTTCTTAGGAGAATTATGAGAGG + Intergenic
1095142031 12:38675817-38675839 GTTCTTAAGAAAATAATTAAAGG + Intronic
1096057934 12:48670522-48670544 GTTTTTAACAGAAGTTTAAAAGG + Intronic
1097506746 12:60483109-60483131 TATTTTAAAAGAAATATGAAAGG + Intergenic
1097584789 12:61502816-61502838 TTTTTAAAGAGAATTATATATGG - Intergenic
1097709039 12:62898289-62898311 GTTTTTAAGTTAATTAAGTACGG + Intronic
1098351422 12:69565602-69565624 GTTTTTAACAGAAGTTTTAAAGG - Intronic
1099307477 12:80975800-80975822 AAATTTAAGAGAAATATGAATGG + Intronic
1099334829 12:81341995-81342017 TTTTTAAAGAGAATAATAAAAGG + Intronic
1099554595 12:84095663-84095685 GTATGTAATAGAATTATAAAAGG - Intergenic
1099620379 12:84996201-84996223 ATTTTTAAGGGGATTGTGAAGGG - Intergenic
1099752450 12:86793176-86793198 TATTTTAAGATAATTATGCAGGG + Intronic
1099886929 12:88543020-88543042 ATTTTTAACAAAATTCTGAAAGG - Intronic
1100505891 12:95219524-95219546 TGTTTTCAGAGAATGATGAATGG - Intronic
1102407543 12:112686825-112686847 TTTTTTAACTGAATTATAAAGGG + Intronic
1103022393 12:117545919-117545941 ATATTTAAGACAATTATTAAAGG - Intronic
1104334213 12:127878218-127878240 TTTATTAAGAGAAATAGGAAAGG - Intergenic
1104445432 12:128829266-128829288 ATTTTTGATAGAATTATGATAGG - Intergenic
1105249203 13:18681711-18681733 GTTTCTAAAAGCTTTATGAAAGG + Intergenic
1105575546 13:21647913-21647935 GTTTATAACTGAATTCTGAAAGG + Intergenic
1106149509 13:27085126-27085148 GTTTCTAATAGTATTATAAATGG + Intronic
1106353206 13:28954877-28954899 GTTATGAAGAGACTTCTGAATGG - Intronic
1109256290 13:60087384-60087406 GTGTTTAAAAGTATTTTGAAAGG - Intronic
1109469114 13:62780926-62780948 GGTTTATGGAGAATTATGAATGG - Intergenic
1110538824 13:76684643-76684665 GTTTTTAAGATAACTTGGAAGGG + Intergenic
1110648435 13:77916614-77916636 GATTTTTAGAGATTTATGAAGGG + Intronic
1110798937 13:79672377-79672399 GTGTTTATGAGAATTATTATTGG + Intergenic
1110801341 13:79700273-79700295 CTTTTTTAAAGAAATATGAATGG + Intergenic
1110904932 13:80875094-80875116 ATGTTTAAGACAATTATGATTGG + Intergenic
1111257665 13:85693672-85693694 TGTTTTAAGATAAATATGAATGG - Intergenic
1111422580 13:88034278-88034300 GTTTTTTACAGCAATATGAAGGG - Intergenic
1111479391 13:88803257-88803279 TTTTGTAAAAGAATTGTGAAAGG - Intergenic
1111502070 13:89134460-89134482 ATTTTTCAGTGCATTATGAATGG - Intergenic
1111628534 13:90819724-90819746 GTTTTAAAGTGAATTTTGGAAGG + Intergenic
1111946928 13:94675853-94675875 GAGTTTAAGAGAATTCTGAATGG - Intergenic
1112056507 13:95693468-95693490 GTGTTTAATTGAATTAGGAAGGG - Intronic
1112523117 13:100116360-100116382 ATTTTTAAGGTAATTATGCAAGG + Intronic
1112773813 13:102822646-102822668 GTTTATAACAGAAATATTAATGG + Intronic
1112830066 13:103438640-103438662 GTTTTTAAGAAAGGCATGAAAGG + Intergenic
1114782919 14:25559638-25559660 GTTTTTAAAAGAATTATATTGGG + Intergenic
1115696814 14:35908363-35908385 ATATTTAAGACAATTATAAATGG + Intronic
1115941299 14:38613197-38613219 GTTTTTAAGATTTTTATCAATGG - Intergenic
1116416166 14:44680112-44680134 TTTTTAAAGTGAATTATCAAAGG + Intergenic
1116562364 14:46396837-46396859 GTTATTAAAAGAAATTTGAACGG + Intergenic
1116602623 14:46946527-46946549 CTTGTTAAGAGAAATATTAATGG + Intronic
1117453764 14:55877182-55877204 GTTTTTTAGTGGATTATGAGGGG - Intergenic
1117774932 14:59174040-59174062 GTTTTTAAAATGATAATGAAAGG - Intergenic
1118109389 14:62698973-62698995 GTTTTGAAAAAAATTATAAATGG - Intergenic
1118975077 14:70669609-70669631 GTTTTTTAAAGACTTTTGAAAGG - Intronic
1119089802 14:71771111-71771133 TCTTTAAAGAGAATTATGAAAGG + Intergenic
1120285678 14:82497720-82497742 GGTCTTAAGAGAATTACCAAAGG + Intergenic
1120670891 14:87360931-87360953 GTTTTTAAAATAATTAGGACTGG + Intergenic
1121953567 14:98193983-98194005 GTTTTTTAGAGAATAATTGAAGG + Intergenic
1122252037 14:100446614-100446636 TTTTTGAAGTGAATTATGATTGG - Intronic
1202841219 14_GL000009v2_random:123636-123658 GTTTTTAACGAAATTATGTAGGG + Intergenic
1202910610 14_GL000194v1_random:113866-113888 GTTTTTAACGAAATTATGTAGGG + Intergenic
1202881982 14_KI270722v1_random:68793-68815 GTTTTTAACAAAATTACGTAGGG - Intergenic
1124198014 15:27650221-27650243 GTTTTTAAGGGGATCATGGAGGG + Intergenic
1124217253 15:27817607-27817629 GTTTCTAAGAGGATCATGGAGGG - Intronic
