ID: 1126781674

View in Genome Browser
Species Human (GRCh38)
Location 15:52144308-52144330
Sequence ACAGAAAGAATATATTGGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 529
Summary {0: 1, 1: 0, 2: 1, 3: 46, 4: 481}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126781674_1126781677 12 Left 1126781674 15:52144308-52144330 CCTACCCAATATATTCTTTCTGT 0: 1
1: 0
2: 1
3: 46
4: 481
Right 1126781677 15:52144343-52144365 CATATCTAATATTTCAATATTGG 0: 1
1: 0
2: 2
3: 33
4: 449

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126781674 Original CRISPR ACAGAAAGAATATATTGGGT AGG (reversed) Intronic
903199523 1:21722971-21722993 ACAGAAAAAGTGTATTGGGGAGG + Intronic
904248968 1:29208943-29208965 ACACAAAGAACATCTTAGGTAGG + Intronic
904510509 1:31002345-31002367 TTAGAAAAAATATATTGGGAAGG - Intronic
905099144 1:35503263-35503285 ACAGAGAGAAAGGATTGGGTAGG - Intronic
908338095 1:63147942-63147964 ATAGGAAGATTATTTTGGGTGGG + Intergenic
908498426 1:64718646-64718668 AAAGAAAGAATAAATGGAGTGGG - Intergenic
908671704 1:66555319-66555341 ACAGAAAATATATTTTGGATAGG - Intronic
909750851 1:79158846-79158868 ACAGAAAGAATAAAGTGCCTAGG - Intergenic
909802967 1:79836417-79836439 ACACAAAGAATGTATTTGCTGGG - Intergenic
909848163 1:80423955-80423977 AAAGAAAGAAAATATTAGGTTGG - Intergenic
911054004 1:93695459-93695481 GCAGCAAGAACATACTGGGTGGG - Intronic
911159471 1:94670274-94670296 ACAGAAAAGATTTATTGGGAGGG + Intergenic
911498009 1:98654168-98654190 AAACAAAGAATATAATGGCTAGG + Intergenic
911740143 1:101378180-101378202 ACATAAAGCAAATATTGGTTTGG + Intergenic
912810660 1:112791790-112791812 ACACAAAGAAAATATTTGCTTGG + Intergenic
913111277 1:115659426-115659448 GCAGAAAGAAAATATTTAGTAGG + Intronic
914804913 1:150984674-150984696 ACAGTAAGAATATAGAGGGAGGG + Exonic
915086308 1:153391215-153391237 GCAGAATGAAAATTTTGGGTGGG + Intergenic
915409659 1:155690253-155690275 ACAGAAAGAAGACATTAGGCTGG + Intronic
915932564 1:160069470-160069492 ATAGAAGGAAGAGATTGGGTGGG + Intronic
917061587 1:171047995-171048017 ACAGAGAGAATATGTTTGTTTGG - Intronic
917116849 1:171611912-171611934 ACAGAAGTAATATATTTGTTAGG - Intergenic
917503880 1:175610876-175610898 AGAGAAAGAATACATTCTGTAGG + Intronic
917823432 1:178790244-178790266 ACATTAAGAATATATTGGCTGGG - Intronic
917952922 1:180059835-180059857 AAAGAAAAATTATTTTGGGTGGG - Intronic
918931408 1:190860416-190860438 GCAGAAAGAAAATGTTGGTTTGG - Intergenic
919275752 1:195414350-195414372 ACAGAAAAAACATTTTGTGTAGG + Intergenic
919494588 1:198248773-198248795 AGAGAAATACTAGATTGGGTGGG + Intronic
919516386 1:198530803-198530825 ACAGATAGAAGAAAGTGGGTTGG - Intronic
919608303 1:199713671-199713693 ACAGAAAGAATAAAATGCCTAGG + Intergenic
919632410 1:199972130-199972152 ACATAATGTATATATTAGGTTGG + Intergenic
920524280 1:206655308-206655330 ACAGAAAGAAAATCTTGGGAAGG + Intronic
920653815 1:207859786-207859808 GCAGGAAGAACATATTGGGGAGG + Intergenic
921572111 1:216792340-216792362 ACAGGAAGAATAAATTATGTTGG - Intronic
922588672 1:226755544-226755566 ACAGAAAAAGTATAGTGGCTGGG + Intergenic
923117043 1:230949943-230949965 AAAGAAAGAATAAATTGGGCCGG - Intronic
923935935 1:238760282-238760304 ACAGAAAGATGATATTCTGTAGG - Intergenic
1063875833 10:10477382-10477404 ACAGCAAAAATACAATGGGTGGG + Intergenic
1065529020 10:26650054-26650076 TAACAAAGAATATATTGGGCTGG - Intergenic
1066284326 10:33949933-33949955 ACAGGAAGAATATGTTGGACAGG - Intergenic
1066300276 10:34090010-34090032 AAAGAAAAAAGAAATTGGGTTGG + Intergenic
1066474544 10:35732335-35732357 ACAGAAAGTATTTTATGGGTGGG + Intergenic
1067066683 10:43107803-43107825 ACAGAAGGTATACATTGGTTTGG + Intronic
1067814721 10:49464922-49464944 GCAGAAGGAAAATGTTGGGTTGG + Intronic
1068182494 10:53539439-53539461 AATTAAAGAACATATTGGGTAGG - Intergenic
1068476253 10:57530381-57530403 AGAAAAAGAATAAATGGGGTTGG + Intergenic
1069005970 10:63317777-63317799 ACAGATAGAATAGATGGGATGGG - Intronic
1069440193 10:68421456-68421478 AAAGAAAGACTATTTTGGGCCGG + Intronic
1069494122 10:68887576-68887598 AAAGAAAGAAAATATTAGGCTGG - Intronic
1070124831 10:73612857-73612879 AAAAAAAGAATATATTTGGCTGG + Intronic
1071577616 10:86740938-86740960 AGAAAAAGAATATATTTGGGAGG + Intergenic
1071706380 10:88003947-88003969 ACAGAAAGGTTATGTTGGATAGG + Intergenic
1071739356 10:88339292-88339314 ACAGAATGCATAGATTAGGTAGG + Intronic
1073197122 10:101700967-101700989 ACTGTAAGAATAAATTAGGTAGG + Intergenic
1073197142 10:101701304-101701326 TCAGAAATTATCTATTGGGTTGG + Intergenic
