ID: 1126779981

View in Genome Browser
Species Human (GRCh38)
Location 15:52131119-52131141
Sequence TAAAATGCACACACTCAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 560
Summary {0: 1, 1: 0, 2: 3, 3: 35, 4: 521}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126779981_1126779984 7 Left 1126779981 15:52131119-52131141 CCCAGCTGAGTGTGTGCATTTTA 0: 1
1: 0
2: 3
3: 35
4: 521
Right 1126779984 15:52131149-52131171 ACATTGGCCCTCCATAGCCATGG 0: 1
1: 0
2: 1
3: 36
4: 352
1126779981_1126779983 -9 Left 1126779981 15:52131119-52131141 CCCAGCTGAGTGTGTGCATTTTA 0: 1
1: 0
2: 3
3: 35
4: 521
Right 1126779983 15:52131133-52131155 TGCATTTTAAAGCTGTACATTGG 0: 1
1: 0
2: 0
3: 15
4: 211
1126779981_1126779988 22 Left 1126779981 15:52131119-52131141 CCCAGCTGAGTGTGTGCATTTTA 0: 1
1: 0
2: 3
3: 35
4: 521
Right 1126779988 15:52131164-52131186 AGCCATGGATTCCACACTCATGG 0: 1
1: 0
2: 4
3: 32
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126779981 Original CRISPR TAAAATGCACACACTCAGCT GGG (reversed) Intronic
900466127 1:2826345-2826367 TGAAATCCTCAAACTCAGCTCGG - Intergenic
901047709 1:6407907-6407929 TAAAATGCAAAAAATTAGCTGGG + Intergenic
901286303 1:8081775-8081797 TAAAATACACAAAATTAGCTGGG - Intergenic
901383888 1:8893774-8893796 AAAAATGCACACACTTCACTTGG - Intergenic
902430952 1:16362673-16362695 AAAAATGCAAAAACTTAGCTGGG + Intronic
903556546 1:24197739-24197761 TAAAATGCACACACCCCGCCAGG - Intergenic
903876228 1:26475141-26475163 AAAAATGCACACACTTCACTTGG - Exonic
904167420 1:28566596-28566618 TAAAATACAAAAAATCAGCTGGG + Intronic
904222526 1:28984161-28984183 TAAAAACCCCAGACTCAGCTGGG - Intronic
904620523 1:31772508-31772530 TCAGATGCACACACACAGATGGG - Intergenic
905003363 1:34691067-34691089 TAAAATGGACACATTGGGCTGGG + Intergenic
905423155 1:37861873-37861895 TAAAATGCAAAAAATTAGCTGGG + Intronic
905613588 1:39377169-39377191 TAAAATGCAAAAAATTAGCTGGG - Intronic
905679343 1:39856321-39856343 TAAAATGAAAATAATCAGCTGGG + Intronic
905691184 1:39944205-39944227 AAAAATGCAAAAAATCAGCTGGG - Intergenic
905879094 1:41451861-41451883 TAAAATACAAACAATTAGCTGGG + Intergenic
905995110 1:42374922-42374944 TAAAATACAAAAAATCAGCTGGG - Intergenic
907090502 1:51720484-51720506 TAAAATACAAAAAATCAGCTGGG - Intronic
907473116 1:54687232-54687254 AAAAATGCAAACAATTAGCTGGG - Intronic
907484178 1:54765659-54765681 TAAATTGCAAACACTTGGCTGGG - Intergenic
908645584 1:66274466-66274488 TAAAATGCCCATTTTCAGCTGGG - Intronic
909109402 1:71455562-71455584 TAAAATACAAAAAATCAGCTGGG + Intronic
909848088 1:80422977-80422999 TAAAATACAAAAAATCAGCTGGG - Intergenic
910213367 1:84816635-84816657 TAAAATGCAAAAAATTAGCTGGG + Intronic
910711751 1:90189035-90189057 TAAAATGAACAAACTAAGGTCGG - Intergenic
911872466 1:103116551-103116573 TAAAATACAAAAGCTCAGCTGGG + Intergenic
912215563 1:107607245-107607267 TCAAATGATCAGACTCAGCTGGG - Intronic
912539222 1:110399982-110400004 TAAAGAGTACAGACTCAGCTGGG + Intergenic
912564341 1:110575209-110575231 TAGCAAGCACAAACTCAGCTGGG - Intergenic
912896197 1:113592849-113592871 AAAAATGCAAAAACTTAGCTGGG + Intronic
913155817 1:116097110-116097132 TTAAATGCACACACCTATCTTGG + Intergenic
914463216 1:147903797-147903819 TAAATTGAACACACTTAACTTGG - Intergenic
915220575 1:154371337-154371359 TGTAATGCAAACACCCAGCTAGG - Intergenic
915222855 1:154388763-154388785 TAAAATACAAAAACTTAGCTGGG + Intergenic
915286130 1:154853646-154853668 TAAAATGACCACTCTCAGCCGGG + Intronic
915390649 1:155540472-155540494 AAAAAAGCAAGCACTCAGCTGGG + Intronic
917335497 1:173920685-173920707 AAAAATGCAAAAACTTAGCTGGG + Intergenic
917847941 1:179037811-179037833 AACAATTCACTCACTCAGCTAGG - Intronic
919393905 1:197021588-197021610 TAACATGCACCCACTCTTCTTGG + Intergenic
919546917 1:198935165-198935187 CAAGATGCACACACTCAACCAGG - Intergenic
919677899 1:200404628-200404650 TAAAATACAAAAAATCAGCTGGG - Intergenic
921068060 1:211636899-211636921 TAAAATACAAAAAATCAGCTGGG + Intergenic
921287152 1:213619447-213619469 TAAAATCCACACACACCACTGGG + Intergenic
921610556 1:217207627-217207649 TAAAATGCTCAGTCTCAGGTAGG + Intergenic
921651745 1:217687834-217687856 TAAAATACAAAAACTTAGCTCGG - Intronic
922629792 1:227094685-227094707 TCAAATGCACATACTCATCTAGG + Intronic
922952516 1:229570796-229570818 AAAAATGCACACACTTTACTTGG - Intergenic
923991487 1:239442265-239442287 TAAAATACAAAAAATCAGCTGGG - Intronic
924133058 1:240932667-240932689 AAAAATACAAAAACTCAGCTGGG - Intronic
924522241 1:244815354-244815376 TAAAATGCAAAAAATTAGCTGGG + Intergenic
1063413602 10:5855541-5855563 TAAAATGCAGACAATTGGCTGGG + Intergenic
1063856136 10:10256226-10256248 TAAAATGCACACATAAAGCATGG - Intergenic
1065014654 10:21451074-21451096 TAAAATACAAAAAATCAGCTGGG - Intergenic
1065493948 10:26310116-26310138 TAAAATGCACACAAACAGGTAGG - Intergenic
1065606912 10:27427606-27427628 AAAAATGCAAACAATTAGCTGGG + Intergenic
1065921201 10:30394488-30394510 TAAAATACAAAAAATCAGCTGGG - Intergenic
1066449973 10:35520081-35520103 TAAAATGCACACTGGGAGCTGGG + Intronic