1125991483 15:44112912-44112934 CTTATAAAGAGAAATATGAAAGG - Intronic
1126774265 15:52086458-52086480 GTTTTTAAGAGAATTATGAAGGG - Intergenic
1127666267 15:61150030-61150052 GTTTTTAAGATAAGTATCATTGG + Intronic
1127744599 15:61953737-61953759 TTTTTAAAGAGAAATAAGAAAGG - Intronic
1128193255 15:65725327-65725349 ATTTTTAAGCGATTTATCAAAGG - Intronic
1128489312 15:68131167-68131189 CTTTTTAAAAAAATTATTAATGG - Intronic
1130049688 15:80473492-80473514 GCTGTTAAGAGAATTAAAAACGG - Intronic
1130647143 15:85738468-85738490 GTTTTTAAATGTATTATAAAAGG + Intronic
1131676930 15:94679980-94680002 ATTTTTAGGACAATTAGGAAGGG - Intergenic
1132183550 15:99782045-99782067 ATATTTAAGAGAAGTACGAATGG + Intergenic
1132183708 15:99783807-99783829 GTTTTTGAGGGAAATATGTATGG - Intergenic
1132434830 15:101791124-101791146 ATATTTAAGAGAAGTACGAATGG - Intergenic
1133849865 16:9492637-9492659 GTTTTTAAGGGGATCATGGAGGG + Intergenic
1134365226 16:13570936-13570958 ATTTTTAAGGGGATCATGAAGGG + Intergenic
1135688569 16:24517996-24518018 TTTTTTAAAAGACTTTTGAAAGG - Intergenic
1135780970 16:25300316-25300338 GGTTTGAAGAGAATTATTGAAGG + Intergenic
1136179743 16:28542859-28542881 GCTTTTAAGGGGATTATGGAGGG + Intergenic
1138372774 16:56540523-56540545 GTTTTTAAGAGGATCATGACAGG - Intergenic
1139048460 16:63092888-63092910 GTTTTAATGAGAACTATCAAAGG + Intergenic
1139175912 16:64687339-64687361 GTTTTTAATAGACTTTAGAAGGG - Intergenic
1140717389 16:77739089-77739111 GGTTGTAAGAGGAATATGAAGGG - Intronic
1140816807 16:78628743-78628765 GCTTTCAAATGAATTATGAAAGG + Intronic
1141979309 16:87540168-87540190 GCTTTCAAGAGAAATAAGAAGGG - Intergenic
1144297984 17:13897395-13897417 GTTCTTAAGAAGATAATGAAGGG - Intergenic
1144660561 17:17066330-17066352 TTTTTAAAAATAATTATGAATGG + Intronic
1146444798 17:32925083-32925105 TTTTTTAACAAAATTATGAGAGG + Intergenic
1146544271 17:33724878-33724900 TTTTTTAAGAAAAAAATGAACGG - Intronic
1147312747 17:39605034-39605056 GTTTTTAAAATAATAATGAGAGG + Exonic
1148527245 17:48351574-48351596 CTTTTTAAAAGAATGATAAATGG - Intronic
1148972311 17:51494502-51494524 GCTTTTAAGGGGATTATGGAAGG + Intergenic
1149150439 17:53556095-53556117 GATTTGAATAGAAATATGAATGG + Intergenic
1149815842 17:59722965-59722987 ATTTTTCTGAGAATTTTGAAAGG - Intronic
1149816118 17:59725376-59725398 GTTTTCAAGGGAATTTTGAAAGG + Intronic
1151104502 17:71596817-71596839 GTTGTTAAGAGAATTGTGTCTGG + Intergenic
1151281571 17:73078856-73078878 GTTTTTAAGTGGATAATGATGGG - Intronic
1153019715 18:616136-616158 GTTTTTAAATGAATCATTAAGGG + Intronic
1153257551 18:3187338-3187360 GTTTTTAAAAGAGTGAAGAAGGG - Intronic
1154320034 18:13341928-13341950 GTTTTTTAAAAAATCATGAATGG + Intronic
1156104735 18:33646572-33646594 GTATTTAAGAAAATTATTCAGGG - Intronic
1156287205 18:35708736-35708758 GTTATTAGGATAATTTTGAAAGG - Intronic
1156430803 18:37071871-37071893 CTCTTTAAGACAATTATAAATGG - Intronic
1156816279 18:41315449-41315471 GTTTTTAAGAATATTTTGGAAGG - Intergenic
1157466135 18:47947185-47947207 GTTTGTAAGATCATTTTGAAAGG - Intergenic
1157846564 18:51008986-51009008 GTTTTTAAGTGTCTTATCAAGGG - Intronic
1158035690 18:53027022-53027044 TTTTTTAAGTGAATAATAAAAGG - Intronic
1158484463 18:57852988-57853010 GTTTTTATGAGAATTATATTGGG + Intergenic
1158872632 18:61703147-61703169 GTTTTTAAGGGGATTCTGGAGGG - Intergenic
1162883782 19:13681000-13681022 GGTTTTAAGAGGATCATGGAGGG + Intergenic
1163939265 19:20477625-20477647 GTTTTTAAGGGTAATGTGAACGG + Intergenic
1165675210 19:37717093-37717115 GTTTTTCAGAGAGGAATGAAAGG - Intronic
1202631083 1_KI270706v1_random:259-281 GTTTTTAACAAAATTACGTAGGG - Intergenic
1202657599 1_KI270708v1_random:37892-37914 GTTTTTAACAAAATTACGTAGGG - Intergenic
925035229 2:679939-679961 GTTTTCAAGAGCTTTATTAATGG + Intergenic
926962151 2:18369375-18369397 TTTTTTAAAAGAATTTTGGAAGG + Intergenic
927792135 2:26018560-26018582 GATTTTCAGAGAATTCAGAAGGG - Intergenic
929419994 2:41780838-41780860 GTTTTTAAGGGGATCATGGAGGG - Intergenic
929803205 2:45122003-45122025 TTTCTTAAGAGAAATATAAAGGG + Intergenic
929841387 2:45467704-45467726 ATTTCTAAGAATATTATGAAGGG + Intronic
930117313 2:47729610-47729632 GTTTTTAAGGGGATCATGGAGGG + Intronic
930995101 2:57707357-57707379 TTTTTTAAAAGCATTATTAAAGG + Intergenic
