ID: 1126780294

View in Genome Browser
Species Human (GRCh38)
Location 15:52133906-52133928
Sequence GGACTCTCGGCTGCTCCATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 80}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126780294_1126780305 28 Left 1126780294 15:52133906-52133928 CCAAATGGAGCAGCCGAGAGTCC 0: 1
1: 0
2: 0
3: 4
4: 80
Right 1126780305 15:52133957-52133979 CTCAGCAAAGCTGGAGAGCCAGG 0: 1
1: 0
2: 3
3: 24
4: 328
1126780294_1126780298 -2 Left 1126780294 15:52133906-52133928 CCAAATGGAGCAGCCGAGAGTCC 0: 1
1: 0
2: 0
3: 4
4: 80
Right 1126780298 15:52133927-52133949 CCCAGCTTTGTTTTGGTGTATGG 0: 1
1: 0
2: 0
3: 12
4: 150
1126780294_1126780301 0 Left 1126780294 15:52133906-52133928 CCAAATGGAGCAGCCGAGAGTCC 0: 1
1: 0
2: 0
3: 4
4: 80
Right 1126780301 15:52133929-52133951 CAGCTTTGTTTTGGTGTATGGGG 0: 1
1: 0
2: 0
3: 27
4: 251
1126780294_1126780300 -1 Left 1126780294 15:52133906-52133928 CCAAATGGAGCAGCCGAGAGTCC 0: 1
1: 0
2: 0
3: 4
4: 80
Right 1126780300 15:52133928-52133950 CCAGCTTTGTTTTGGTGTATGGG 0: 1
1: 0
2: 3
3: 24
4: 189
1126780294_1126780296 -9 Left 1126780294 15:52133906-52133928 CCAAATGGAGCAGCCGAGAGTCC 0: 1
1: 0
2: 0
3: 4
4: 80
Right 1126780296 15:52133920-52133942 CGAGAGTCCCAGCTTTGTTTTGG 0: 1
1: 0
2: 1
3: 2
4: 75
1126780294_1126780302 19 Left 1126780294 15:52133906-52133928 CCAAATGGAGCAGCCGAGAGTCC 0: 1
1: 0
2: 0
3: 4
4: 80
Right 1126780302 15:52133948-52133970 GGGGCAGCCCTCAGCAAAGCTGG 0: 1
1: 0
2: 1
3: 24
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126780294 Original CRISPR GGACTCTCGGCTGCTCCATT TGG (reversed) Intronic
900421078 1:2556222-2556244 GGACCCTCGGCTGCTCCCCGGGG - Intronic
913174622 1:116262659-116262681 GGAGTCTAGGCTTCTCAATTGGG - Intergenic
922762313 1:228140673-228140695 GGACTCCCAGCTGCTCTCTTTGG - Intronic
924453998 1:244203484-244203506 GCCCTCTCGGCTGCTGCATGTGG - Intergenic
1069018952 10:63465164-63465186 GGACTCGCGGCTCCGCCTTTCGG + Intronic
1069889801 10:71645750-71645772 GGAGCCTCTGCTCCTCCATTTGG + Intronic
1072151564 10:92689274-92689296 GGACTCTTGGCCGCTCCACCTGG - Intergenic
1075446131 10:122514420-122514442 GGACTCTGGGCTGCTGGAATAGG + Exonic
1080072599 11:28108033-28108055 GGACTCTGGGACGCTCCTTTTGG - Intronic
1088741147 11:112768315-112768337 GGACTCTTGCATGCTCCTTTGGG - Intergenic
1089129233 11:116199220-116199242 AGACTCCCGGCATCTCCATTGGG - Intergenic
1094497241 12:30996008-30996030 GGAATCTCGGCTGCTGCAGGTGG - Exonic
1095825506 12:46526395-46526417 GGCCTCTCAGCTGTTGCATTTGG - Intergenic
1100360183 12:93870597-93870619 GTACTCTTGGCTGCTGCAGTTGG - Intronic
1101585241 12:106080121-106080143 TGACTCTCAGCTGCCCCACTTGG + Intronic
1104616109 12:130270620-130270642 GCATTCTCAGCTACTCCATTGGG + Intergenic
1104718654 12:131032521-131032543 GAACTCTCGGCTGCCCTCTTAGG + Intronic
1108980114 13:56500173-56500195 TGACACTGGGCTGCTTCATTGGG - Intergenic
1116956587 14:50929772-50929794 GAACTCTAGGTTACTCCATTGGG + Intronic
1124108775 15:26767155-26767177 TGGCTCTAGGTTGCTCCATTTGG - Intronic
1126657194 15:50991236-50991258 GGACAATGGGCTGCTCCATCCGG - Intronic
1126780294 15:52133906-52133928 GGACTCTCGGCTGCTCCATTTGG - Intronic
1128326305 15:66726189-66726211 GGACTCTAGGCTGCTCCCTGAGG + Intronic
1129238742 15:74239535-74239557 GCACTCTCAGCTACTCCACTGGG - Intronic
1131889112 15:96952773-96952795 GGAGTCTCTGCTGCTCTCTTTGG + Intergenic
1132086531 15:98912865-98912887 GGACTCTGGGCTTCCCCAGTCGG - Intronic
1132515357 16:363461-363483 GGTCTCCCGGCAGCTCCCTTGGG + Intergenic
1133969026 16:10553785-10553807 GGACTTTCTGCGGCTCCATACGG + Intronic
1141803694 16:86328234-86328256 GGACTCTGGGCTGCTGGGTTTGG + Intergenic
1142412567 16:89923899-89923921 GGACGTTCGGCTACTCCAGTGGG - Intronic
1142561834 17:814473-814495 CCCCTCTCTGCTGCTCCATTGGG - Intronic