1066574859 10:36814302-36814324 AAAAACACACACACTCACCTGGG + Intergenic
1067276530 10:44839942-44839964 TAAAATGCAAAAAATTAGCTGGG - Intergenic
1067997907 10:51296583-51296605 CAAAATCAACAAACTCAGCTAGG - Intronic
1068362081 10:55988981-55989003 TAAAATGAACACACAAATCTAGG + Intergenic
1069693291 10:70368781-70368803 TAAAATACAAAAACTTAGCTAGG - Intronic
1070033940 10:72703577-72703599 TACAATGCACACACATAACTGGG - Intronic
1070621004 10:78011003-78011025 AAAAATGCAAAAACTTAGCTGGG - Intronic
1071370922 10:84950808-84950830 AAAAATGCACCCACTCAGTCTGG - Intergenic
1071758338 10:88571553-88571575 TAAAATGAACACCGTCAGCTAGG + Intronic
1071810803 10:89178786-89178808 TGAAATGTACACATTCATCTTGG + Intergenic
1071834342 10:89404793-89404815 AAAAATGCAAAAACTTAGCTGGG + Intronic
1072599872 10:96915615-96915637 AAAAATGCACACACTTCACTCGG + Intronic
1073056292 10:100705060-100705082 AAAGATACACACACGCAGCTGGG + Intergenic
1073329792 10:102662459-102662481 TAAAATACAAAAACTTAGCTGGG + Intergenic
1073488047 10:103834125-103834147 GAAAATCCACACACTCTGCAAGG + Intronic
1074331195 10:112511402-112511424 TAAAATACAAAAAATCAGCTGGG - Intronic
1074404403 10:113168782-113168804 GAAAATGCACATAAACAGCTTGG - Intergenic
1075385886 10:122055057-122055079 TAAAATGCAAAAATTTAGCTGGG + Intronic
1076892166 10:133290330-133290352 TAAAATACAAAAAATCAGCTGGG + Intronic
1078094561 11:8288843-8288865 TAAAATGCACACTCTTCGCTGGG - Intergenic
1078228211 11:9413038-9413060 TAAAATGCAAAAAATTAGCTGGG - Intronic
1078478113 11:11651549-11651571 AAATGTGCACACACACAGCTAGG + Intergenic
1079294999 11:19225303-19225325 GAAAATGCAGGCACTCAGCAAGG - Exonic
1079379398 11:19924017-19924039 AAAAATCCTCCCACTCAGCTGGG - Intronic
1081620390 11:44615849-44615871 TAATGGGCACACATTCAGCTTGG - Intronic
1081939080 11:46925434-46925456 TGAAAAGCAGACAGTCAGCTAGG + Intergenic
1082036986 11:47652977-47652999 TAAAATGCAAACAATCAGCTGGG - Intergenic
1082868312 11:57919872-57919894 AAAAATGAATACACTCAGTTAGG + Intergenic
1083127645 11:60587619-60587641 TAAAATGCTCCCCCTCAGCCTGG + Intergenic
1083170014 11:60918183-60918205 TAAAAAGCTAACATTCAGCTAGG - Intronic
1084301850 11:68257374-68257396 TAAAATACAAAAACTTAGCTGGG + Intergenic
1084498820 11:69522439-69522461 TAAATTACTCAGACTCAGCTGGG - Intergenic
1085065544 11:73492349-73492371 TAAAATAAACAAACTCAGCCTGG + Intronic
1085074709 11:73580515-73580537 AAAAATGCACACACTTCGCTTGG - Intronic
1085552768 11:77390359-77390381 TAAAATACAAAAAATCAGCTGGG - Intronic
1085553212 11:77394682-77394704 TAAAATGCAAAAAATTAGCTGGG + Intronic
1085618184 11:78017711-78017733 TAAAATGCCCACCCTCGGCCGGG - Intronic
1086133577 11:83424479-83424501 AAAAATGCTCACAGTCAACTTGG + Intergenic
1086893197 11:92282502-92282524 TAAAAAGTACAAAATCAGCTGGG + Intergenic
1088746649 11:112809643-112809665 TTATATTCACACACACAGCTTGG + Intergenic
1089206922 11:116772087-116772109 TAAAAGGCAAACAGTCATCTTGG + Intronic
1089751537 11:120655013-120655035 CAAAATGCACACACCAAACTGGG + Intronic
1090642463 11:128741096-128741118 TAAAATACAGTCACTCAGCCAGG + Intronic
1091539618 12:1447808-1447830 TAAAATACAAAAAATCAGCTGGG - Intronic
1092503509 12:9071113-9071135 TAAAATGCAGATCCTCAGCCGGG - Intronic
1092736267 12:11585809-11585831 TAAAATACAAACACTTAGCCAGG + Intergenic
1092799791 12:12152942-12152964 TTAAAAACCCACACTCAGCTTGG + Intronic
1094539909 12:31354652-31354674 TAAAATGTAAACATTTAGCTGGG + Intergenic
1095170948 12:39035669-39035691 TAAACTGAAGACACACAGCTTGG + Intergenic
1097667718 12:62499710-62499732 TAAAATACAAAAAATCAGCTGGG + Intronic
1097996927 12:65898076-65898098 TAAAATACATACACTTAGCCAGG - Intronic
1098216723 12:68228320-68228342 TAAAATGCAAAAAATTAGCTGGG - Intergenic
1098278421 12:68837245-68837267 CAAAATGTACAAATTCAGCTGGG - Intronic
1100474648 12:94924298-94924320 TAAAATACAAACAATTAGCTGGG - Intronic
1101860638 12:108479686-108479708 CAACGTGCACACAATCAGCTGGG + Intergenic
1101968679 12:109297495-109297517 AAAAATGCAAAGACTGAGCTGGG - Intronic
1102122025 12:110449399-110449421 TAAAATGCAAAAAATTAGCTGGG + Intronic
1103075350 12:117977971-117977993 TAAAAAGCACACATGCAGCCAGG + Intergenic
1103089289 12:118086165-118086187 AAAAAAGCACAAAGTCAGCTGGG + Intronic
1103126970 12:118432099-118432121 TAAAATACATAAAATCAGCTGGG - Intergenic
1103497810 12:121376307-121376329 AAAAATGCAAACATTTAGCTAGG - Intronic
1104510096 12:129369537-129369559 TAAAATGCTCACAGGAAGCTGGG + Intronic
1104689484 12:130814535-130814557 TAAAAGCCCCAAACTCAGCTGGG - Intronic
1105354895 13:19651364-19651386 TAAAATACAAAAACTTAGCTGGG + Intronic
1105901851 13:24762207-24762229 TAAAATACAAAAAATCAGCTGGG + Intergenic
1105980954 13:25515613-25515635 TAAAACACACACACACAACTAGG - Intronic
1106211949 13:27657367-27657389 TAAAATACAAAAAATCAGCTGGG + Intronic
1106729042 13:32519988-32520010 TATGATACACACACACAGCTAGG + Intronic
1107140451 13:36993012-36993034 GAAGATGCACAGCCTCAGCTGGG + Intronic
1108252300 13:48579288-48579310 TAACGTGCAGACACTTAGCTGGG + Intergenic
1109761713 13:66838639-66838661 TAAAATGCAAACATTCACATGGG - Intronic