931017966 2:58007540-58007562 GTTATTAAGAAAATTATAAGAGG - Intronic
931177259 2:59866415-59866437 GATATTATGAAAATTATGAATGG - Intergenic
931297392 2:60941678-60941700 TTATTTAAAAGATTTATGAAAGG + Intronic
931429763 2:62198843-62198865 GTTCTGAAGAGAAATATGCAGGG + Intronic
931620388 2:64204305-64204327 CTGTTTAAGAGAAATCTGAACGG - Intergenic
931768560 2:65478268-65478290 GGTTTTAACAGAGTCATGAAAGG - Intergenic
932298814 2:70649137-70649159 GTTTTCAACATAAATATGAATGG - Intronic
932445102 2:71775810-71775832 GTGTTAAAGAGAATAAAGAAAGG - Intergenic
932696175 2:73958652-73958674 ATTTTTAACAGAATTTTCAATGG - Intronic
933782995 2:85814689-85814711 GATTTTAATAGAATAAAGAAGGG - Intergenic
935142845 2:100369149-100369171 ATTTTTAAGGGGATTATGAAGGG + Intergenic
935496202 2:103784396-103784418 TTTTGCAAGAGAGTTATGAAGGG + Intergenic
936265392 2:111001275-111001297 GTTTCTAAGAGAATTATATCAGG + Intronic
936832775 2:116669171-116669193 TCTTTTAAGACAATTTTGAATGG - Intergenic
937283077 2:120733912-120733934 GATTTAAAGAGAAGTTTGAAAGG - Intergenic
937526655 2:122778905-122778927 GTTTTTAAGTGATTTTTTAAAGG - Intergenic
938061253 2:128256373-128256395 TTTATTAAGACAATTATAAATGG + Intronic
938251054 2:129816027-129816049 GTTTTTAAGGGGAATATGGAGGG + Intergenic
938936796 2:136134353-136134375 GTTGTAAAGGGAATTCTGAAAGG - Intergenic
939099291 2:137877363-137877385 GGTTTTAAGAGAATTTCCAAAGG - Intergenic
939111799 2:138017413-138017435 ATTTTTAAGAGAATTTTTGATGG - Intergenic
939313581 2:140517577-140517599 TTTTTTATGATAATTCTGAAAGG - Intronic
939562496 2:143749338-143749360 GGCTATAAGAGAAATATGAATGG + Intronic
940158176 2:150681404-150681426 GTTTTTAAGAGGATCATGGAGGG + Intergenic
940381073 2:153015516-153015538 GTTATTGAAAAAATTATGAAAGG - Intergenic
940982388 2:160018196-160018218 TTTTTTAAGAGATTGATGATAGG - Intronic
940999963 2:160191467-160191489 TTTTTTAAAAAAATTATAAATGG - Intronic
941202809 2:162534466-162534488 TGTTTTAATAGAATTATGCAAGG - Intronic
941219633 2:162760222-162760244 TTTTTTTAGAAAATTATGCAAGG - Intronic
941392153 2:164927470-164927492 GTTTTGGAGAAAATTATCAAAGG + Intronic
942344992 2:174993336-174993358 GTATTTAAGATAATCATGATAGG - Intronic
942738110 2:179139808-179139830 GTTTTTAAGGGGATCATGTAGGG - Intronic
943087896 2:183335384-183335406 GTTTTTTAAAAAATCATGAATGG + Intergenic
943409674 2:187531840-187531862 GTATTTAAGTGTATTATAAAAGG - Intronic
943425597 2:187729207-187729229 GTGTTTATGAGATTTGTGAATGG - Intergenic
943728372 2:191275471-191275493 GGTTTAAAGAGAACTAGGAAGGG - Intronic
943749279 2:191494734-191494756 TTTTTTAAAGGAATTATGAGGGG + Intergenic
943862276 2:192882796-192882818 GTTATTAAAAGAAGGATGAAAGG - Intergenic
943914216 2:193607438-193607460 GAATTTGAGATAATTATGAAAGG - Intergenic
943955132 2:194178565-194178587 GTTTTTAAGAGGATTATTGTGGG + Intergenic
943967880 2:194361355-194361377 GGTTTTGAGAGAAAAATGAATGG - Intergenic
944947345 2:204704553-204704575 GTATTTATGAGAATTTTGACTGG + Intronic
945436021 2:209818180-209818202 CTTTTGAAAAGAAATATGAATGG - Intronic
946551077 2:220802563-220802585 CTTTTAAAGAGATTTTTGAAGGG - Intergenic
946857230 2:223963004-223963026 GTTTTTAAAAACATTATTAATGG + Intronic
947176679 2:227374226-227374248 CTTTGTAAGTGAATCATGAAAGG - Intronic
947267205 2:228295757-228295779 GTTTTGTAGAGACCTATGAAGGG + Intergenic
947308851 2:228778282-228778304 GTTTTTAAGGGGATCATGGAAGG - Intergenic
948359882 2:237412696-237412718 GTTTTTTACAGCATTAAGAATGG + Intronic
949013039 2:241692761-241692783 GTTTTTAAGGGGATCATGGAAGG - Intergenic
1168841744 20:914228-914250 GTTTTTAAGAACATTAGGTAGGG + Intronic
1169188813 20:3644009-3644031 GTTTTTAAGATAATGAAAAAGGG - Intronic
1170105827 20:12753675-12753697 GTTTTTAAGTAAATTATCACTGG - Intergenic
1170421940 20:16201671-16201693 GTTTGAAAGACAATTAGGAATGG - Intergenic
1171166195 20:22974093-22974115 GTTTTTAAGAGGACTGTGGAGGG - Intergenic
1173840763 20:46155411-46155433 GTTTTTAAGATTATCTTGAATGG - Intergenic
1175021593 20:55856902-55856924 GTTTTTAAAAGAAAAATGAAGGG + Intergenic
1176597477 21:8760235-8760257 GTTTTTAACAAAATTATGTAGGG - Intergenic
1176629966 21:9128563-9128585 GTTTTTAACGAAATTATGTAGGG + Intergenic
1176643309 21:9326199-9326221 GTTTTTAACAAAATTACGTAGGG - Intergenic