1074239349 10:111621720-111621742 ACAGAAGGAAAATGTGGGGTTGG + Intergenic
1074843803 10:117379257-117379279 GCAGAAATAAGATACTGGGTAGG - Intergenic
1075094821 10:119464395-119464417 AGAGAAAGCTTATTTTGGGTTGG - Intergenic
1077251283 11:1561813-1561835 TGGGAAAGAATATATTGGGGGGG - Intronic
1079074826 11:17377935-17377957 ACTGAAAGAGAAGATTGGGTAGG + Intergenic
1079936008 11:26617065-26617087 ATATAAAGAATATTTTGGGCCGG - Intronic
1081085066 11:38788997-38789019 TCAGAACGAATAAGTTGGGTGGG + Intergenic
1081243044 11:40730334-40730356 ACAGAAAAAATGTAGTGGTTGGG - Intronic
1081940049 11:46933460-46933482 AGAGAGAGAATATATTGAGATGG - Intergenic
1088112180 11:106275068-106275090 ACAGAAAGAATAAATTGCCTAGG - Intergenic
1088140096 11:106605402-106605424 AAAGGCAGAATAGATTGGGTGGG + Intergenic
1089113684 11:116077103-116077125 ACAGAGACAATACATTTGGTAGG + Intergenic
1090316352 11:125792350-125792372 ACTGAAAGAATATAATTGGCAGG - Intergenic
1090762789 11:129851653-129851675 ACCTAAAGAATATGTAGGGTGGG - Intronic
1090919722 11:131197209-131197231 ACAAGAAGAACAGATTGGGTGGG + Intergenic
1090988198 11:131792273-131792295 ACAAACAGAAAATATTTGGTGGG + Intronic
1091157380 11:133386197-133386219 AAAGAAAGAAAAAACTGGGTTGG - Intronic
1091500263 12:1010183-1010205 AGAGAAAGGAAATATTGGCTGGG + Intronic
1091804319 12:3345056-3345078 AAAAAAAGAATACATTGGGTGGG - Intergenic
1092320139 12:7463264-7463286 ACAAAAAGAATATAATGCCTAGG - Intronic
1093329632 12:17819526-17819548 TAAGAAAGAAAACATTGGGTAGG - Intergenic
1093591231 12:20904665-20904687 ACAGAGAGAAAATGTGGGGTTGG - Intronic
1093668177 12:21839366-21839388 ACAGAAAGAAGACATTTGGAGGG + Intronic
1093708008 12:22296579-22296601 ACAGAAATATTTTCTTGGGTGGG - Intronic
1093876614 12:24355985-24356007 CCACAAAGAATAAATTGGGCTGG - Intergenic
1094181019 12:27592758-27592780 AAATAAAGAATATGTTAGGTAGG + Intronic
1094672036 12:32579803-32579825 AAAGAAAGGATAAATTGAGTAGG - Intronic
1096161688 12:49383696-49383718 GCAGGAAGAATAAAGTGGGTCGG - Intronic
1097072552 12:56365781-56365803 ATTAAAAGAATATATTGGTTGGG + Intergenic
1097326041 12:58277734-58277756 ACAGAAGGAAAATGTGGGGTCGG + Intergenic
1097353510 12:58575406-58575428 ACAGAAAGAGGAAATTGGCTCGG + Intronic
1098329545 12:69338775-69338797 TTAAAAAGAATATAATGGGTTGG + Intergenic
1098614077 12:72500802-72500824 ACACAAAAAATATTTTGGTTGGG + Intronic
1098809752 12:75071563-75071585 TCAGAAAAATTTTATTGGGTGGG - Intronic
1099426546 12:82530840-82530862 ACAAAAAGAATATCTAGGCTAGG - Intergenic
1099533355 12:83815759-83815781 AATAAAAGAATATATTGGCTGGG + Intergenic
1099803592 12:87488651-87488673 ACAAAACAAATGTATTGGGTAGG - Intergenic
1100246946 12:92767908-92767930 ATAGAAAGAATGTATAGGGCGGG + Intronic
1100956699 12:99916654-99916676 TCAGAAAGAATATTTTGGCCAGG + Intronic
1101268950 12:103122630-103122652 TCAGAAAGAACATTTTGGGCAGG + Intergenic
1105256734 13:18748313-18748335 ACAGAAGGAACATATAGGGTTGG - Intergenic
1105258069 13:18758052-18758074 ACAGAAGGAACATATAGCGTTGG - Intergenic
1105258225 13:18759375-18759397 GCAGAAAAAATATATGGGCTTGG + Intergenic
1105258951 13:18764510-18764532 GCAGAAGGAAAATATGGGGTTGG - Intergenic
1105260723 13:18777359-18777381 ACAGAAGGAACATATGGGGTTGG - Intergenic
1105260882 13:18778675-18778697 GCAGAAAAAATATATGGGCTTGG + Intergenic
1105262085 13:18786995-18787017 ACAGAAGGAACATATGGGTTTGG - Intergenic
1105263022 13:18793766-18793788 ACAGAAGGAACATATAGGGTTGG - Intergenic
1105263194 13:18795266-18795288 GCAGAAAAAATATATGGGCTTGG + Intergenic
1105263704 13:18798679-18798701 GCAGAAGGAATATATGGGCTTGG + Intergenic
1105979900 13:25508220-25508242 ACAGAAACAAGACATTAGGTAGG + Intronic
1106018469 13:25891880-25891902 ACAGAATGATTGTACTGGGTTGG + Intronic
1106968627 13:35106389-35106411 ACAGTAAGAATAGAATAGGTAGG - Intronic
1107013449 13:35690373-35690395 AAAGAAAAAATATATTAGCTGGG - Intergenic
1107170064 13:37330747-37330769 ACAGAAATAATATTCTGTGTAGG - Intergenic
1107389534 13:39949283-39949305 ACAGAAAGAATAAAGTGCCTAGG + Intergenic
1108113175 13:47099583-47099605 ACATAAAGAATATATTCTGGAGG + Intergenic
1108678675 13:52760788-52760810 ACAGAAAGAAAAGAGTTGGTGGG - Intergenic
1108917869 13:55638073-55638095 CCAGAAAAAATATTTTTGGTTGG - Intergenic
1109718378 13:66246242-66246264 ACAGAAGGGAAATATGGGGTTGG + Intergenic
1110261873 13:73493908-73493930 ACAGAAAGAATATTTATAGTAGG - Intergenic
1110446464 13:75588229-75588251 ACTGAAAGAATATATAAAGTTGG - Intronic
1110972394 13:81781550-81781572 ACAGATAGAACATATTGGCTTGG + Intergenic
1111136796 13:84056960-84056982 ACTCAAAGAATTTTTTGGGTAGG + Intergenic