1109827048 13:67735364-67735386 AAAAAAGCACACACTAGGCTGGG - Intergenic
1111411904 13:87887950-87887972 AAAAATACAAACACTTAGCTGGG - Intergenic
1111640647 13:90965660-90965682 AAAAATGCAAACAATCATCTGGG - Intergenic
1111742885 13:92226757-92226779 AAAAATGCAAAAAATCAGCTGGG - Intronic
1112397520 13:99046678-99046700 TAAAATAAACACACACAGCCTGG + Intronic
1113027309 13:105955310-105955332 TAAAATGCAAAAACTTAGCTAGG + Intergenic
1113382951 13:109820500-109820522 TAAACTGCACCCATCCAGCTGGG + Intergenic
1113650452 13:112030739-112030761 CAAAGTGCACACACACAGCCCGG - Intergenic
1114675025 14:24434563-24434585 TAAAATGCAAAAAGTTAGCTGGG - Intronic
1114732195 14:25004858-25004880 TAACAAGCACACACACAGCCTGG + Intronic
1114915352 14:27257251-27257273 TAAAATGCACAAACTCTATTTGG + Intergenic
1114987103 14:28243992-28244014 TAAAATAGACACAAACAGCTGGG + Intergenic
1117176928 14:53154326-53154348 TAAAATGAAAACACTGAGGTTGG - Intergenic
1117694047 14:58340508-58340530 TAAAATGCAAAAAATTAGCTGGG - Intronic
1117941549 14:60972230-60972252 AAAAATGCACACACTTCACTTGG + Exonic
1118728220 14:68646507-68646529 TAAAAGGCAGACAATAAGCTGGG - Intronic
1119135467 14:72214335-72214357 AAAAATGCAAAAAATCAGCTGGG - Intronic
1119969188 14:78950441-78950463 TAAAATGAACCCATTCATCTTGG - Intronic
1120039727 14:79738852-79738874 TAAAATGAACACATTTGGCTGGG - Intronic
1120132388 14:80822789-80822811 AAAAATGCACACACTTCACTTGG - Intronic
1120830086 14:88990147-88990169 TAACATGAACACACTGAGCATGG + Intergenic
1121821591 14:96972495-96972517 TAAAATACAAACAATTAGCTGGG - Intergenic
1121853843 14:97248350-97248372 TCAAAGGAACAGACTCAGCTAGG - Intergenic
1121904999 14:97731636-97731658 TAAACTTCACACAATCAGGTAGG + Intergenic
1121923941 14:97910846-97910868 TAAATTTCAAAGACTCAGCTTGG + Intergenic
1122519949 14:102336453-102336475 TAAAATACAAAAAATCAGCTGGG - Intronic
1122749278 14:103920807-103920829 TAAAACTGACACACACAGCTAGG - Intronic
1124445832 15:29730978-29731000 AAAAATGCACACACTTCACTTGG - Intronic
1125270567 15:37934476-37934498 TGAAATCCACACACTTATCTAGG + Intronic
1125688884 15:41580590-41580612 GAAAATGCAAATATTCAGCTGGG + Exonic
1125746858 15:42003122-42003144 TAACATTCACCCTCTCAGCTGGG - Intronic
1125764699 15:42126783-42126805 TAAAATACAAAAAATCAGCTGGG - Intergenic
1126154807 15:45555927-45555949 AAAAATGCACACACTTCACTTGG - Intergenic
1126779981 15:52131119-52131141 TAAAATGCACACACTCAGCTGGG - Intronic
1126812778 15:52424957-52424979 TAAAATTCACACTTTCAGTTGGG + Intronic
1128000239 15:64184514-64184536 TAAAATACAAAAAATCAGCTGGG + Intronic
1128267774 15:66281638-66281660 TAAAATACAAAAAATCAGCTGGG - Intergenic
1128365718 15:67000799-67000821 AAAAATGCACACACTTCACTTGG + Intergenic
1128504191 15:68254897-68254919 AAAAATGCACACACTTCACTTGG - Intronic
1130096748 15:80861809-80861831 TACAGTGCACACAACCAGCTGGG + Intronic
1130284711 15:82545411-82545433 TAAAAAGCACCCACTAAGCATGG + Intronic
1130383902 15:83394665-83394687 TAAAATGCAAAAAATTAGCTGGG + Intergenic
1130554060 15:84910431-84910453 TAAAACACACACACTCAGCTGGG + Intronic
1131211777 15:90503819-90503841 AAAAATGCAAAAAATCAGCTGGG + Intergenic
1131616770 15:94024352-94024374 TAAGAAACACACACTCACCTTGG + Intergenic
1132398540 15:101490659-101490681 TTAAAAGCACCCACTGAGCTGGG + Intronic
1133434351 16:5766422-5766444 TAAAATGCAAAAAATTAGCTGGG + Intergenic
1133535706 16:6700495-6700517 TAAAATACAAAAAATCAGCTGGG + Intronic
1133544132 16:6788634-6788656 AAAAATACAAACAATCAGCTGGG - Intronic
1133678415 16:8097521-8097543 TAAAATACAAACAATTAGCTGGG + Intergenic
1134145002 16:11753807-11753829 AAAAATGCAAACAATTAGCTGGG - Intronic
1134221370 16:12357154-12357176 TAAAATGCCCACATTCAGGCAGG + Intronic
1134315809 16:13117884-13117906 TAAAAAGCTCACAGTCAGCCTGG + Intronic
1134906328 16:17982763-17982785 TAAAATACAAAAACTTAGCTGGG - Intergenic
1135080898 16:19434648-19434670 TAAAAGTCACACACTCAACCAGG - Intronic
1135338175 16:21622001-21622023 TAAAATACAAAAACTTAGCTGGG - Intronic
1135391486 16:22097124-22097146 AAAAATACACAAAATCAGCTGGG - Intronic
1135485343 16:22860138-22860160 TAAATTACCCACTCTCAGCTAGG - Intronic
1135858323 16:26032524-26032546 AAAAATGCACACACTTCACTTGG + Intronic
1136379840 16:29888116-29888138 TAAAATTCAAAGCCTCAGCTGGG + Intronic
1136709873 16:32228286-32228308 TAAAATGCAAACAATTAGCCAGG + Intergenic
1136758036 16:32701125-32701147 TAAAATGCAAACAATTAGCCAGG - Intergenic
1136810070 16:33169250-33169272 TAAAATGCAAACAATTAGCCAGG + Intergenic
1136816546 16:33279330-33279352 TAAAATGCAAACAATTAGCCAGG + Intronic
1137062356 16:35802889-35802911 AAAAATGCACACACTTCCCTTGG + Intergenic
1138406239 16:56796681-56796703 TAAAAAGCAAAAACACAGCTGGG + Intronic
1138983690 16:62300943-62300965 TCAAAGGCACAGACTCAGGTGGG - Intergenic
1139970115 16:70769109-70769131 AAAAATGCACATCCACAGCTGGG - Intronic
1140686738 16:77441004-77441026 TAAAATACAAAAAATCAGCTGGG - Intergenic
1140805537 16:78529112-78529134 AAAAATGAACAAACTTAGCTGGG - Intronic
1141888486 16:86910141-86910163 TAATATGCACACACACAGTTTGG + Intergenic