1177017331 21:15808409-15808431 GTTTTATAAAGAATTATGACTGG - Intronic
1178940889 21:36904549-36904571 ATATTTAAGAGAATTATGGGTGG - Intronic
1180369627 22:11973017-11973039 GTTTTTAACAAAATTACGTAGGG + Intergenic
1180376611 22:12099088-12099110 GTTTTTAACAAAATTACGTAGGG - Intergenic
1180420965 22:12814599-12814621 GTTTTTAACAAAATTATGTAGGG + Intergenic
1181663878 22:24376339-24376361 GTTTTTATGTGAATTCTTAAAGG - Intronic
1182185476 22:28397247-28397269 GGTTTTATGAAAGTTATGAAGGG - Intronic
1182568071 22:31214174-31214196 GTTTCTTAGAAAATTGTGAAAGG + Intronic
1183141243 22:35942076-35942098 GTTTATAAGAGAATACTAAATGG - Intronic
1183283510 22:36947561-36947583 GTTTTTAAGGGGATTATAGAGGG - Intergenic
949287486 3:2424028-2424050 TCTTTTATGAGAATTTTGAAAGG - Intronic
949619747 3:5797313-5797335 TTTTTTAAGAAAATTTTGATTGG + Intergenic
950990454 3:17432793-17432815 GTTTTTAAGAATTCTATGAAAGG - Intronic
952506795 3:34014644-34014666 TTTATTAAGAGAATTATACATGG - Intergenic
953396415 3:42574630-42574652 CTATTTAAGACAATTATAAATGG + Intronic
954100546 3:48369235-48369257 ATTTTTAAGAGAAATAAGGAAGG - Intergenic
954479010 3:50780109-50780131 GTTTTTAAGAAAATTTAAAACGG - Intronic
955267339 3:57458141-57458163 CTTTTGGAGAAAATTATGAAAGG - Intronic
956543557 3:70372940-70372962 GATTTTAAAACAATTATAAACGG - Intergenic
956641689 3:71421806-71421828 TTGTTTAAGAGAATTATGGTAGG - Intronic
957096758 3:75784380-75784402 GTTTTTAACAAAATTACGTAGGG + Intronic
957446778 3:80323185-80323207 ATTTGTAAGAGAATTTTTAATGG - Intergenic
957498007 3:81015721-81015743 GCTATTAAGAGAACTATCAAAGG + Intergenic
957503228 3:81084954-81084976 TTTTTTAAGTGTGTTATGAAAGG + Intergenic
957511597 3:81195589-81195611 GTTCTGAGGTGAATTATGAAGGG + Intergenic
957769002 3:84663422-84663444 GTTTTTAAAAGGCTTATAAAAGG + Intergenic
957806894 3:85159369-85159391 GATTTTAAGGGAATTGTGGAAGG + Intronic
957880265 3:86203157-86203179 GCTTTGAAGAGAAATATGAAAGG - Intergenic
958121552 3:89296203-89296225 GTTTTTAAGGGAATCTAGAATGG + Intronic
959427829 3:106214982-106215004 GTTTTTAACATAAGTTTGAATGG + Intergenic
960215501 3:115031023-115031045 TTTTCTTAGAAAATTATGAAGGG - Intronic
960267733 3:115639891-115639913 ATATTTAAGAGAATCAAGAAGGG + Intronic
960689622 3:120331797-120331819 TTCTTTAAGATAATTATTAAAGG - Intronic
962064063 3:131960814-131960836 GGTTTTAAGGGGATTATGGAGGG - Intronic
962095490 3:132288312-132288334 GTTTTTAAGGGGATCATGGAGGG + Intergenic
962727528 3:138246592-138246614 GTTTTTTAGAGCTTTAAGAATGG - Intronic
963353826 3:144185361-144185383 GTTTTTAAAAGGATCATAAAGGG - Intergenic
963468080 3:145708670-145708692 GTTTCTTATTGAATTATGAAAGG - Intergenic
963772391 3:149401216-149401238 GTTTCTAAGATAATTATGAAAGG + Intergenic
964454057 3:156841344-156841366 GTTTTTATGAGAGTTATAGAGGG + Intronic
964676747 3:159291263-159291285 GTTTATAATAAAATTATAAAAGG + Intronic
965211509 3:165795909-165795931 GTTTTTATGAGAAAAAAGAAGGG + Intronic
965339143 3:167464351-167464373 GTTGAGAAGAGAATTAGGAAAGG + Intronic
965423509 3:168492562-168492584 GCTTATATGATAATTATGAAAGG + Intergenic
965446008 3:168774649-168774671 GATTTTAAAAAAAGTATGAATGG + Intergenic
965860955 3:173149606-173149628 TTTTTTAAGGAAATAATGAAGGG - Intergenic
966009763 3:175060269-175060291 GTTTATAAGTGAAATAGGAAGGG - Intronic
966327730 3:178775984-178776006 ATTTTTAAGAAAATTCTGCAGGG - Intronic
966358255 3:179105170-179105192 GTTTTTAAACGAATTATGAATGG + Intergenic
967600890 3:191387287-191387309 ATTTTGAAGTGAATTATGAAAGG + Intronic
1202743575 3_GL000221v1_random:78830-78852 GTTTTTAACAAAATTACGTAGGG + Intergenic
968939173 4:3629156-3629178 GTTTTTAAGGGGATCATGGAAGG - Intergenic
969386783 4:6855965-6855987 GTTTTTAAGAGTGTTTTTAAAGG + Intronic
969659189 4:8516461-8516483 GTTTTTCAGGGAATGGTGAAGGG - Intergenic
969703074 4:8778290-8778312 TTTTTAAAAAAAATTATGAAAGG - Intergenic
970145611 4:13032390-13032412 GTTGGTAAGAAAATGATGAAGGG + Intergenic
970329089 4:14960879-14960901 GTTATGAAGAGAATTATAATGGG - Intergenic
970475641 4:16419570-16419592 GTTTTTAAGAAAATCACTAAAGG - Intergenic
970944060 4:21669393-21669415 GTTATTAAGAAAATTATGGCTGG - Intronic
971015640 4:22486214-22486236 ATTTTCAACAGAATTTTGAAAGG + Intronic
971421660 4:26478936-26478958 GTTTTAAAAAGAATTTTAAAAGG - Intergenic