1111212168 13:85093874-85093896 AAAGAAAGATAATGTTGGGTGGG - Intergenic
1111255697 13:85664722-85664744 ACAGAGATAAGATATTGTGTTGG - Intergenic
1111441380 13:88286022-88286044 GCAGAAGGAAAATATGGGGTTGG - Intergenic
1111977291 13:94979771-94979793 AGAGAAGGAATTTATTGGCTTGG + Intergenic
1112882375 13:104123452-104123474 GCAGAAAGAAAATGTGGGGTTGG + Intergenic
1116468559 14:45261216-45261238 ACAGAAGCAATGTCTTGGGTGGG + Intergenic
1116646961 14:47540461-47540483 ACAGAAAGAAAAAATAGGGGAGG - Intronic
1116895839 14:50313897-50313919 AAACAGAGAATAGATTGGGTGGG - Intronic
1117553114 14:56856190-56856212 GGAGAAAGAATTGATTGGGTTGG - Intergenic
1118597528 14:67447568-67447590 ACAGGAGGGATATATTGGGAGGG + Intronic
1118652112 14:67907781-67907803 ACAGAATAAATATATTGAGGTGG + Intronic
1119236287 14:73022335-73022357 ACAGAAGAAAAATATTAGGTGGG + Intronic
1120428004 14:84375319-84375341 ACAGAAAGAATAAAGTGTGTGGG + Intergenic
1120481408 14:85054035-85054057 GCAGAAGGAAAATATGGGGTTGG - Intergenic
1120596253 14:86441206-86441228 ACAGGAAGAAGGTATTGGGCTGG - Intergenic
1121013842 14:90536501-90536523 ACAGGAAGAATAGGTTGGGGAGG - Exonic
1202834742 14_GL000009v2_random:69352-69374 ACAGAAGGAAAATATGGGCTTGG - Intergenic
1124714033 15:32041792-32041814 AAATAAAGAATATATTTGATAGG - Intronic
1125353384 15:38790931-38790953 ACAGGAAGAAGAGATGGGGTGGG - Intergenic
1125542763 15:40479905-40479927 TAAGAAAGAATATATTGGCTGGG - Intergenic
1126781674 15:52144308-52144330 ACAGAAAGAATATATTGGGTAGG - Intronic
1128476613 15:68002362-68002384 AAAGAAAGAATACATTGTTTAGG + Intergenic
1131186722 15:90280481-90280503 GCAGAAAGAATATTCCGGGTGGG - Intronic
1135034696 16:19067475-19067497 ATAAAAAGATTTTATTGGGTGGG - Intergenic
1135795787 16:25441454-25441476 AAAGAAGGGACATATTGGGTGGG - Intergenic
1136103202 16:28010461-28010483 TCAGAAAGAAAATATTGGATTGG + Intronic
1140429864 16:74893214-74893236 ACAGAGAGACTATCCTGGGTGGG + Intronic
1140675599 16:77326322-77326344 ACAGAATGTAAATATTGGATTGG - Intronic
1144270865 17:13614223-13614245 GCAGACACAAAATATTGGGTAGG - Intergenic
1146414350 17:32617813-32617835 ATAGAAAGAATACATTGTTTGGG + Intronic
1147475791 17:40710372-40710394 ACAGAAAGGATAAATAGGGCAGG - Intergenic
1147479199 17:40742992-40743014 ACAGAGAGAAAAAATTAGGTAGG - Intergenic
1147700906 17:42394312-42394334 AAAAAAAGAAAATATTGAGTGGG - Intergenic
1148035957 17:44659962-44659984 ACAGAAAAATTATAATGTGTGGG + Intronic
1148612264 17:48972260-48972282 AAAGAAAGAGTGTGTTGGGTTGG + Intergenic
1149084352 17:52696643-52696665 ACAGAAAAAATAGATTGGAGGGG - Intergenic
1149804387 17:59601327-59601349 GGAGAAAGAAGATAATGGGTAGG - Intronic
1152058108 17:78048325-78048347 ACAGAACCAATATTTGGGGTGGG - Intronic
1153013530 18:562597-562619 ACATACAGTATATATAGGGTTGG - Intergenic
1153080388 18:1216800-1216822 AAAAAAAGTATATATAGGGTTGG - Intergenic
1153710007 18:7789023-7789045 AGATAAAGAATATCTTGGGCTGG + Intronic
1154424399 18:14260989-14261011 GCAGAAGGAAAATATGGGGTTGG + Intergenic
1154425133 18:14266116-14266138 GCAGAAAAAATATATGGGCTTGG - Intergenic
1154425290 18:14267433-14267455 ACAGAAGGAACATATAGGGTTGG + Intergenic
1154427089 18:14280342-14280364 GCAGAAGGAAAATATGGGGTTGG + Intergenic
1154428022 18:14287019-14287041 ACAGAAGGAACATATAGGGTTGG + Intergenic
1154428247 18:14288578-14288600 GCAGAAAGAAAATATGGGCTTGG - Intergenic
1154429814 18:14299875-14299897 GCAGAAAGAAAATACGGGGTTGG + Intergenic
1154430567 18:14305031-14305053 ACAGAAAAAATATATGGGCTTGG - Intergenic
1154431618 18:14313062-14313084 ACAGAAGGAACATATAGGTTTGG + Intergenic
1154432089 18:14316218-14316240 GCAGAAGGAAAATATGGGGTTGG + Intergenic
1154432825 18:14321356-14321378 GCAGAAAAAATATATGGGCTTGG - Intergenic
1154432986 18:14322672-14322694 ACAGAAGGAACATATAGGGTTGG + Intergenic
1154433212 18:14324233-14324255 GCAGAAAGAAAATATGGGCTTGG - Intergenic
1154433876 18:14329241-14329263 ACAGAAGGAAAATATGGTGTTGG + Intergenic
1154434308 18:14332365-14332387 ACAGAAGGAACATATAGGGTTGG + Intergenic
1155111448 18:22719254-22719276 ATAAAAAGAAAATATTGGATGGG + Intergenic
1155616289 18:27725295-27725317 ACAGAATGAAAATTTTTGGTAGG + Intergenic
1155738883 18:29260967-29260989 ACAAGAAGAATAGAGTGGGTAGG - Intergenic
1155900303 18:31381504-31381526 AAAGGAAGAATGTATAGGGTTGG - Intronic
1155999511 18:32369505-32369527 ACAGATAGAATATATGGAGATGG + Intronic
1156265488 18:35484498-35484520 ACAGACAGAAGACATTTGGTGGG + Intronic
1156876423 18:42019135-42019157 ACAGAAGGAAAGTATGGGGTAGG - Intronic
1157254422 18:46125560-46125582 AAAGAAAGAAAATAATGTGTTGG + Intronic