1203060187 16_KI270728v1_random:961474-961496 TAAAATGCAAACAATTAGCCAGG - Intergenic
1143232952 17:5372916-5372938 TAAAATGCAGAAAGTTAGCTGGG - Intronic
1143704785 17:8689158-8689180 AAAAATGCACAAAACCAGCTGGG - Intergenic
1143728053 17:8863693-8863715 TAAAATACACAAAATTAGCTGGG - Intronic
1143846752 17:9778094-9778116 TAAAATGGACAAACTGAGCCGGG + Intronic
1144379770 17:14683025-14683047 TAAAATGCAAAAAATTAGCTGGG + Intergenic
1145258360 17:21340047-21340069 TTAAAAGTACACACCCAGCTGGG - Intergenic
1145318268 17:21747959-21747981 TTAAAAGTACACACCCAGCTGGG + Intergenic
1145354466 17:22128804-22128826 CAAAATGCACAAACAAAGCTAGG + Intergenic
1146207093 17:30914231-30914253 TAAAATGCAAACAATTATCTTGG + Intronic
1146338630 17:31998238-31998260 AAAAATGCAAAAAATCAGCTGGG - Intronic
1147565357 17:41533053-41533075 AAAAATGCAAACAATTAGCTGGG + Intergenic
1147679578 17:42232624-42232646 CAAAATGTAGACACTCAGCCTGG + Intronic
1147753594 17:42753512-42753534 AAAAATGCACACACTTCACTTGG + Intergenic
1147833843 17:43315969-43315991 AAGAACGCACACACTAAGCTAGG - Intergenic
1149828403 17:59850212-59850234 AAAAATGCAAAAACTTAGCTGGG + Intergenic
1149896858 17:60435152-60435174 AAAAATGCACACACTTCACTTGG + Intergenic
1150171847 17:63004694-63004716 AAAAATGCACACACTTCACTTGG + Intergenic
1150288956 17:63970927-63970949 TTAAGAGCACAGACTCAGCTGGG - Intronic
1150767015 17:68010338-68010360 TTAAATGGACAGCCTCAGCTGGG + Intergenic
1151913913 17:77103600-77103622 TAAAATACACAAAATCAGCTGGG - Intronic
1153116993 18:1670368-1670390 TAAAATGGACAGATTCATCTTGG + Intergenic
1153179496 18:2416999-2417021 TAAAATACAAAAAATCAGCTGGG - Intergenic
1153635328 18:7108363-7108385 TAAAATGCTAACTCCCAGCTAGG + Intronic
1155473731 18:26217047-26217069 CAAAATGCATAACCTCAGCTGGG + Intergenic
1156009211 18:32476540-32476562 GAAAATGCACACACTGCACTCGG + Intergenic
1156692984 18:39730699-39730721 TAAATTGCACAAACACAGTTAGG + Intergenic
1157122633 18:44925964-44925986 TAAAATTAAGACCCTCAGCTGGG + Intronic
1158185275 18:54764410-54764432 TAAAATACACACACTCAACATGG - Intronic
1158271578 18:55722048-55722070 GAAAATGCTCAAACTCAGCTGGG - Intergenic
1158664608 18:59421088-59421110 TAAAATACAAAAACTTAGCTGGG + Intergenic
1159386144 18:67727525-67727547 GAAAATACACACACACAGCCGGG + Intergenic
1159612708 18:70544502-70544524 TAAAATGCAAAAACTTAGCCAGG - Intergenic
1161420510 19:4173920-4173942 AAAAATGCAAACAATTAGCTGGG + Intergenic
1161783450 19:6308901-6308923 TAAAAAGGACAAACTCTGCTGGG + Intronic
1161927292 19:7310738-7310760 AAAAATACACACATACAGCTGGG - Intergenic
1162386427 19:10362742-10362764 TAGAGGGCACACACACAGCTAGG + Intronic
1163659048 19:18565846-18565868 TAAAATACAAAAAATCAGCTGGG - Intronic
1163856193 19:19704191-19704213 TAAAATACACAGCCACAGCTAGG + Intergenic
1165022836 19:32937724-32937746 TAAAGTGGACACACGCAGCTAGG + Intronic
1165594198 19:36998196-36998218 TAAAATGCAAAAAATTAGCTGGG + Intronic
1166515211 19:43441374-43441396 TAAAATCCACACTCCAAGCTAGG - Intergenic
1166759168 19:45213647-45213669 TAAAATTCACCTTCTCAGCTGGG + Intronic
1168450130 19:56459829-56459851 TAAAATACAAAAAATCAGCTGGG + Intronic
925706996 2:6695217-6695239 TAAAATGCAAATAATCAGCCGGG + Intergenic
927890910 2:26748329-26748351 TAAAATGCAAAAAATTAGCTGGG + Intergenic
928647345 2:33368555-33368577 TAAAGTGTACACACTTAGCCTGG - Intronic
929410953 2:41696946-41696968 CAAAAAGCTCACATTCAGCTGGG - Intergenic
929773126 2:44909423-44909445 TAAAATGCAAACAATTAGCTGGG + Intergenic
929897858 2:45977190-45977212 TTAAAAACACACAATCAGCTGGG - Intronic
931613989 2:64136740-64136762 TAAAATACAAACATTTAGCTGGG + Intronic
931726718 2:65118636-65118658 TAAAATACAAAAAATCAGCTGGG - Intronic
932318654 2:70803419-70803441 AAAAATGCACACACTTCACTTGG - Intergenic
932531199 2:72535066-72535088 TAAAATGCAAATACTAAACTTGG + Intronic
932705357 2:74020468-74020490 TAAAATGCAAACACCAAGCCTGG - Intronic
933109765 2:78382571-78382593 TAAAATACAAAAACTTAGCTGGG + Intergenic
933289480 2:80421836-80421858 AAAAAGGCTAACACTCAGCTCGG - Intronic
935168534 2:100591038-100591060 AAAAATGCACACACTTCACTTGG + Intergenic
935866301 2:107391338-107391360 AAAAATGCACACATTAACCTAGG - Intergenic
935891121 2:107679588-107679610 TGAAATGCACACTCTGAGCTAGG - Intergenic
936492109 2:112981148-112981170 AAAAATGCACACACTACACTTGG + Intronic
936915615 2:117636611-117636633 TAAATTGCACAGTCTCAGGTAGG + Intergenic
938305839 2:130253482-130253504 TAAAATACAAAAAATCAGCTGGG - Intergenic
938448313 2:131394289-131394311 TAAAATACAAAAAATCAGCTGGG + Intergenic
939508667 2:143079699-143079721 TAAAATGGAAACACTGAGATTGG + Intergenic
939612274 2:144326290-144326312 TAAAATACACAGACTCAGCCAGG + Intronic
939715665 2:145580689-145580711 TAAAATACAAACAATTAGCTGGG - Intergenic
940188680 2:151015072-151015094 TAAAATACAAACAGTGAGCTGGG + Intronic
940625957 2:156175562-156175584 TGAAATGAACAGACTGAGCTAGG + Intergenic
940863859 2:158797494-158797516 AAAAATGAAATCACTCAGCTGGG + Intronic
940975617 2:159940194-159940216 TAAAATGCACACTCTCAGGGAGG + Exonic
941963788 2:171280537-171280559 AAAAATGCAAACAATCAGCCAGG + Intergenic