971813232 4:31454914-31454936 GTTTTTAAAAAATTTATTAATGG - Intergenic
971847318 4:31936169-31936191 GTTTCTAAGATAATATTGAAGGG + Intergenic
971912538 4:32812702-32812724 CCCTTTAAGAGGATTATGAAAGG + Intergenic
972136078 4:35895915-35895937 CTTTTTGTGACAATTATGAATGG - Intergenic
972309332 4:37865291-37865313 GTTTTGAAGAGATTTTTGAAAGG + Intergenic
972539444 4:40026497-40026519 GTTTTTAAAAAAATGGTGAATGG - Intergenic
972716887 4:41655579-41655601 GTTTTTTAGAGAATTACAATTGG - Intronic
972827841 4:42781953-42781975 GTTTTTAATATTTTTATGAATGG - Intergenic
972844745 4:42974178-42974200 GTTTTTAAGTGGATCATGGAGGG + Intronic
972982373 4:44721503-44721525 TTTTTTAAGAGAATGCTTAATGG + Intronic
973106952 4:46351602-46351624 ATTTTTAAAAGATATATGAATGG + Intronic
973360773 4:49162450-49162472 GTTTTTAACAAAATTATGTAGGG - Intergenic
974205810 4:58701958-58701980 GTTTTTAACTCAATGATGAAAGG + Intergenic
974480538 4:62437581-62437603 GTTTTTAAGGGGATTATGGAGGG + Intergenic
975453185 4:74554267-74554289 ATTTTTAAGCAAATTAAGAATGG + Intergenic
976005623 4:80426239-80426261 TTTTTGAAGGGAACTATGAAAGG + Intronic
976501355 4:85793903-85793925 GTTTTTAAGAGAATTTACTAAGG + Intronic
976955420 4:90892194-90892216 GTTTTTTTGATAATTAAGAAAGG + Intronic
977355893 4:95945862-95945884 TTTTTTAAAACTATTATGAATGG - Intergenic
977391666 4:96417416-96417438 GTGTTTAAGAGAAATATTTATGG - Intergenic
978105979 4:104902302-104902324 GATTTTAAGACCATTAGGAAAGG + Intergenic
978518416 4:109594381-109594403 CTTTTCAAGAGAACTGTGAAGGG + Intronic
978950682 4:114555183-114555205 TTTTTTAAAACAATTATGAGAGG - Intergenic
979160380 4:117452452-117452474 GTGTGTATGACAATTATGAAAGG - Intergenic
979495564 4:121379317-121379339 GAGTTTAAGAGAATTAGTAATGG + Intronic
979702017 4:123679954-123679976 GTTTTTAAGACAAATATGTGAGG - Intergenic
979708183 4:123746463-123746485 GTTTTTATGAAAATTATATAAGG - Intergenic
979768460 4:124491967-124491989 TTTTTTAAAACAATTATGAATGG + Intergenic
979993968 4:127408872-127408894 ATTTTTTAGAGGATGATGAATGG - Intergenic
980246492 4:130251502-130251524 ATTTTTTAAAGGATTATGAAGGG + Intergenic
980429555 4:132675803-132675825 GTTTTCAAGTGAATGATGGAGGG + Intergenic
980845829 4:138323661-138323683 GATATTAAAAGAATTATAAAGGG + Intergenic
981009631 4:139912178-139912200 GTTTTTGAGACAATGAGGAAGGG + Intronic
981963615 4:150573959-150573981 TTTTTTAAGTTAATTGTGAATGG + Intronic
982078011 4:151757970-151757992 ATTTTTAAGAAAAGTATGAAGGG - Intronic
982385778 4:154800471-154800493 GTTTGAAGGATAATTATGAAAGG + Intronic
982598062 4:157410335-157410357 GTTTTTAACAGCAATATGAAAGG + Intergenic
982720034 4:158849668-158849690 ATTTTTCTGAGAATTTTGAAAGG - Intronic
983073180 4:163293392-163293414 GTTTTTATGAGAAATCTCAAGGG - Intergenic
983330319 4:166318919-166318941 GTTAGTGTGAGAATTATGAAAGG - Intergenic
983451564 4:167918212-167918234 GTTTTTAAGGGGATCATGGAGGG + Intergenic
983612199 4:169659953-169659975 GGTTTTAAGATAAATATAAAGGG - Intronic
983612581 4:169665701-169665723 CTTTTTAAAAAAATTATGGAAGG - Intronic
983844932 4:172506332-172506354 GTTTTTATGAGGATCATGGAGGG - Intronic
984681621 4:182616932-182616954 GTGCTTTAGAGAATGATGAAAGG - Intronic
984893036 4:184510358-184510380 GCTTTTAAGGGGATCATGAAGGG + Intergenic
1202758215 4_GL000008v2_random:84521-84543 GTTTTTAACAAAATTACGTAGGG - Intergenic
985976994 5:3427768-3427790 GTTTTTAATACAATAATCAATGG - Intergenic
986494352 5:8327827-8327849 CTTATTAAGAGACTTTTGAATGG - Intergenic
987858279 5:23449967-23449989 ATTTGTTAGAGAATTCTGAAAGG + Intergenic
988823135 5:34907734-34907756 CTTTTGAAGAGATCTATGAATGG - Exonic
988947402 5:36219523-36219545 TTTTTTAACAGCATTATTAATGG + Intronic
989432142 5:41368210-41368232 CTTTTTATGGCAATTATGAATGG + Intronic
989436790 5:41423005-41423027 TTTTTAAAAAAAATTATGAATGG + Intronic
989575628 5:42985494-42985516 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
989754152 5:44932456-44932478 GTTTTTAAGAGAAATGAAAATGG - Intergenic
991092701 5:62708391-62708413 GTTTTTAAGGGAATTGTGAAGGG + Intergenic
991272815 5:64805784-64805806 TTTTTAAAGACACTTATGAAAGG - Intronic
992297018 5:75336085-75336107 GTGTTTGAGGGAATTAGGAAAGG + Intergenic
993540345 5:89141561-89141583 GTTTTTAAGAAGGTTGTGAAAGG + Intergenic