1158077528 18:53548104-53548126 AAAGAAACTATATATTGGCTTGG + Intergenic
1158199808 18:54927359-54927381 AGAGAAAGAATAGATCAGGTTGG + Intronic
1161048131 19:2147599-2147621 AGAAAAAGAATATATGGGCTGGG + Intronic
1163067274 19:14807293-14807315 AAAGAATGGATATATTGGGTAGG - Intronic
1164496794 19:28772798-28772820 CCAGATATAAAATATTGGGTGGG + Intergenic
1164569819 19:29365704-29365726 ACAGACAGAAAATATTGTCTAGG - Intergenic
1202637784 1_KI270706v1_random:56818-56840 ACAAAAGGAAAATATAGGGTTGG - Intergenic
1202637961 1_KI270706v1_random:58341-58363 ACAGAAGGAAAATATGGGCTTGG + Intergenic
1202638217 1_KI270706v1_random:60072-60094 GCAGAAGGAAAATATGGGGTTGG - Intergenic
925257078 2:2499454-2499476 GCAGAAAGGATATGTGGGGTTGG - Intergenic
926446779 2:12952531-12952553 AAAGAACAAATGTATTGGGTGGG - Intergenic
926863000 2:17328447-17328469 AGAGAGAGAATATGTTAGGTTGG + Intergenic
927493543 2:23536714-23536736 AAAGAAAGAATCTATTGGAAGGG + Intronic
928153204 2:28852015-28852037 ACAAAATGAATATTTTGGCTGGG + Intronic
928865172 2:35908803-35908825 AGAGAAAGATTATATCAGGTTGG + Intergenic
929226487 2:39516378-39516400 AAGGAAAGAATAGATTGGGAAGG - Intergenic
929962656 2:46508066-46508088 AATGAAAAAATATATTGGGGTGG + Intronic
930563014 2:52984432-52984454 AGAGAGAGAACATATTGGGCTGG - Intergenic
932918755 2:75885558-75885580 AAAGATAGAACATCTTGGGTAGG + Intergenic
933442209 2:82327318-82327340 ACAGACAGAATCTAGAGGGTGGG - Intergenic
933750324 2:85599016-85599038 ATGGAAAGAAGATATGGGGTGGG + Exonic
934492567 2:94771698-94771720 ACAGAAAGAAAATATGGGCTTGG + Intergenic
934492808 2:94773270-94773292 ACAGAAGGAATATATAGGGTTGG - Intergenic
934493652 2:94779521-94779543 GCAGAAAGAAAATATGAGGTTGG - Intergenic
936494048 2:113002410-113002432 ACAGACAAAACATATTGGTTTGG - Intergenic
937464145 2:122115244-122115266 ATAGAAAAAATATATGGGATAGG - Intergenic
937685927 2:124697295-124697317 AGAGAAAAAAGACATTGGGTAGG - Intronic
938279776 2:130055722-130055744 ACAGAAGGAAAATATGGGGTTGG - Intergenic
938330728 2:130446436-130446458 GCAGAAGGAAAATATGGGGTTGG - Intergenic
938359216 2:130675067-130675089 GCAGAAGGAAAATATGGGGTTGG + Intergenic
938435620 2:131281716-131281738 ACAGAAGGAAAATATGGGGTTGG + Intronic
939303469 2:140378398-140378420 ACAGAACCAATATATTGTTTAGG + Intronic
939656395 2:144831321-144831343 AAAGGAAGAATGTATTGGCTTGG + Intergenic
940629832 2:156224068-156224090 ACAGAAAGAATAAAGTGCCTAGG + Intergenic
941258402 2:163264045-163264067 ACAGGAAGAATATCTAGAGTAGG - Intergenic
942101103 2:172584963-172584985 AAGAAAAGCATATATTGGGTGGG - Intronic
942140088 2:172968746-172968768 AGAGAAAGCATACATTGGCTGGG - Intronic
942357036 2:175127278-175127300 CCAGAAAGAGTAAATTTGGTTGG + Intronic
943113660 2:183639318-183639340 ACAGAAAGTAGATGTTGGTTGGG + Intergenic
943312121 2:186338956-186338978 ACAGAAAGAATATAATACCTAGG - Intergenic
943372127 2:187028450-187028472 ACAGAAGGAAAATGTGGGGTTGG + Intergenic
943417262 2:187623977-187623999 CAATAAAGAATATATTAGGTTGG + Intergenic
944393671 2:199245957-199245979 ACAGAAAGGCTATAGTGGGCTGG + Intergenic
944742124 2:202622728-202622750 ACATAAAGAAAATATTGGCCAGG - Intergenic
945414215 2:209551102-209551124 ATAGGAAGAAAATATTGGATTGG + Intronic
945991342 2:216397830-216397852 ATAGAAAGTATATCTTGGGGTGG - Intergenic
946568331 2:220992995-220993017 AAAGAAAGAAGATCTGGGGTGGG + Intergenic
947020238 2:225666481-225666503 ATTGAAACAATATATTGGTTTGG + Intergenic
947671663 2:231940813-231940835 GCAGGAAGAATAGAGTGGGTGGG + Intergenic
948309934 2:236977500-236977522 ACAAACAGAAGATATTGGATGGG - Intergenic
1168863399 20:1062824-1062846 ACAGAAAGAGCATAGGGGGTGGG - Intergenic
1169630429 20:7625111-7625133 AAAGAAAGAATTTATTGCGAGGG - Intergenic
1169931655 20:10839519-10839541 ACAGAAAAAATAAATTGGATTGG + Intergenic
1171884801 20:30644136-30644158 GCAGAAGGAAAATATGGGGTTGG - Intergenic
1173230167 20:41188795-41188817 ACAGAGACAATATGTTGAGTGGG - Intronic
1173753600 20:45495915-45495937 TCACAAGGAATATTTTGGGTTGG - Intergenic
1174549360 20:51350512-51350534 AAAGAAAAAAAAAATTGGGTGGG + Intergenic
1175454525 20:59101722-59101744 AAAGAAAGAATACCTTAGGTAGG - Intergenic
1176843829 21:13861523-13861545 GCAGAAAGAAAATATGGGTTTGG + Intergenic
1176844063 21:13863084-13863106 ACAGAAGGAAAATATAGGGTTGG - Intergenic
1176844225 21:13864399-13864421 GCAGAAAAAATATATGGGCTTGG + Intergenic
1176844949 21:13869536-13869558 GCAGAAGGAAAATATGGGGTTGG - Intergenic
1176846741 21:13882408-13882430 ACAGAAGGAACATATAGGGTTGG - Intergenic