942265522 2:174220662-174220684 TAAAATGCAAATACTCATCTTGG - Intronic
943587774 2:189760628-189760650 TAAAATGCAAAAAATCAGCTGGG + Intronic
943707270 2:191048623-191048645 AAAAATGCAAACAATTAGCTGGG + Intronic
944417733 2:199495730-199495752 TTAAATGCTAAGACTCAGCTGGG + Intergenic
945802767 2:214453879-214453901 TAAAATGCAAAAAATTAGCTGGG - Intronic
948167474 2:235874209-235874231 TAAAATGCAAAAAATTAGCTGGG - Intronic
948196077 2:236097551-236097573 TAAAATACAAAAACTTAGCTGGG - Intronic
948220953 2:236269478-236269500 TAAGATGCAAACACACAGCCTGG + Intergenic
1168840045 20:904051-904073 TGAAACACACACACACAGCTAGG - Intronic
1168889464 20:1285066-1285088 TAAAATGCATACACTGTGCAGGG + Intronic
1169236179 20:3931686-3931708 TAAAATGCATTCATTCTGCTAGG - Exonic
1169732664 20:8803200-8803222 TAAACTGCAGACACTTATCTAGG + Intronic
1169776209 20:9256370-9256392 TCAAATGCACACTCCCAGCAAGG + Intronic
1170033495 20:11966681-11966703 TAATATGCACACAATCACCTGGG - Intergenic
1170905426 20:20511893-20511915 TAAAACACACACACTCAGCCAGG + Intronic
1170948195 20:20910864-20910886 TAAAATGAAAAGAATCAGCTGGG + Intergenic
1171016194 20:21544158-21544180 GAAAAAGCACTCACTCTGCTGGG - Intergenic
1171106912 20:22442313-22442335 TAAAATACAAAAACTTAGCTGGG + Intergenic
1171221471 20:23401718-23401740 TAAAATACAAACAATTAGCTGGG + Intronic
1172140373 20:32718536-32718558 TAAAATACAAAAAATCAGCTGGG + Intronic
1172735574 20:37124729-37124751 TAAAATGCAGGTTCTCAGCTGGG - Intronic
1173207670 20:41007389-41007411 AAGCATGCACACACCCAGCTGGG + Intergenic
1173221407 20:41135988-41136010 TAAAATCCACACTCCCTGCTTGG - Intergenic
1173244345 20:41325027-41325049 TAAAATACAAAAACTTAGCTGGG + Intergenic
1173502133 20:43561680-43561702 TAAAATCCAAAGCCTCAGCTGGG - Intronic
1174176175 20:48646385-48646407 AAAAATGAAAACAATCAGCTGGG + Intronic
1174337433 20:49873184-49873206 CAAAATCCACACATTTAGCTGGG + Intronic
1174605645 20:51759375-51759397 TAAAATGTACACACACGGCCGGG + Intronic
1174655933 20:52172132-52172154 TCACATGCACACACCCAGGTTGG - Intronic
1174811595 20:53650147-53650169 TAAAAGGCAGATACTAAGCTGGG - Intergenic
1176973337 21:15290386-15290408 TAAAGAGCACACACCCAGCCGGG + Intergenic
1177559529 21:22731535-22731557 TAAAATACAAACAATTAGCTGGG + Intergenic
1178011155 21:28288889-28288911 AAAAATGCAAACGCTTAGCTGGG - Intergenic
1178433429 21:32536367-32536389 TAAAATGCAAAAAATTAGCTGGG - Intergenic
1178947208 21:36958626-36958648 TAAAATACAAACAATTAGCTGGG + Intronic
1179407298 21:41136561-41136583 GAGCATGCACACACCCAGCTGGG - Intergenic
1179777802 21:43678318-43678340 TAAAATGCAAAAAATTAGCTGGG - Intronic
1181781482 22:25196729-25196751 TAAAAAGCTCAAATTCAGCTGGG - Exonic
1181944836 22:26508558-26508580 AAAAAGGCACATTCTCAGCTGGG + Intronic
1182207260 22:28641161-28641183 TAAAATGCAAACAATTAGCCGGG + Intronic
1182253435 22:29020419-29020441 TAAAATACAAAAAATCAGCTGGG - Intronic
1182493715 22:30691997-30692019 TAAAATGCATGTTCTCAGCTGGG + Intergenic
1182925245 22:34116312-34116334 TAAAATGCATGCAATTAGCTGGG - Intergenic
1183491571 22:38119539-38119561 TAAAAAGCACAAACTAGGCTGGG + Intronic
1184025338 22:41851652-41851674 TAAAATACAAAAAATCAGCTGGG - Intronic
1184121993 22:42457644-42457666 TAAAATACAAACAATTAGCTGGG - Intergenic
1184327701 22:43802770-43802792 AAAAATGCACACACTTCACTTGG - Intronic
1184819309 22:46897136-46897158 CAAAATGCACAAACAAAGCTAGG + Intronic
950313982 3:11984172-11984194 GAAAATGCAGATGCTCAGCTAGG - Intergenic
950520065 3:13492837-13492859 TAAAATCCCCACACCCAGCCAGG - Intronic
950640020 3:14342683-14342705 TACAAAACACACATTCAGCTGGG + Intergenic
950779041 3:15375358-15375380 AAAAATGCACACACTTCACTTGG + Intergenic
951006908 3:17628071-17628093 AAAAATACACACACTCCGCCGGG + Intronic
951871459 3:27367103-27367125 AAAAATGAACACACTGGGCTGGG - Intronic
953382822 3:42486928-42486950 TAAAAGTCACAGAGTCAGCTGGG + Intergenic
953956269 3:47234392-47234414 TAAAATACAAAAACTTAGCTGGG - Intronic
954068602 3:48126572-48126594 TAAAATACAAAAAATCAGCTGGG - Intergenic
954069731 3:48134218-48134240 TAAAATGCAAAACATCAGCTGGG - Intergenic
954076320 3:48184054-48184076 TAAAATACACACATTCGGCTGGG + Intronic
954252691 3:49380410-49380432 TAAATTATATACACTCAGCTGGG + Intronic
954661191 3:52227751-52227773 GCACATGGACACACTCAGCTTGG + Intergenic
954768259 3:52941431-52941453 TAAAATGCAAAAAATTAGCTGGG + Intronic
954921916 3:54198636-54198658 TAAAAGGAAGACACTCAGCTTGG + Intronic
955580893 3:60420790-60420812 GCAAATGCAAACACTGAGCTAGG - Intronic
955938100 3:64121965-64121987 TCAAAATCACAGACTCAGCTGGG - Intronic
955967195 3:64400716-64400738 TCAAATGCAAACACTCGGATTGG - Intronic
956403586 3:68905328-68905350 TAAAATACAAAAACTTAGCTAGG - Intronic
956601357 3:71026076-71026098 TAATATGCACACACTCAGTGGGG + Intronic
956677613 3:71750922-71750944 TAAAATGCAAAAAATTAGCTGGG - Intronic
958526710 3:95269907-95269929 TAAGATAGACACTCTCAGCTAGG - Intergenic
958682355 3:97347356-97347378 TAAAATACACAAACTCCACTAGG + Intronic
961214146 3:125146798-125146820 AAAAATGTACAAACTTAGCTGGG - Intronic