993579916 5:89647807-89647829 GTTTTTATGAGAACTAAAAATGG - Intergenic
994601600 5:101912354-101912376 CTTTTTGAGGGAATTGTGAATGG + Intergenic
994899905 5:105758469-105758491 GTTCTTAATAGAATTTAGAATGG + Intergenic
995058144 5:107785279-107785301 GTTTTTACAATAATTTTGAATGG + Intergenic
995116046 5:108480760-108480782 GTTTATAAGACAAATATAAAAGG - Intergenic
995552073 5:113291758-113291780 GTGTTTAAGAGAAAAATGACAGG + Intronic
996266894 5:121552184-121552206 ATATTTAAGATAATTATAAATGG + Intergenic
996723986 5:126657820-126657842 CTTTTTAACAGAAAGATGAAGGG - Intergenic
996770234 5:127078038-127078060 CATTTAAAAAGAATTATGAATGG - Intergenic
996848799 5:127930478-127930500 GCTTTGAAGAGAATAATGGATGG - Intergenic
996911565 5:128661869-128661891 GTTCTTTACAGCATTATGAAAGG + Intronic
997156722 5:131568976-131568998 CTTCTTAATAGGATTATGAATGG - Intronic
998324054 5:141263115-141263137 GTCTTTAAAACAATTCTGAATGG + Intergenic
998662282 5:144253016-144253038 TTTATTAAGAGAATTAGAAATGG - Intronic
998843963 5:146286966-146286988 GTTTTGATGAGAATGATGGAAGG + Exonic
999080140 5:148835693-148835715 TTTTTTTATAGAATTGTGAAGGG + Intergenic
1000005999 5:157185543-157185565 GTTTTTAAAATAATTAAGCAAGG + Intronic
1000057555 5:157620707-157620729 GGATTTAAGAGAATTTTCAAAGG - Intergenic
1000152034 5:158512401-158512423 GTTTTTAAAACAAGAATGAATGG - Intergenic
1001868471 5:175128316-175128338 GTATTTAACAAAGTTATGAAGGG + Intergenic
1002084622 5:176765752-176765774 ATTTTTAAGATAATTACAAAAGG - Intergenic
1002692260 5:181058772-181058794 GTTTTTAAAAGGATTTTAAAAGG - Intronic
1003462380 6:6341962-6341984 GTTTTTAAGAAAATTATATGAGG - Intergenic
1003518354 6:6836334-6836356 CTTGTTAAAAAAATTATGAAGGG - Intergenic
1003674579 6:8191448-8191470 GTTTTTAATGTAATTATGTAAGG - Intergenic
1004454789 6:15782494-15782516 GTTATTAAGAAAATCATAAAGGG + Intergenic
1004485073 6:16058704-16058726 GTTTTTAAGGGAAAGATGGAGGG - Intergenic
1004738197 6:18429500-18429522 GTTTTTTAGGGAAGTATAAAAGG + Intronic
1008189263 6:48434164-48434186 TTTTTTAAGAGAATGTTCAAAGG - Intergenic
1008213149 6:48750734-48750756 GATTTTGAAAGGATTATGAATGG - Intergenic
1008437498 6:51493733-51493755 GTCTTTAAGAAAATTATTGAAGG + Intergenic
1008496679 6:52140836-52140858 ATTTTTAGGAGTTTTATGAAAGG - Intergenic
1008955939 6:57215844-57215866 ATATTTAAGACAATTATAAATGG + Intronic
1009305590 6:62085673-62085695 ATTTTTACCAGAATAATGAAAGG + Intronic
1009475657 6:64088029-64088051 GGTTTTATGAAAATTATGACAGG + Intronic
1009526638 6:64755181-64755203 GTTTTTATAGGTATTATGAATGG - Intronic
1010955154 6:82081869-82081891 GTTTTTAATTGAAATATAAAAGG + Intergenic
1011741826 6:90369256-90369278 GTCTTTAAAAGAATCATGACTGG + Intergenic
1011795964 6:90951735-90951757 GTTTTAAAAATAAATATGAATGG + Intergenic
1012413316 6:98985229-98985251 GGTTTTCTCAGAATTATGAAAGG - Intergenic
1013332370 6:109117383-109117405 GTTTTTAATTGAAGGATGAAAGG + Intronic
1013453483 6:110308319-110308341 ATTTTTAAAAGAATAATCAAGGG - Intronic
1013716242 6:112966832-112966854 CTTTTTGAGACAATTAAGAATGG - Intergenic
1014328270 6:120027291-120027313 ATTTTTAAAAGTATTTTGAAGGG - Intergenic
1014422043 6:121258614-121258636 TTTTAAAAGAGAATGATGAATGG - Intronic
1014507436 6:122276875-122276897 GTTCTTAAGAGTATCATGAACGG - Intergenic
1016469778 6:144363082-144363104 GTTTTTAAAAGATTTTTTAATGG + Intronic
1016976092 6:149809644-149809666 GTTGTTAAGATAAATTTGAAGGG - Intronic
1017348055 6:153407260-153407282 GTTTTTAAGCAAATTATGGGAGG - Intergenic
1017358695 6:153541317-153541339 GTTTTTAAGGGGATCATGGAGGG - Intergenic
1017755737 6:157527404-157527426 TTTTTGAAGAGATTTTTGAATGG - Intronic
1019553194 7:1614167-1614189 GTTTTTAAGGGGATCATGGAGGG - Intergenic
1020316240 7:6907208-6907230 GTTTTTATGAGAATTATGCTAGG - Intergenic
1020486299 7:8725098-8725120 CTTTTTAAAAGAATTCTCAAGGG + Intronic
1020707542 7:11564503-11564525 ATTTGTAAGAGAATTAGGAAGGG - Intronic
1020724316 7:11790920-11790942 GTTCTTTAAAGAATAATGAAGGG - Intronic
1020813583 7:12876037-12876059 TTTTTTTAGAAAATTATGCAAGG + Intergenic
1021063203 7:16140001-16140023 TTTTTTAACAGAAATATTAATGG - Intronic
1021145507 7:17083478-17083500 ATATTTAAGACAATTATAAATGG - Intergenic
1021224743 7:18013923-18013945 GTTTTTAAGGGAATCATGGAGGG + Intergenic