1176848146 21:13892257-13892279 ACAGAAGGAACATATAGGGTTGG - Intergenic
1178461176 21:32803712-32803734 ACAGTAAGAAAACATTGGGGAGG - Intronic
1178871228 21:36378398-36378420 TTAGAAAGAATATACTGGCTGGG + Intronic
1180363750 22:11921807-11921829 GCAGAAGGAAAATATGGGGTTGG + Intergenic
1181631498 22:24154010-24154032 ACAGAAAGAGTAGAGTGGATAGG - Intronic
1181688583 22:24545595-24545617 AAAAAAAGAATATAGTGGGGTGG - Intronic
1182664467 22:31947006-31947028 AAAAAAAGAATATATTGGAAGGG + Intronic
1184578509 22:45395048-45395070 ACTGAACAAATATATTAGGTTGG + Intronic
949426708 3:3924900-3924922 AAAGAAAAAATCTATTGGATGGG + Intronic
949798509 3:7877810-7877832 AAAGAAAGAAAAAATTGGGAAGG + Intergenic
949985139 3:9534657-9534679 ACAGAAACCATAAAGTGGGTGGG + Intronic
950335528 3:12189861-12189883 TCCAAAAGAATATATTGGCTTGG - Intronic
950800957 3:15551593-15551615 ACAGAAAGATTACATTTGTTTGG - Intergenic
950911011 3:16591727-16591749 ACAGAAAGCAGATCTTGGCTGGG - Intronic
950911149 3:16593466-16593488 ACAGAAAGCAGATCTTGGCTGGG - Intronic
951133640 3:19077696-19077718 ACAGAAAGAATATATTTTTCTGG + Intergenic
951229673 3:20162824-20162846 ACAGAAAAAATACACTGGATAGG + Intronic
951733056 3:25832161-25832183 ACATAAAAAATAGAATGGGTAGG + Intergenic
952090916 3:29884583-29884605 AAAGAAAGAATAAATTGACTTGG - Intronic
952206577 3:31186370-31186392 ACATAAAGACTATAGTTGGTGGG - Intergenic
953597380 3:44330390-44330412 ATAGAGAAAATATATTGGTTTGG - Intronic
955784352 3:62521219-62521241 AGAGAAAAAAAATATTAGGTGGG + Intronic
956075843 3:65504535-65504557 ACACAAAGAAGACATTGGGGAGG + Intronic
956383771 3:68694630-68694652 ATATAAAGATTATATTAGGTTGG + Intergenic
956487067 3:69734111-69734133 ATAGAAAGAATATATACGCTGGG + Intergenic
957337322 3:78848334-78848356 ACTGAATGAAAATATTAGGTTGG - Intronic
957429996 3:80091762-80091784 AAAGAAAGACTATGTTGGCTGGG - Intergenic
957525086 3:81370179-81370201 AAATAAAGAATATATTATGTTGG - Intergenic
957920946 3:86748028-86748050 GCAGAAAGAAAATGTGGGGTTGG + Intergenic
959385785 3:105704232-105704254 TCTTAAAGAATATATTTGGTTGG + Intronic
959626042 3:108452815-108452837 ACAGAAAAAAAATATTGAGTTGG + Intronic
959646030 3:108702422-108702444 ACAGACTGAAAATATTGGGATGG - Intergenic
959828963 3:110836721-110836743 ATACAAAGAATATAATGGCTGGG + Intergenic
960644129 3:119859767-119859789 ACAGACTGAATATTTTGGGGCGG - Intronic
961943262 3:130658635-130658657 GCAGAAAGAACTTAGTGGGTAGG - Intronic
963429357 3:145178428-145178450 ACAAAAACAAAATATTGGGAAGG + Intergenic
964132827 3:153310323-153310345 ACAGAAAAAATTTATAAGGTTGG - Intergenic
964618678 3:158698648-158698670 TCAGAAAGAAAATATGGAGTTGG - Intronic
964895510 3:161590664-161590686 ACAGAAAGGAAATGTGGGGTTGG - Intergenic
965168245 3:165224692-165224714 ACAGAGAGAATTCCTTGGGTGGG - Intergenic
965531651 3:169776329-169776351 ACAGGTAGAATATATTAAGTTGG + Intronic
965642962 3:170850439-170850461 ACAGAGAGACTATAAAGGGTTGG - Intronic
965990436 3:174811170-174811192 ACAGAAGGGAAATATGGGGTTGG + Intronic
966105911 3:176333524-176333546 ACAAAAAGAGTATACTGAGTGGG + Intergenic
966812929 3:183864479-183864501 AAAGAAATAAAATATTGGCTGGG + Intronic
967122059 3:186390918-186390940 ACAGAATCAATACATTGGCTTGG + Intergenic
967402223 3:189075962-189075984 AAAAAAAGTATATATTGGGAAGG - Intronic
969994896 4:11301980-11302002 ACAGTCAGAAAATATTGGGATGG - Intergenic
970918955 4:21370125-21370147 ACATTAAGAATAACTTGGGTTGG - Intronic
970971538 4:21989882-21989904 AGAGAAATAATACAATGGGTAGG - Intergenic
971068597 4:23063999-23064021 ACATAAAGAATATATTTAGATGG - Intergenic
971194414 4:24458201-24458223 GCACAAAGAAAATATTGGGCTGG + Intergenic
972002657 4:34058445-34058467 GCAGAAACATAATATTGGGTTGG - Intergenic
972068903 4:34989604-34989626 ACAGAAAGAATATTTTAGGATGG + Intergenic
972228500 4:37042940-37042962 ATAGAATGAATATATTGTGTTGG + Intergenic
972563401 4:40248441-40248463 AGAGAAAGAGAATATTGGCTGGG - Intergenic
972575464 4:40347106-40347128 AAATAAAAAATATATTGGCTGGG - Intronic
972854108 4:43084988-43085010 ACAAAAAGAAGATATGTGGTTGG - Intergenic
972923697 4:43976162-43976184 AGAGAAAGAATATATGTGATTGG - Intergenic
973344072 4:49035790-49035812 CCAGTTAGAATATATTGGATTGG + Intronic
973367296 4:49218209-49218231 GCAGAAAGAAAATATGGGCTTGG + Intergenic
973367538 4:49219769-49219791 AGAGAAGGAACATATAGGGTTGG - Intergenic
973368450 4:49226419-49226441 GCAGAAGGAAAATATGGGGTTGG - Intergenic
973392599 4:49569006-49569028 GCAGAAGGAAAATATGGGGTTGG + Intergenic
973840485 4:54855708-54855730 ACAGAAATAATCTATTGCCTTGG + Intergenic