961477136 3:127154086-127154108 ACAAATGCATACACACAGCTTGG - Intergenic
961648696 3:128406650-128406672 AAAAATGCAAAAAATCAGCTAGG + Intronic
961690519 3:128666182-128666204 AAAAATGCAAAAAATCAGCTGGG - Intronic
963018907 3:140852698-140852720 TAAAATTTACACAATCAGCATGG + Intergenic
964349340 3:155787510-155787532 TAAAATACAAAAACTTAGCTGGG - Intronic
964714141 3:159704272-159704294 TAAAATGCAAAAACTTAGCTGGG + Intronic
965102832 3:164323782-164323804 GAAAATGCACACACTAATTTAGG + Intergenic
965849750 3:173009774-173009796 GAAAATGCACACACAAAGCAAGG + Intronic
966194771 3:177301962-177301984 TAAAATACAAAAAATCAGCTGGG + Intergenic
966705549 3:182909901-182909923 TAAAATGCAAAAAATTAGCTGGG + Intronic
966811318 3:183847402-183847424 AAAAATGAACAAAATCAGCTGGG + Intronic
967271355 3:187736190-187736212 TCACATGCACACACTAACCTTGG - Intronic
968056466 3:195695705-195695727 TAAAATGCAAAAAATTAGCTGGG + Intergenic
969308969 4:6341043-6341065 TTAAATGAACCCACTCAGGTGGG + Intronic
969879144 4:10158394-10158416 AAACATGAACACAATCAGCTTGG + Intergenic
970432156 4:15999174-15999196 TAAAATTCACACACTTGGCCGGG + Intronic
972091558 4:35292515-35292537 TAAAATGCAAAAAATTAGCTGGG - Intergenic
972445419 4:39138984-39139006 CAAACTGCACACCATCAGCTGGG + Intergenic
972474872 4:39440716-39440738 TAAAATACAAAAAATCAGCTGGG - Intronic
972502993 4:39695506-39695528 TAAAATACAAAAACTTAGCTGGG - Intergenic
973157957 4:46981124-46981146 TAAAGTGAACAGCCTCAGCTAGG - Intronic
973598077 4:52513003-52513025 TAAAATGCAAAAAATTAGCTGGG + Intergenic
973791304 4:54380604-54380626 TAAAATACAAAAACTTAGCTGGG - Intergenic
974627984 4:64448245-64448267 TAAAATACAAAAACTTAGCTGGG + Intergenic
975594220 4:76032500-76032522 AAAAATTCACATAGTCAGCTGGG - Intronic
976353601 4:84088326-84088348 TAAAGTGCACACACCCATCTGGG - Intergenic
976811222 4:89103368-89103390 TAAAATACAAAAAATCAGCTGGG - Intronic
977261220 4:94799462-94799484 TAAAATACAAAAACTTAGCTGGG - Intronic
977705046 4:100061519-100061541 TAAAATACAAACAATCAGCTGGG - Intergenic
978466682 4:109016227-109016249 GATCATGCACACACCCAGCTTGG - Intronic
979233190 4:118369861-118369883 TAAAATACAAAAACTTAGCTGGG + Intergenic
979701176 4:123669495-123669517 TAAAATGCAAAAAATTAGCTGGG + Intergenic
980466041 4:133183689-133183711 TTCATTGCACACACTCTGCTAGG + Intronic
980482199 4:133401420-133401442 TAAAATCCAGAAACTCAGCAAGG + Intergenic
981203737 4:142014963-142014985 TAAAATGTAAAAAATCAGCTGGG + Intergenic
982873038 4:160608062-160608084 TAAAATCCAGACTCTCAGATGGG + Intergenic
983210653 4:164954444-164954466 TAAAATGCACAAACTCCCCAAGG - Exonic
983526883 4:168768831-168768853 TAAAATGCAAAAAATTAGCTGGG - Intronic
984071143 4:175114523-175114545 TAAAAAACACACACATAGCTGGG + Intergenic
984077823 4:175205555-175205577 AAAAATACACAGACTCTGCTGGG + Intergenic
984668591 4:182455720-182455742 TAAAATACACAAAATTAGCTGGG - Intronic
984763790 4:183384271-183384293 TAAAAACCCCAGACTCAGCTAGG + Intergenic
984778041 4:183501105-183501127 AAAAATGCAAAAAATCAGCTGGG - Intergenic
985080948 4:186263298-186263320 TAAAATGTACAAAATCAGCTTGG + Intergenic
985178530 4:187229840-187229862 TCAGGTGCACACACTAAGCTTGG + Intergenic
985310543 4:188593077-188593099 TGAAATGGAAACACTCAACTCGG - Intergenic
986210441 5:5666674-5666696 GAAAATGCAGAAACTCTGCTTGG + Intergenic
986282828 5:6337533-6337555 TAAAATGCACATAATAGGCTGGG + Intergenic
986962532 5:13232695-13232717 TACAATAAACACACTCAGCAAGG - Intergenic
988193207 5:27965195-27965217 TAAAATGCACACATTAACATTGG - Intergenic
990535888 5:56721928-56721950 TAAAATGCAAACAATTAGCTGGG - Intergenic
991181585 5:63757665-63757687 TAAAATACACAAAATTAGCTGGG - Intergenic
991413875 5:66371463-66371485 CAAAATATACACACACAGCTAGG - Intergenic
992040131 5:72822751-72822773 TAAAATACAAAAAATCAGCTGGG - Intronic
992233875 5:74688493-74688515 AAAAATACAAACAATCAGCTGGG - Intronic
992381480 5:76242009-76242031 AAAAATGCACACACTTCACTTGG + Intronic
993234475 5:85286079-85286101 TAAAATGCACACATGCGGCTGGG + Intergenic
994692442 5:103034959-103034981 TAGCATGCACACACCCAGCCAGG + Intergenic
995819865 5:116218008-116218030 AAAAATGCACACACTTCTCTTGG + Intronic
996270528 5:121598834-121598856 AAAAATGCAAACACTAAGTTGGG + Intergenic
996720846 5:126628596-126628618 TAAAATACAAAAAATCAGCTGGG + Intergenic
997494504 5:134310644-134310666 GAAAATGCAAAAACTTAGCTGGG - Intronic
997519992 5:134516947-134516969 TAAAATGCAGACTCTTGGCTGGG + Intergenic
998452120 5:142242838-142242860 TAAAATACAAAAAATCAGCTGGG - Intergenic
998568847 5:143239353-143239375 TAAAACACACACACACAGCAAGG + Intergenic
999021880 5:148174882-148174904 TGAAATGCACTCACTCATATAGG - Intronic
999212633 5:149903555-149903577 TAGAATCCACCCACTCTGCTGGG - Intronic
1001224246 5:169930149-169930171 TAAAATGCAAAAAATTAGCTGGG - Intronic
1001783838 5:174394364-174394386 TAAATTGAACAAACTCAGCCTGG + Intergenic
1001874848 5:175191024-175191046 TAAAATGCACATAATCATATGGG - Intergenic
1002022911 5:176376199-176376221 TAAAATACAAAAAATCAGCTGGG + Exonic
1002998527 6:2309602-2309624 AAAAATACAAAAACTCAGCTTGG - Intergenic