1021339470 7:19446157-19446179 ATTTTTAAGAGACTTAGGCAAGG + Intergenic
1021444102 7:20714228-20714250 TTTGATAAGAAAATTATGAAAGG - Intronic
1021805503 7:24350689-24350711 GTTTTTAAAAGAATTATTTTTGG - Intergenic
1021835900 7:24674441-24674463 GCTTTTAAGACAATTATCAAGGG + Intronic
1022161585 7:27716041-27716063 GATTTCTTGAGAATTATGAATGG + Intergenic
1022167948 7:27790671-27790693 GTTTCCAAGAAAATTATCAAAGG - Intronic
1022335948 7:29422221-29422243 TTTTTTAAAAGAATGATGGAAGG + Intronic
1022841536 7:34168679-34168701 ATATTTAAGATAATTATAAATGG - Intergenic
1023207703 7:37768906-37768928 GTTTTTCAGAGGAGGATGAATGG + Intronic
1023712206 7:43006778-43006800 GTTGTTGAGAGAATTGTGAGAGG - Intergenic
1023727224 7:43156132-43156154 CTTTTTAATAAAATTATAAAAGG + Intronic
1023778216 7:43630899-43630921 ATGTTTAAGACAATTATAAATGG - Intronic
1023780706 7:43652400-43652422 GTTCTTAAAACAATCATGAAAGG + Intronic
1023903639 7:44505315-44505337 ATTTTTAAGTGAGTTATAAATGG - Intergenic
1024403645 7:48952477-48952499 GTTTTTATGAAACTTCTGAAAGG - Intergenic
1024521901 7:50312661-50312683 GTTTTTAACTGTATTTTGAAAGG + Intronic
1026057535 7:66997304-66997326 TTTTTTAAGAGAGATATGCAGGG - Intronic
1026415675 7:70178253-70178275 TATTTTAAGAGAAATATGAATGG + Intronic
1026597852 7:71749399-71749421 GATTTTAAGGGAATCATGAAAGG + Intergenic
1026604821 7:71806812-71806834 GTTTTTAAGGGGATTGTGGAGGG - Intronic
1026720572 7:72827728-72827750 TTTTTTAAGAGAGATATGGAAGG + Intronic
1026936067 7:74256420-74256442 GGTTTTTGGAGAATTATGAAAGG - Intergenic
1029175867 7:98664117-98664139 GTTTTTAAGGGAATCATAAAGGG - Intergenic
1029900544 7:104034763-104034785 GTTTTTAAGGGGATCATGGAAGG - Intergenic
1030406276 7:109118415-109118437 GCTTCTGAGAGAATTATTAAAGG + Intergenic
1030450537 7:109704756-109704778 ATTTTAAAAAGAAATATGAAAGG - Intergenic
1030822654 7:114114005-114114027 GAATTTAAGAGAATTATAATAGG + Intronic
1030917753 7:115337977-115337999 TATTTTAAGAAAATGATGAATGG + Intergenic
1031402377 7:121341363-121341385 GTTGATAAGGTAATTATGAAAGG - Intergenic
1031737010 7:125377836-125377858 GTTTTAAAGAAAACTATAAATGG - Intergenic
1032244298 7:130195357-130195379 GTTTTTTAATCAATTATGAAAGG + Intronic
1032293855 7:130616706-130616728 CTTTTTAAGATAAATTTGAATGG + Intronic
1032579923 7:133095076-133095098 ATTTTCAAGAGAAATAAGAAGGG - Intergenic
1032602337 7:133311211-133311233 TTGTTTAAAAGAATTGTGAAGGG + Intronic
1033631107 7:143158983-143159005 GTTCTTAGGAGAAATATAAATGG - Intergenic
1033951992 7:146796368-146796390 GTTTTTAAGGGGATTGTGGAGGG + Intronic
1035778039 8:2204567-2204589 GTTATTATGAGAATTAAAAAAGG - Intergenic
1036655935 8:10677371-10677393 TTTTTAAAAAGAATAATGAAAGG - Intronic
1037984638 8:23281708-23281730 ATATTTAAGACAATTATAAATGG - Intronic
1038032769 8:23658832-23658854 GTTTTTTAAAAAATCATGAAAGG + Intergenic
1038905782 8:31901167-31901189 GTTTGTAAAAGAACTAGGAATGG + Intronic
1039121141 8:34147749-34147771 GTTTCTAAGAGAAATAGGATAGG - Intergenic
1040768724 8:50947860-50947882 GTTTTTAAGGGAATTTGAAAGGG - Intergenic
1040936911 8:52791003-52791025 GTTTTTAAGGAAATCATGGAGGG + Intergenic
1040985572 8:53290630-53290652 GTTTTTAAGGAGATCATGAAGGG + Intergenic
1041758816 8:61341806-61341828 GCTTTTAAGGGAATTTTGCAAGG + Intronic
1041936763 8:63340612-63340634 GTTTTTAAGGGGATCATGGAGGG + Intergenic
1042363315 8:67907527-67907549 CTTTTTAATGGTATTATGAAAGG - Intergenic
1042866174 8:73358301-73358323 TTTCTTAAGAGAATTAAAAATGG - Intergenic
1043228902 8:77772831-77772853 TTTTTTAAGCGAATTAAGACAGG + Intergenic
1043670310 8:82876510-82876532 GTTTTATAGAGATTTATGATGGG - Intergenic
1044334101 8:90956887-90956909 ATTTCTAATAGAACTATGAAAGG - Exonic
1044363757 8:91319083-91319105 ATATTTAAGAAAATTAAGAATGG - Intronic
1044846107 8:96383486-96383508 GATTTGAAGAGGAATATGAAGGG - Intergenic
1045803960 8:106135041-106135063 GGTTTTAAGAGAATCATGGAGGG + Intergenic
1046052101 8:109036284-109036306 GATTTTAAAATAAATATGAAAGG + Intergenic
1046307047 8:112382493-112382515 GCTTTTAAGAGATTTTTAAATGG - Intronic
1046470138 8:114661912-114661934 GTTTTTAAGGGGATCATGGAGGG - Intergenic
1047143274 8:122166891-122166913 GTTTTAAAGAGAAAGATAAAAGG - Intergenic
1047334145 8:123920004-123920026 TTTTGTAAGAGAAGTATGATGGG - Intronic