975245737 4:72119154-72119176 AGAAAACAAATATATTGGGTTGG + Intronic
975766107 4:77669224-77669246 ACATTAAGAATGTATTGGGCCGG - Intergenic
975837367 4:78438796-78438818 GTTGAAAGAATATATTGGTTTGG + Intronic
976345494 4:83994755-83994777 ACAGAAATTATATATTGGTTTGG - Intergenic
977163393 4:93664626-93664648 ACAGGAAGAATATTTTGGGGTGG + Intronic
977383580 4:96308655-96308677 GCAGAAGGGAAATATTGGGTGGG + Intergenic
977396963 4:96483616-96483638 GCAGAAAGAATCTATTTGTTGGG - Intergenic
977550675 4:98439601-98439623 ACAGAAAGAAAATAATCTGTGGG - Intronic
977823414 4:101502547-101502569 CCAGAAAGAATCAGTTGGGTGGG - Intronic
978057579 4:104291419-104291441 ACAGCTGGAAGATATTGGGTAGG - Intergenic
978665999 4:111182856-111182878 ACAGAAGGAAAATGTGGGGTTGG - Intergenic
979007652 4:115322463-115322485 ACAAATAGAAAATATTGGCTGGG + Intergenic
980579638 4:134732711-134732733 ACAGAAAGGAAATGTAGGGTTGG + Intergenic
981788990 4:148514423-148514445 AAAGAAAGCATATATTGAGGAGG - Intergenic
981977823 4:150752437-150752459 TCAGAAAGAATAGATTTTGTTGG + Intronic
982376517 4:154696806-154696828 ACAGAAAGAATATTTTGGAGAGG + Intronic
982513793 4:156318754-156318776 ATAGAAACCATATATTGGGTGGG + Intergenic
982995064 4:162333431-162333453 ACAGAAGGAAAATATTAAGTGGG - Intergenic
983170886 4:164535159-164535181 ACAGAAAGAAAATGTGGGCTGGG + Intergenic
983815124 4:172115853-172115875 ACAGAAAGAAAATATTAATTAGG - Intronic
984443411 4:179802419-179802441 ACAGAAATAATAGAATTGGTAGG + Intergenic
984454307 4:179945363-179945385 GCAGAAAGGAAATATGGGGTTGG + Intergenic
1202765282 4_GL000008v2_random:144198-144220 ACAGAAGGAAAATATGGGCTTGG + Intergenic
986917083 5:12633735-12633757 TCAGTAAGAATATATAGGCTAGG - Intergenic
987569330 5:19634959-19634981 AAAAAAAGAATGTATTTGGTGGG + Intronic
987601572 5:20078761-20078783 ACAAAAAAAATATATTAGCTGGG - Intronic
987851564 5:23361911-23361933 GCAGAAAGAAAATGTGGGGTTGG - Intergenic
987901445 5:24017625-24017647 TCAGAAACAATATGTTGTGTGGG + Intronic
987910211 5:24133123-24133145 AAAGAAAAAATACATTGGATGGG + Intronic
987954655 5:24722859-24722881 ACAGAGGGAATATAATGGGGTGG - Intergenic
988369700 5:30350596-30350618 AAAGAAAGAATATTTTTGGGGGG + Intergenic
988656098 5:33213492-33213514 ACATAAAGATTATATTATGTTGG + Intergenic
989083398 5:37650099-37650121 ACTGAAAGAAAGTATTGGGCCGG + Intronic
991510893 5:67375512-67375534 ACAGAAAGAATGTATTGGTCTGG + Intergenic
991913156 5:71581509-71581531 ACAGATGGAAAATATTGGGTGGG - Intergenic
992018833 5:72602453-72602475 ACAGAAAGAACATGTTGCATTGG - Intergenic
992248518 5:74853982-74854004 AAATAAAAGATATATTGGGTAGG - Intronic
992266352 5:75021878-75021900 AAAGGATGAATATGTTGGGTAGG - Intergenic
992591568 5:78301130-78301152 ACAGAAAGGAAATGTGGGGTTGG + Intergenic
992744903 5:79810013-79810035 AGAGAGAGAACATATTGGTTTGG + Intergenic
993115032 5:83710194-83710216 ACAGGGAGAATATGTAGGGTGGG + Intronic
993148705 5:84131935-84131957 AAAGAAAGAATATAGGGGCTGGG + Intronic
993398939 5:87425100-87425122 ACAGGAAGAAGAAATTTGGTTGG - Intergenic
993477746 5:88385861-88385883 ACAGAAAAAATAAAATGGGATGG - Intergenic
994253882 5:97570094-97570116 GCAGAAGGGAAATATTGGGTTGG - Intergenic
994627655 5:102242014-102242036 ACAGAGAGAATCTCTTGGGGTGG + Intronic
995057188 5:107772968-107772990 ACAGAAAGAATATCTTAGAGTGG - Intergenic
995174533 5:109159958-109159980 AGAGAAAGACTACATTTGGTGGG + Intronic
995604037 5:113832016-113832038 ATAGCAATAATGTATTGGGTAGG + Intergenic
996113623 5:119594356-119594378 TCAGAAGGAAAATATTGGGCAGG + Intronic
996222096 5:120946718-120946740 ACAGAAAAAATATATTTATTTGG + Intergenic
996268265 5:121569859-121569881 ATAGAAAGTATAGATTGGGAAGG - Intergenic
996834606 5:127776982-127777004 ACAGAAGGAAAATGTGGGGTGGG + Intergenic
996929490 5:128869074-128869096 TCCAAAAGAATATATTGAGTAGG - Intronic
997100026 5:130958493-130958515 GCAGAAAGGAAATATGGGGTTGG + Intergenic
998118614 5:139558581-139558603 AAATAAACAATATATTGGCTGGG - Intronic
998635130 5:143945370-143945392 ACAAAAAGAATATAATGCCTAGG - Intergenic
999021656 5:148172767-148172789 TGAGAAAAAATATATTTGGTGGG + Intronic
1002451870 5:179323361-179323383 ACAGAGAGAATACTTTGGGGAGG + Intronic
1003694526 6:8390160-8390182 AGAGAAACAATATATGTGGTGGG - Intergenic
1004350745 6:14888263-14888285 CCATGGAGAATATATTGGGTGGG - Intergenic
1004828889 6:19455675-19455697 ACAGAACCACTATGTTGGGTAGG - Intergenic
1004915293 6:20326432-20326454 ATACAAAGAAAATATTTGGTTGG - Intergenic
1005204758 6:23389723-23389745 GCAAAATGACTATATTGGGTAGG + Intergenic
1005402805 6:25451846-25451868 AGAGAAAAGATTTATTGGGTTGG - Intronic