1003281083 6:4692223-4692245 TAAAATGCACACACATGGCCAGG + Intergenic
1005791739 6:29309818-29309840 AAAAATACAAACACTTAGCTGGG + Intergenic
1006483745 6:34320536-34320558 TAAAATGTTCACACTAGGCTGGG + Intronic
1006644648 6:35507723-35507745 TCAAATGCACACACCCAGGCTGG - Intronic
1006770903 6:36551734-36551756 TAAAATACACACACACGGCCGGG - Intergenic
1007042471 6:38735975-38735997 TAAAATACAAAAAATCAGCTGGG + Intronic
1008101327 6:47394337-47394359 TAAAATACACAAAATTAGCTGGG - Intergenic
1008352456 6:50507978-50508000 TAAAATACAGAAAATCAGCTGGG - Intergenic
1008372917 6:50756157-50756179 TAAAAGGGACACACTCGGCCTGG - Intronic
1009578563 6:65500155-65500177 ACAAATGCACACACCCAGTTAGG + Intronic
1011152183 6:84286516-84286538 AAAAATGCAAAAACTTAGCTAGG + Intergenic
1011212825 6:84972474-84972496 TAAAATTTAAAAACTCAGCTGGG - Intergenic
1012522997 6:100143275-100143297 TAGAATTCAAAAACTCAGCTTGG + Intergenic
1012662792 6:101923758-101923780 TAAAATGCAAAAAATTAGCTGGG + Intronic
1012913706 6:105145532-105145554 TAAAAAACACACACACGGCTGGG + Intergenic
1013094422 6:106931759-106931781 AAAAATCCACACACTTCGCTTGG + Intergenic
1013730870 6:113165461-113165483 TAAAAAGCACACAGTAGGCTGGG + Intergenic
1014434740 6:121408808-121408830 AAAAATGCACACACTTCACTTGG - Intergenic
1014728882 6:125007540-125007562 TAAAATGCTCAAAGTCAGCCAGG - Intronic
1016025112 6:139278841-139278863 TAAAATACAAAAACTTAGCTAGG + Intronic
1016034352 6:139371036-139371058 TAAAATGCACACACTCCACTGGG - Intergenic
1016044616 6:139468019-139468041 AAAAATGCAGACTCTCAGCTGGG - Intergenic
1016048527 6:139505498-139505520 TAAAATGCAAACAATAGGCTGGG - Intergenic
1016122119 6:140356991-140357013 TAAAATGGAAACAATCACCTTGG + Intergenic
1016320002 6:142832030-142832052 AAAAATGCAAAAAATCAGCTGGG + Intronic
1016896625 6:149060038-149060060 TCTAATGCACACACTTTGCTTGG - Intronic
1018409733 6:163531799-163531821 TAAAATGTACAAACTCAGCCGGG - Intronic
1018969986 6:168520776-168520798 TAACATAAACACACTAAGCTAGG - Intronic
1020064317 7:5175790-5175812 TAAAATACACACACCCGGCCGGG + Intergenic
1020152149 7:5690875-5690897 TAAAATGTACACATTCATCATGG + Intronic
1021029246 7:15709462-15709484 TAAAATGCACACACACTGCCTGG + Intergenic
1021675224 7:23073765-23073787 TAAAATACAAAAACTTAGCTGGG + Intergenic
1021859494 7:24892296-24892318 TAAAATGCACACATTTACTTGGG - Intronic
1022067061 7:26869462-26869484 TAAAATACAAAAACTTAGCTGGG + Intronic
1022216200 7:28264207-28264229 TAAAACGCACAAACACAGCAAGG - Intergenic
1024154183 7:46603424-46603446 AGAAATGCACATTCTCAGCTGGG - Intergenic
1024306058 7:47930520-47930542 TAAAATACACACAGTCGGCCGGG + Intronic
1024525076 7:50341300-50341322 AAAAATGCAAAAAATCAGCTGGG - Intronic
1024978587 7:55136505-55136527 TGAAATGCACACACACATGTTGG - Intronic
1025159490 7:56642229-56642251 TAAAATACAAAAAATCAGCTGGG - Intergenic
1025228593 7:57183660-57183682 TAAAATGCAAAAACTTAGCCGGG - Intergenic
1026304015 7:69124478-69124500 TAAAATGCAAAAACTTAGCCAGG - Intergenic
1026369114 7:69680963-69680985 TAAAATACTCAAATTCAGCTGGG - Intronic
1026489704 7:70852138-70852160 AAAAATGCTCACAATCATCTGGG + Intergenic
1026535442 7:71235088-71235110 TAAAATACAAAAAATCAGCTGGG + Intronic
1026679797 7:72457167-72457189 AAAAATGCAAAAAATCAGCTGGG - Intergenic
1026796713 7:73370526-73370548 AAAATTGCTCACTCTCAGCTGGG - Intergenic
1026910360 7:74088247-74088269 TGAAATGAACACACTCAGTGTGG + Intronic
1026936717 7:74260893-74260915 TAAAATGCAAAAAATCACCTGGG + Intergenic
1027955746 7:84876914-84876936 AAAAAGGCACACACTCCACTTGG - Intergenic
1028197514 7:87924350-87924372 TAAAATACAAAAACTTAGCTGGG + Intergenic
1029337321 7:99913371-99913393 TAAAAATCACTCTCTCAGCTAGG + Intronic
1029638021 7:101798301-101798323 TAAAATGCAAAAAATCAGCCAGG + Intergenic
1030159371 7:106491682-106491704 TGAAGTGCAGACACTGAGCTAGG + Intergenic
1030882297 7:114895294-114895316 TAAAATGCAAAAACTTAGCTGGG - Intergenic
1031259607 7:119501721-119501743 TAAAATCCACACATACAGCCAGG + Intergenic
1031453977 7:121957046-121957068 AAAAATGCGCACACTTCGCTTGG + Intronic
1031659063 7:124397969-124397991 AAAAATGCAAACAATTAGCTGGG + Intergenic
1032221220 7:129995695-129995717 GAAAATGAACACATTCAGCCAGG + Intergenic
1032353167 7:131184840-131184862 AAAGATGCACACACCCAGCCAGG + Intronic
1032826999 7:135580621-135580643 TAAAATACAAAAACTTAGCTGGG - Intronic
1032984882 7:137326903-137326925 TGCAATGCACACAATGAGCTGGG - Intronic
1033335309 7:140447275-140447297 TAAAATATACAAAATCAGCTGGG - Intergenic
1033474504 7:141678120-141678142 TAAAATACAAAAACTTAGCTGGG - Intronic
1034639201 7:152589223-152589245 TAAAATACAAAAAATCAGCTGGG - Intergenic
1035134200 7:156684658-156684680 TAAAATGCACACACACAGGCTGG + Intronic
1036399772 8:8397710-8397732 TAAAATACACAAAATTAGCTGGG - Intergenic
1036943434 8:13072443-13072465 TAAAATACAAACAATTAGCTGGG - Intergenic
1037096680 8:14994421-14994443 TAAAATACAAACAATTAGCTGGG + Intronic
1037358857 8:18052500-18052522 TAAAATACAAAAAATCAGCTTGG - Intergenic
1037662038 8:20936236-20936258 TAAAATGCTCAAGCACAGCTGGG + Intergenic