1148699499 17:49579225-49579247 GGACTATCGGCTGGTCCAGAAGG + Exonic
1151252259 17:72845352-72845374 GGACTCTTGGCTACTCCTTGTGG + Intronic
1152550391 17:81026917-81026939 TGACACTGGGCTGCTCCACTGGG + Intergenic
1152716742 17:81903940-81903962 GGCCTCTGGGCTGCTCCAGGCGG + Intronic
1203163475 17_GL000205v2_random:72949-72971 GGGCTCTGTTCTGCTCCATTTGG - Intergenic
1156833249 18:41521287-41521309 GGACTCTCGTCTGGCCCATATGG - Intergenic
1158055138 18:53270025-53270047 AGAATCCAGGCTGCTCCATTGGG + Intronic
1160880385 19:1316949-1316971 GGACACCCTGCTGCTCCATCTGG + Intergenic
1161304510 19:3559495-3559517 TGATTCTCTGCTGCTCCACTTGG + Intronic
1163158853 19:15453145-15453167 GGTCTTGCGGCTGGTCCATTTGG + Exonic
1165902580 19:39175577-39175599 TGACTCTGGGCTGCTCCACCAGG - Intronic
1165940517 19:39412843-39412865 GGGCTCCCGGCTGCTCCAGGAGG - Exonic
1167671881 19:50858327-50858349 GGGCTCCCGGCTGCACCATCTGG - Intronic
1168102665 19:54149307-54149329 GGATTCTCGGGTGCTCCACCAGG - Intronic
1168163987 19:54534049-54534071 GGACTCTGGGCAGGTCCATCTGG - Intronic
1168492523 19:56822647-56822669 GAAGTTTCTGCTGCTCCATTTGG - Intronic
925445166 2:3920884-3920906 GGACTCAGGGCTGCGCCTTTGGG + Intergenic
925595702 2:5553464-5553486 GGACTCTCGGCTCCTCCTGGAGG + Intergenic
927949169 2:27155851-27155873 GGAGGCTCAGCTGCTCCATAGGG + Exonic
934366602 2:92672277-92672299 GCACTCTCGGAAGCTTCATTGGG + Intergenic
934402309 2:93248126-93248148 GCACTCTCGGAAGCTTCATTGGG + Intergenic
934568079 2:95351562-95351584 GGAAGCTCAGCAGCTCCATTTGG + Intronic
941809645 2:169742770-169742792 GGAGTCTGGGATGGTCCATTTGG - Intronic
943542306 2:189231984-189232006 GGTCTCTGTCCTGCTCCATTTGG + Intergenic
946374923 2:219302287-219302309 AGACTCTGGGCTGCTCTATCTGG - Exonic
1171439343 20:25148191-25148213 GCACTCTCGGCTTCCCCATGGGG - Intergenic
1174083263 20:47985687-47985709 AGACTCTGGGCTCCTCCAGTGGG + Intergenic
1174174994 20:48638995-48639017 GGACTCTGGGCTGTTCCCTCGGG - Intronic
1185007361 22:48289151-48289173 GGACTTTTGGCTGGACCATTAGG - Intergenic
1202717533 2_KI270715v1_random:25365-25387 GCACTCTCGGAAGCTTCATTGGG + Intergenic
949638199 3:6007400-6007422 GGACTCTAGGCTGCTGTAATTGG + Intergenic
951524479 3:23640502-23640524 GGTCTTTTGACTGCTCCATTTGG + Intergenic
959417943 3:106099863-106099885 GGTCTCTGTTCTGCTCCATTGGG + Intergenic
962362575 3:134754562-134754584 AGACTCTCGGCTTCTCCAAGAGG + Intronic
968863619 4:3193082-3193104 GTACTCTCAGCTGCTCTCTTGGG - Intronic
972158948 4:36198962-36198984 GGACTCCTGTCTGCTCCAGTGGG + Intronic
980929889 4:139176000-139176022 GCCCTCTCTTCTGCTCCATTTGG - Intronic
980991242 4:139740422-139740444 GGTTTGTCAGCTGCTCCATTAGG + Exonic
986722584 5:10570387-10570409 GGACTCATCGCTGCTCCATTTGG + Intronic
989730059 5:44638414-44638436 GGATTCTTTGCTGCTCCGTTGGG - Intergenic
993225143 5:85160148-85160170 GGACTGTCAGCTGAGCCATTTGG - Intergenic
995276803 5:110286504-110286526 GGACGCTGGGGTGCTCCATTTGG + Intergenic
1002634819 5:180602039-180602061 GATCTCTCGGCTGCTCCTCTGGG + Exonic
1007840475 6:44712114-44712136 GGATTCCCTGCTGCTCCTTTGGG + Intergenic
1011398369 6:86934455-86934477 GGATTGTCTGCAGCTCCATTTGG - Intergenic
1012311137 6:97725163-97725185 TGACGCTCAGCTGATCCATTGGG + Intergenic
1013702899 6:112795443-112795465 GGACTCTCGGTTTCTACAATGGG - Intergenic
1017463595 6:154674203-154674225 GGCCTCCAGGCTGCTCCATGTGG - Intergenic
1021716491 7:23467651-23467673 GGAGTCTCCACTGCTCCATAAGG + Intronic
1026874297 7:73870796-73870818 GGACTCTCGGCTGCACTTCTAGG + Intergenic
1031404726 7:121370854-121370876 GCTCTCTCTGCTGTTCCATTTGG + Intronic
1049299703 8:141863023-141863045 GGAGTCCTGGCTGCTCCAGTGGG - Intergenic
1058633572 9:107014698-107014720 GGAGTCTGGGTTGCTCCATCTGG + Intergenic
1060786933 9:126458384-126458406 GGCCTCTGGGCTGCTCCTTTTGG + Intronic