1005992410 6:30911611-30911633 AAAGAATGAATGTATGGGGTTGG + Intronic
1007980496 6:46150982-46151004 ATAAAAAGAATATGTTGGCTGGG - Intergenic
1008386565 6:50897919-50897941 ACAGAAAGAACTGATTGGGCAGG - Intergenic
1008413052 6:51205787-51205809 ACAGAAAGAGTATACTAAGTGGG + Intergenic
1009235329 6:61116424-61116446 AAAGCAAAAATATACTGGGTAGG + Intergenic
1009723453 6:67506242-67506264 GCAGAAGGAAAATGTTGGGTTGG - Intergenic
1010268619 6:73895590-73895612 AAAGAAAGAACATAGTGGATTGG - Intergenic
1010685588 6:78851312-78851334 ACAAAAAGAACAAATGGGGTGGG + Intergenic
1011798338 6:90982355-90982377 TCAGAAACACTTTATTGGGTTGG + Intergenic
1011962291 6:93106128-93106150 ATAGAATGAATATACTGGGTGGG - Intergenic
1012034979 6:94124237-94124259 AAAGAAAGAATAAATTGGCAAGG + Intergenic
1012040263 6:94195785-94195807 GCAGAGAGAATATTTTGGGGAGG + Intergenic
1012117411 6:95320032-95320054 ACAGAAAAAATATATAGAGATGG - Intergenic
1012974634 6:105767184-105767206 AATAAAAGAATATAGTGGGTAGG - Intergenic
1013163455 6:107568519-107568541 ACACACAGAATAAATTAGGTTGG + Intronic
1013171722 6:107642242-107642264 ACAGAAAAAAAAAATAGGGTGGG + Intronic
1014720387 6:124911141-124911163 ACAGAAATAATATGTTGGGCAGG - Intergenic
1015584576 6:134762120-134762142 ACATAAAGAAAATGTTGGCTGGG - Intergenic
1015834710 6:137407892-137407914 ACAGAAAGAATAAATTACCTAGG - Intergenic
1015860466 6:137673279-137673301 TCTGAAAGAAAATATTGGCTGGG + Intergenic
1015925067 6:138300601-138300623 AAAAAAGGAAGATATTGGGTTGG + Intronic
1016546999 6:145235264-145235286 ACAAAGAAAATATATTGGATTGG - Intergenic
1016591244 6:145746080-145746102 AGAGAAAGAAAATATGGGGTGGG - Intergenic
1016909481 6:149183369-149183391 ACAGAAAAAATATACTTGTTGGG + Intergenic
1017017161 6:150110752-150110774 ACAGAATGAATGTATTGGGCAGG - Intergenic
1017018517 6:150121022-150121044 ACAGAAAGAGTATAATTGGAAGG - Intergenic
1018527488 6:164729048-164729070 GCAGAAGGAAAATGTTGGGTTGG + Intergenic
1020197369 7:6051722-6051744 GCAGAAAGAATATCCTTGGTGGG - Intronic
1021033829 7:15772148-15772170 AAAGATAGCATATATTGGGGAGG + Intergenic
1021421326 7:20448472-20448494 ACCAAAAGAATACATTGGGCAGG + Intergenic
1021586529 7:22214700-22214722 ACAGAAAGAATACGTAGGGAGGG - Intronic
1021654088 7:22857824-22857846 AAAAAAAGAATATACTGGGCGGG - Intergenic
1025016639 7:55444369-55444391 ACATGAAGAATGTACTGGGTTGG - Intronic
1025553028 7:62273178-62273200 ACAGATAGAATCTAATGAGTAGG + Intergenic
1026220103 7:68388717-68388739 CCAGAAATAATATAGAGGGTTGG + Intergenic
1027766030 7:82343170-82343192 ATAGAAAGAATAGAGTGGCTAGG - Intronic
1027862537 7:83603108-83603130 AAAGAAATACAATATTGGGTTGG - Intronic
1028064816 7:86370253-86370275 AAAGATAGAATATACTGTGTTGG - Intergenic
1028407012 7:90486163-90486185 ACAGCAAGAAGTGATTGGGTGGG + Intronic
1028503784 7:91549305-91549327 ACAGAAAGAACAAAATGTGTTGG - Intergenic
1030178760 7:106682715-106682737 GCAGAAAGAGGATATTGGATGGG + Intergenic
1030312648 7:108083733-108083755 ACAGATAGAATACATGGGCTTGG + Intronic
1030388595 7:108897085-108897107 AAATAATGAAAATATTGGGTAGG + Intergenic
1031254941 7:119435440-119435462 GCAGAAGGAAAATATAGGGTTGG - Intergenic
1031335238 7:120521843-120521865 AGAAAAATAATCTATTGGGTAGG + Intronic
1031828748 7:126600314-126600336 ACAGACAGAAAATATTGTATTGG + Intronic
1031905941 7:127459374-127459396 ACAGAAAGACTACATTTGTTTGG + Intergenic
1031993996 7:128216597-128216619 ACAGAAAGACTATTTTTGGATGG + Intergenic
1033264557 7:139873602-139873624 ACAGAAATAAAACGTTGGGTGGG + Intronic
1033720301 7:144051579-144051601 ACAGAAAGCAGATCCTGGGTAGG - Intergenic
1034600481 7:152249086-152249108 ATCCAAAGAATATTTTGGGTAGG - Intronic
1034684229 7:152955881-152955903 ACAGAAAGAATAAATTTGGGTGG - Intergenic
1035121748 7:156574089-156574111 GCAGACAGAAGATATTTGGTTGG + Intergenic
1035684666 8:1514463-1514485 ACAGCGAGAAAATATTGTGTTGG + Intronic
1035702758 8:1649210-1649232 ACAAAAAGAATTTACTGGTTGGG - Intronic
1036027195 8:4922705-4922727 ACAGAATGCATATAATGGGCTGG - Intronic
1036598002 8:10231391-10231413 AGAGACAGAAGATATTGGCTTGG + Intronic
1036935466 8:12997901-12997923 ACACAAAGAATATCTAGTGTTGG - Intronic
1037871549 8:22502074-22502096 AAAGAAAGATTATCTTGGGAGGG - Intronic
1039059646 8:33563571-33563593 ACAGAAAGTAAATATTTGGGTGG - Intronic
1039941365 8:42094120-42094142 GGAGAAAGCAGATATTGGGTGGG - Intergenic
1040102498 8:43518145-43518167 GCAGAAGGAAAATATGGGGTTGG + Intergenic
1040103097 8:43522217-43522239 ACAGAAGGAAAATATGGGTTTGG - Intergenic
1040645825 8:49395450-49395472 ACAGAAAGAGAATTTTAGGTGGG - Intergenic