1038255992 8:25951617-25951639 GAGAATACACACACTTAGCTAGG + Intronic
1038460141 8:27709407-27709429 TAGACTCCACACACTCACCTGGG + Intergenic
1039215072 8:35260622-35260644 TAAAATACAAACAATTAGCTCGG - Intronic
1039555700 8:38473252-38473274 GAAAATCCACAAACTCATCTGGG + Intergenic
1039619787 8:38986011-38986033 TAAAATAAACAAAATCAGCTGGG + Intronic
1040747223 8:50659998-50660020 TAAAATGCAAAAAGTTAGCTGGG - Intronic
1040788944 8:51202060-51202082 TAAAATACAAAAACTTAGCTGGG - Intergenic
1040873647 8:52127337-52127359 TGAAAAGCACAAACTCAACTTGG + Intronic
1042807964 8:72792319-72792341 TAAAAAGTAAACACACAGCTTGG - Intronic
1042902364 8:73742235-73742257 TAAAATCCACCTCCTCAGCTGGG + Intronic
1043923133 8:86006554-86006576 TAAAAAACACAAACTGAGCTGGG + Intronic
1044237016 8:89842703-89842725 TAAAATGCACACACTGGACAAGG + Intergenic
1044586714 8:93875299-93875321 TAAACTGCACAAAGTTAGCTTGG + Intronic
1044730401 8:95224446-95224468 GAAACAGAACACACTCAGCTGGG + Intergenic
1046520227 8:115316002-115316024 TAAAAAGCAAACACTAAGATTGG + Intergenic
1046935873 8:119884934-119884956 TAAAATACAAACAATTAGCTGGG - Intronic
1046998632 8:120551563-120551585 AAAAATGCAAAAAATCAGCTGGG + Intronic
1047435270 8:124830751-124830773 TAAAATGCACACACTTGGCCAGG - Intergenic
1049739296 8:144228622-144228644 TAAAATACAAACAATTAGCTGGG - Intronic
1050406282 9:5311709-5311731 AAAAATGCACACACTTCACTTGG - Intergenic
1050579381 9:7035171-7035193 AAAAATACAAAAACTCAGCTGGG - Intronic
1050783364 9:9368073-9368095 TAAAATGTACACACTGAAATGGG - Intronic
1050937253 9:11413908-11413930 TAAAAACCCCAGACTCAGCTAGG + Intergenic
1051443439 9:17113490-17113512 TTAAATAAAAACACTCAGCTTGG - Intergenic
1052389048 9:27856669-27856691 TAAGATGATCACACTGAGCTTGG - Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053085893 9:35221227-35221249 AAAAATACACAAAATCAGCTGGG - Intronic
1053301339 9:36952398-36952420 TAAAATGCAAAAAATTAGCTAGG - Intronic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1053544006 9:39003910-39003932 TAAAGTCCAAAGACTCAGCTAGG + Intergenic
1053808440 9:41827407-41827429 TAAAGTCCAAAGACTCAGCTAGG + Intergenic
1054622152 9:67360021-67360043 TAAAGTCCAAAGACTCAGCTAGG - Intergenic
1054830548 9:69620301-69620323 TATAAGGTACACACTAAGCTAGG + Intronic
1055552536 9:77444847-77444869 TAAATGTCCCACACTCAGCTGGG + Intronic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1056914596 9:90735020-90735042 TAAAATACAAAAAATCAGCTGGG + Intergenic
1057117869 9:92542675-92542697 TAAAATACACAAAATTAGCTGGG - Intronic
1057118656 9:92550233-92550255 TAAAATACACAAAATTAGCTGGG + Intronic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1057776262 9:98012889-98012911 AAAAATGCAAACAATTAGCTGGG - Intronic
1058207360 9:102125366-102125388 TAAAATGCAAAAAATTAGCTGGG + Intergenic
1059058635 9:111011952-111011974 AAAAATGCAGAGTCTCAGCTAGG + Intronic
1059139393 9:111837850-111837872 TTAAAGGCAGAAACTCAGCTGGG - Intergenic
1059175902 9:112169968-112169990 GAAAAAGGATACACTCAGCTTGG - Intronic
1059334810 9:113562314-113562336 AAAAATGCAAAAAATCAGCTGGG + Intronic
1060645738 9:125278223-125278245 TAAAATGCTCACATTAGGCTGGG + Intronic
1060691222 9:125662520-125662542 TAAAATACACAAAATTAGCTGGG + Intronic
1061134981 9:128728653-128728675 TAAAATCCACACACTCACGGTGG + Intergenic
1061749283 9:132765130-132765152 TAAAATGCAAAAAATTAGCTGGG + Intronic
1061832579 9:133304920-133304942 TAAAACACACAGACTCAGGTGGG + Intergenic
1185651230 X:1649434-1649456 TAAAAAGCACAAAATTAGCTGGG + Intergenic
1185757932 X:2666933-2666955 TAAAATGCAAAAAATTAGCTGGG - Intergenic
1186182174 X:6984002-6984024 CAAAATGCACACACAAAGCAAGG - Intergenic
1187200913 X:17133012-17133034 AAAAATGCACACACTTCCCTTGG + Intronic
1187520117 X:20005666-20005688 TAAATTTCAAAAACTCAGCTGGG - Intergenic
1188413746 X:29906172-29906194 TAAAATACAAACAATCAGCCGGG + Intronic
1188853570 X:35162920-35162942 TAAAAGTCACACACTGAGTTTGG + Intergenic
1189977744 X:46479266-46479288 AAAAATACACAAAATCAGCTGGG + Intronic
1190405623 X:50084540-50084562 AAAAATTCACAAAATCAGCTGGG - Intronic
1192419837 X:71019902-71019924 GAAAATGAACAGCCTCAGCTGGG - Intergenic
1196202123 X:112898331-112898353 AAAAATGCAAACAATTAGCTGGG + Intergenic
1197143821 X:123148186-123148208 TAAAATACACAAAATTAGCTGGG + Intergenic
1197213790 X:123849442-123849464 TAAAATACACAAAATTAGCTGGG + Intergenic
1197243627 X:124146147-124146169 TAAAATGCACAAACAGAGCAAGG + Intronic
1197342135 X:125287314-125287336 AAGTGTGCACACACTCAGCTGGG - Intergenic
1198535321 X:137580116-137580138 AAAAATGCAAAAACTTAGCTGGG + Intergenic
1199125687 X:144117006-144117028 AAAAATGCAAAAACTTAGCTGGG - Intergenic
1199438951 X:147846393-147846415 TAAAATGCAGACTTTCATCTTGG + Intergenic
1200900125 Y:8423027-8423049 TGAAATACACACAATTAGCTGGG - Intergenic
1201330920 Y:12819972-12819994 AAAAATGCAAAAACTTAGCTGGG + Intronic
1201502068 Y:14655849-14655871 TCAAAAGCCCACCCTCAGCTGGG + Intronic
1201593228 Y:15637868-15637890 AAGCATGCACACACACAGCTGGG + Intergenic
1202044513 Y:20725110-20725132 TAAAATGCACAAACGAAGCAAGG + Intergenic