1047982752 8:130199888-130199910 ATTGTTATAAGAATTATGAATGG - Intronic
1048079997 8:131116533-131116555 CTTTATAATAGATTTATGAATGG + Intergenic
1048191974 8:132298310-132298332 CTGTTTGAGAGAATTATGATGGG + Intronic
1048672276 8:136736544-136736566 TTTTCTGAGAGAATTATGATAGG + Intergenic
1049864109 8:144922504-144922526 GTTTTTAAGGGGATCATGGAGGG + Intergenic
1050563099 9:6854658-6854680 GGTTTTTAGAAAATTAAGAATGG + Intronic
1051098327 9:13492252-13492274 GTTTTTTAGATAATTATCACAGG - Intergenic
1052295801 9:26895046-26895068 GTTTTTAAGGGAATTTTGGTGGG - Intergenic
1052456927 9:28711470-28711492 GTGGTTAAGAGAATAATGATAGG - Intergenic
1052647850 9:31260537-31260559 GATTTAAAGAGTTTTATGAATGG - Intergenic
1055168192 9:73222429-73222451 GTTTTTGAGAGCATTTTGAGAGG - Intergenic
1055225670 9:73991431-73991453 GTTTTTGTGGCAATTATGAATGG - Intergenic
1055669653 9:78590063-78590085 GTTTCAAAGGGAATTTTGAATGG + Intergenic
1056478383 9:86975643-86975665 TTTTTTAAGACAAAAATGAAAGG - Intergenic
1058153182 9:101484354-101484376 GATTTTTAGAGAATCATAAAAGG + Intronic
1058606163 9:106725887-106725909 TTTTTTAAGAGAATGAAGGAGGG + Intergenic
1058734511 9:107882168-107882190 CTTTTTGAGAGAATTACTAAAGG - Intergenic
1058927485 9:109681650-109681672 GTTTTTCAGAGAAAGCTGAATGG + Intronic
1059895759 9:118862945-118862967 CTTTTTGTGAGAATTGTGAATGG - Intergenic
1060871248 9:127042008-127042030 GTTTCTAAGAAAACTGTGAATGG + Intronic
1203752801 Un_GL000218v1:96248-96270 GTTTTTAACGAAATTATGTAGGG + Intergenic
1203712210 Un_KI270742v1:108794-108816 GTTTTTAACAAAATTACGTAGGG + Intergenic
1203539003 Un_KI270743v1:69393-69415 GTTTTTAACAAAATTACGTAGGG - Intergenic
1203555818 Un_KI270743v1:207123-207145 GTTTTTAACAAAATTATGTAGGG + Intergenic
1185938502 X:4285961-4285983 TTTTATAAGAGAACTATAAAAGG - Intergenic
1186264191 X:7813950-7813972 GTTTTTAAGGGAATTTTGGTGGG + Intergenic
1186499934 X:10043192-10043214 GTATTTTAGAGAATGATCAAAGG + Intronic
1187608026 X:20907488-20907510 GTTTTAAATATAATTATGAATGG + Intergenic
1187608094 X:20908282-20908304 GTTTTAAATATAATTATGCATGG + Intergenic
1187683644 X:21794368-21794390 ATATTTAAGACAATTATAAATGG + Intergenic
1187951474 X:24475091-24475113 GTTTTTAAAAAAATTATGTTAGG + Intronic
1188106200 X:26150191-26150213 ATTTTTAAGTGAATTTAGAAAGG - Intergenic
1188277757 X:28221984-28222006 CTTTTTATGATATTTATGAATGG + Intergenic
1188573235 X:31614908-31614930 TTTATTATCAGAATTATGAAAGG + Intronic
1188796823 X:34477266-34477288 TTTTTTAAGGCAATTGTGAATGG + Intergenic
1189056650 X:37706342-37706364 TTTTTGAAGAGAATAATCAAGGG + Intronic
1189933674 X:46041741-46041763 GTTTTTAAGAGGATCATGGAGGG + Intergenic
1189937249 X:46082376-46082398 GTTTATAAAAAAATTATAAAGGG - Intergenic
1193476908 X:81977394-81977416 GTTTTTAGGAGGTTCATGAAAGG + Intergenic
1193691449 X:84649864-84649886 GTTTTTAATAAATATATGAAAGG - Intergenic
1193790961 X:85814586-85814608 GGTTGGAAGAGCATTATGAAAGG - Intergenic
1193849488 X:86518645-86518667 GATTTTATGACAATTGTGAATGG + Intronic
1194273471 X:91850224-91850246 ATTTTTAAGAGAATTATAATTGG + Intronic
1194719931 X:97327969-97327991 GTTTTTAAGTAAATTAAGAAGGG - Intronic
1194748349 X:97655038-97655060 CTTTTTAAAAGAAATGTGAATGG + Intergenic
1194762714 X:97813656-97813678 GTTTTTCAGGGAATTTTGATGGG - Intergenic
1195390587 X:104358071-104358093 GTTTTTAAGCGGATTGTGGAGGG + Intergenic
1195598992 X:106724942-106724964 ATATTTAAGAAAATAATGAATGG + Intronic
1195924783 X:110014659-110014681 GTTTGTGACAGAAGTATGAAAGG + Intronic
1196364025 X:114903034-114903056 GTTTTAAAGACAGTTAGGAAAGG + Intronic
1197326651 X:125102724-125102746 GTTTCAAAGAGAATTCTTAACGG + Intergenic
1198208618 X:134494317-134494339 GTTTTTAATGAAATTATAAAAGG - Intronic
1198417290 X:136433666-136433688 GGTTTTAGGAGAATAAAGAATGG - Intergenic
1198605472 X:138332503-138332525 GTTTTTAAGGGAATGATGGCAGG - Intergenic
1199619102 X:149683400-149683422 GTTTTTAAGAGGATCATGGAGGG + Intergenic
1200590716 Y:5071640-5071662 ATTTTTAAGAGAATTATAATTGG + Intronic
1200734981 Y:6784477-6784499 GCTTGTAAGACAATAATGAAAGG - Intergenic
1201166442 Y:11213818-11213840 GTTTTTAACGAAATTATGTAGGG + Intergenic
1201457937 Y:14191300-14191322 GTTTGTCAGAGAGTTAGGAATGG + Intergenic
1201621217 Y:15960455-15960477 GTTTTTAAAAGAAGAATAAAAGG + Intergenic