ID: 1126780219

View in Genome Browser
Species Human (GRCh38)
Location 15:52133415-52133437
Sequence GCGCTCCGGCCAGTGCGTGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 74}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126780219_1126780221 -7 Left 1126780219 15:52133415-52133437 CCTGCACGCACTGGCCGGAGCGC 0: 1
1: 0
2: 0
3: 3
4: 74
Right 1126780221 15:52133431-52133453 GGAGCGCATGTCCCACACCATGG 0: 1
1: 0
2: 0
3: 12
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126780219 Original CRISPR GCGCTCCGGCCAGTGCGTGC AGG (reversed) Exonic
900477099 1:2881150-2881172 AGGCTCCGGCCAGCGTGTGCGGG + Intergenic
900677929 1:3900215-3900237 GCGCCCCGGCCAACGCGTCCCGG + Exonic
903153320 1:21428340-21428362 GCGCGCCAGCAAGTTCGTGCTGG + Intergenic
912499874 1:110114683-110114705 TGGCTGCAGCCAGTGCGTGCTGG - Intergenic
916738766 1:167630369-167630391 GAGCTCCGGCCCGGGCGAGCGGG + Exonic
917797642 1:178543118-178543140 GAGCGCCGCCCAGTGCCTGCAGG - Intronic
918388607 1:184036432-184036454 GCGCTCCGGGCTGTCCCTGCCGG - Intronic
922851330 1:228735883-228735905 GCGCGGCGTCAAGTGCGTGCTGG + Exonic
1069717856 10:70532388-70532410 GGGCTCTGCCCAGTGGGTGCAGG - Intronic
1070813309 10:79309147-79309169 GCGCTCTGGCCAGTCTCTGCGGG - Intronic
1075940660 10:126388082-126388104 GAGCACCGGCCAGGGCGAGCAGG + Exonic
1078485356 11:11717299-11717321 GCGTGCCGGACAGTGGGTGCAGG - Intergenic
1080461614 11:32459603-32459625 GCCCTCTGTCCAGTGTGTGCAGG - Intergenic
1083878826 11:65538389-65538411 GCTCTCCAGCCAGTGCCTGCCGG - Intronic
1085201438 11:74704575-74704597 GCGCTGAGGCCAGTGGGGGCTGG + Exonic
1090398307 11:126433410-126433432 GCCCTCCGGCCAGAGGGAGCTGG + Intronic
1091367861 11:135037312-135037334 GGGCTCTGGCCTGTGCCTGCAGG + Intergenic
1093381531 12:18500168-18500190 GGGCTGCGCCCAGTGCTTGCCGG + Intronic
1099538110 12:83871099-83871121 GCGCGCAGGACAGTGGGTGCAGG + Intergenic
1103936299 12:124479050-124479072 GCGCTCTGGCCTGTGGGTTCTGG - Intronic
1104602488 12:130162807-130162829 GCGCTCGGGCCAGGCCGGGCGGG + Exonic
1112344098 13:98576533-98576555 GGTCTCCGGCGTGTGCGTGCAGG - Intronic
1115910946 14:38255823-38255845 GCGCTCAGCACCGTGCGTGCGGG - Exonic
1116018197 14:39431860-39431882 GCACTCACGCCAGTGCGAGCAGG + Exonic
1117131856 14:52695288-52695310 GCTCACCCGCCAGGGCGTGCGGG + Intronic
1123933104 15:25181354-25181376 GAGCTCTGGCCAGTGCCTGGTGG + Intergenic
1123934254 15:25186536-25186558 TAGCTCCGGCCAGTGCCTGATGG + Intergenic
1123935535 15:25192292-25192314 GAGCTCTGGCCAGTGCCTGGTGG + Intergenic
1126780219 15:52133415-52133437 GCGCTCCGGCCAGTGCGTGCAGG - Exonic
1127300722 15:57651052-57651074 TGGCTCTGGCCAGTGGGTGCTGG + Intronic
1129188981 15:73926828-73926850 GGGCGCCTGCCTGTGCGTGCTGG + Exonic
1133030965 16:3010964-3010986 GCCCACTGGCCAGTGCGGGCAGG - Intergenic
1145225815 17:21127185-21127207 TGGCTCCGGCGAGTGCGTGGCGG + Intronic
1145249091 17:21287668-21287690 GCGCTGGGGCCAGTGGGTGGGGG + Intronic
1146256038 17:31391990-31392012 GCGCTTCGGCCAGGGCGAGGAGG + Exonic
1147896622 17:43755650-43755672 GTGCTCCGGCCAGTGCGGCCCGG - Exonic
1149616768 17:58007321-58007343 GCGCTCCCGCGCGTGCGTGTTGG - Exonic
1152708941 17:81860596-81860618 GCGCCGCGGCCAGCGCGCGCGGG - Exonic
1152735638 17:81995657-81995679 TCGCTCCGGGCAGTGGGTCCTGG + Intronic
1153331391 18:3879111-3879133 ACGCTCCTGCCAGTACCTGCAGG - Exonic
1154412454 18:14148754-14148776 GCGCTCCGGCAGGTGCATCCTGG + Intergenic
1157464094 18:47930210-47930232 GTGCGCCGGCCCGGGCGTGCGGG - Intronic
1160824503 19:1073429-1073451 GGGCTCCGGTCAGTTCTTGCAGG + Intronic
1162453570 19:10769032-10769054 GGGCTCCTGCCTGTGTGTGCTGG + Intronic
1165129487 19:33622830-33622852 GGGCACCGGCCTGTGAGTGCTGG + Intronic
1168013628 19:53554450-53554472 GCGCTCCGGCCGCTGGGTGCGGG + Intronic
929501153 2:42493034-42493056 GCGCTCCAGCCAGCGCCTGGAGG + Exonic
938073060 2:128318503-128318525 GCGCGCCAGCAAGTTCGTGCTGG - Exonic
938256219 2:129861839-129861861 GGGCTCCCGCCAGTGGCTGCAGG - Intergenic
938343410 2:130549845-130549867 GCGCTCAGGCCAGGGCCGGCGGG - Exonic
938346423 2:130570877-130570899 GCGCTCAGGCCAGGGCCGGCGGG + Exonic
949036061 2:241816247-241816269 GCGCTCAGGCGAGTGCCAGCTGG + Exonic
1170642416 20:18166253-18166275 CCGCTCCAGCCAGTGGATGCAGG - Intronic
1170674533 20:18467050-18467072 GCGCCCCGCCCACTGGGTGCTGG + Exonic
1171121503 20:22572661-22572683 GGGCTGGGGCCAGGGCGTGCTGG + Intergenic
1173663576 20:44750591-44750613 GCGCTCGGGCCAGTCGGCGCTGG - Exonic
1174445003 20:50584921-50584943 GCGCTCCAGCCTGAGGGTGCTGG - Intergenic
1177281487 21:18987666-18987688 GCGCGCAGGCGAGTGGGTGCAGG - Intergenic
1178708201 21:34890795-34890817 GCGCTGCGGCCCCTGCGGGCGGG - Intronic
1182296899 22:29315325-29315347 GCGCACCGGGCAGGGCGCGCGGG - Exonic
950950392 3:16992587-16992609 GAGCACAGGCCAGTGCCTGCAGG + Intronic
950950648 3:16994988-16995010 GAGCACAGGCCAGTGCCTGCAGG + Intronic
953674100 3:44986435-44986457 GGGCTGCGGGCAGTGCTTGCGGG - Intronic
962382980 3:134911907-134911929 GAGCTGCTGCCAGTGCATGCAGG + Intronic
968654991 4:1774602-1774624 GCGCTCAGGCCAGTGTCTGTAGG - Intergenic
987050524 5:14143955-14143977 GAGCTCCGGCCACCGCGCGCTGG + Intronic
996101464 5:119449715-119449737 GAGCTGGGGCCAGTGCATGCAGG + Intergenic
1002314894 5:178337216-178337238 GCGCTCCAGCAAGTGCACGCAGG - Intronic
1007464794 6:42044178-42044200 AGGCTCCGGCCAGAACGTGCAGG - Intronic
1019430500 7:996846-996868 GCGTTCCTGGCAGTGGGTGCTGG - Intergenic
1019786130 7:2978650-2978672 GCGGTCCGGCCAGGGGGTGGGGG + Intronic
1020136928 7:5592821-5592843 GCGCTGCGGAGGGTGCGTGCGGG + Exonic
1033461532 7:141551298-141551320 GCGCGCGGGCCAGTTCGGGCCGG - Exonic
1035113579 7:156504911-156504933 GAGCTTCAGGCAGTGCGTGCAGG + Intergenic
1035334393 7:158116523-158116545 TGGCTCCTGCCAGTGTGTGCAGG - Intronic
1044591325 8:93916889-93916911 GCACTCCGGCCCGAACGTGCGGG + Intronic
1056369632 9:85941227-85941249 GTGGTCCGGACAGTGCGTGGCGG + Exonic
1185773984 X:2787493-2787515 GTGCTCCGGGCAGTGCCTTCTGG + Intronic