1040895952 8:52368485-52368507 AAAGAGAGAATATATTAGTTAGG + Intronic
1040931050 8:52735730-52735752 ACAGAAAGAAGAAATTCGGCCGG + Intronic
1041480619 8:58316078-58316100 ACACAAAAAACATATTGGATTGG + Intergenic
1041628202 8:60055168-60055190 AAAGAAATAATATATTATGTGGG - Intergenic
1041745984 8:61210003-61210025 AAAGAAAGATTATCATGGGTGGG + Intronic
1042076587 8:65001973-65001995 TTAGAATGAATATATAGGGTAGG + Intergenic
1042400138 8:68335782-68335804 AAAGAAATAATATTTTGGGCAGG + Intronic
1042864015 8:73340964-73340986 ACAGGAAGGATATATGGGGATGG + Intergenic
1043261765 8:78209345-78209367 ACAGTAACAAAATATTGGCTGGG + Intergenic
1044184042 8:89230752-89230774 AAAGAAAGAAGAAATTGGGAAGG + Intergenic
1044483788 8:92725314-92725336 ACAGAGAGAATATGTTGGGGTGG + Intergenic
1044784724 8:95781816-95781838 ACAGAAAGGAAATGTGGGGTTGG + Intergenic
1044823172 8:96172162-96172184 ACAGAAAGAATAGAATGGAATGG + Intergenic
1045920277 8:107521162-107521184 ACAGAAAGAATTCATGGGCTAGG + Intergenic
1045990739 8:108304088-108304110 ATAGTAATAATATATTAGGTGGG + Intronic
1046640049 8:116719682-116719704 AAAAAAAGAATATATGGGTTAGG + Intronic
1046911050 8:119627207-119627229 ACAGAACGAATATATGAGATTGG + Intronic
1047036234 8:120941607-120941629 AAAGATTAAATATATTGGGTAGG + Intergenic
1048038985 8:130706878-130706900 GCAGAAAGAAAATGTGGGGTTGG - Intergenic
1048347787 8:133590624-133590646 ACAGAAAAAATATTTAAGGTTGG - Intergenic
1048706027 8:137154684-137154706 GCAGAAGGAAAATGTTGGGTTGG + Intergenic
1049141323 8:140957136-140957158 ATATAAAGAAAATATTGGCTAGG + Intronic
1050275922 9:4000227-4000249 ACAGAAGAAATATATTTAGTAGG + Intronic
1050383001 9:5050739-5050761 ACAGGAAGAATGTCTTGGGATGG + Exonic
1051238145 9:15023577-15023599 AAAGACAGAGTATAATGGGTAGG - Intergenic
1051711081 9:19931853-19931875 AAAGAAATAAAATATTGAGTTGG + Intergenic
1051834435 9:21319290-21319312 ACATAAAGAATATATAGGCCTGG + Intergenic
1052695882 9:31877255-31877277 ACAGAAAGAATAAATTACCTAGG - Intergenic
1052878236 9:33583546-33583568 GCAGAAGGAAAATATGGGGTTGG + Intergenic
1052879547 9:33592843-33592865 ACAGAAGGAACATATAGAGTTGG + Intergenic
1053495985 9:38548316-38548338 GCAGAAGGAAAATATGGGGTTGG - Intronic
1053496434 9:38551390-38551412 ACAGAAGGAACATATAGAGTTGG - Intronic
1053497747 9:38560661-38560683 GCAGAAGGAAAATATGGGGTTGG - Intronic
1053665775 9:40316637-40316659 GCAGAAGGAAAATATGGGGTTGG + Intronic
1053914934 9:42938766-42938788 ACAGAAGGAGAATATGGGGTTGG + Intergenic
1053915359 9:42941684-42941706 GCAGAAGGAAAATATGGGGTTGG + Intergenic
1054376315 9:64452213-64452235 AAAGAAAGAAAATATGGGCTTGG - Intergenic
1054376931 9:64456667-64456689 GCAGAAGGAAAATATGGGGTTGG + Intergenic
1054518837 9:66059647-66059669 GCAGAAGGAAAATATGGGGTTGG - Intergenic
1055748467 9:79477116-79477138 ACAGAAACAAACTATTGGTTAGG + Intergenic
1055883249 9:81028113-81028135 GGAGAAAGACTGTATTGGGTTGG - Intergenic
1056283958 9:85069565-85069587 ACAGAAGGGAAATGTTGGGTTGG + Intergenic
1056586092 9:87928127-87928149 GCAGAAGGAAAATATGGGGTTGG - Intergenic
1056897411 9:90563879-90563901 ACAGAAAGAACCTATTGGATGGG - Intergenic
1057003155 9:91531524-91531546 AGAGAAAGCATATATAGGGTGGG + Intergenic
1057535359 9:95897593-95897615 TAAGAAAGAATTCATTGGGTAGG + Intronic
1057676351 9:97138930-97138952 ACAGAAGGAACATATGGAGTTGG - Intergenic
1057676779 9:97142050-97142072 ACACAAGGAACATATAGGGTGGG - Intergenic
1057677210 9:97145146-97145168 GCAGAAGGAAAATATGGGGTTGG - Intergenic
1059133327 9:111778155-111778177 ACAGAATAAATATATTGGACAGG - Intronic
1059621072 9:116006259-116006281 AGAGAAAGATTATCTTGGGCAGG + Intergenic
1062719907 9:138034713-138034735 GAAGAAAGAAAATATTGGCTAGG - Intronic
1203545530 Un_KI270743v1:125663-125685 ACAGAAAAAGTATATGGGCTTGG + Intergenic
1203546031 Un_KI270743v1:129087-129109 ACAGAAGGAAAATATGGGCTTGG + Intergenic
1185840091 X:3381237-3381259 AAAAAAAGAATATATTGGCTGGG + Intergenic
1185868535 X:3643936-3643958 ACAGTAACAACATTTTGGGTGGG - Intronic
1188208688 X:27392902-27392924 ACATAAAGAATGGATTGGCTGGG + Intergenic
1188719512 X:33505728-33505750 ACAGAAGGAAAATGTGGGGTTGG + Intergenic
1189645992 X:43132531-43132553 AGAGAGAGAATATATTGTGCTGG - Intergenic
1190255170 X:48757104-48757126 TTAGAAGGAATATATTGGCTGGG - Intergenic
1190806412 X:53841791-53841813 AGAGAGAGAATATATTATGTAGG + Intergenic
1191000544 X:55656302-55656324 AAAGAAAGAATATCTATGGTTGG - Intergenic
1191777637 X:64833939-64833961 ACAGAAAGAATATAATACCTAGG - Intergenic
1191903021 X:66057784-66057806 ACAGAAGGAATTCATAGGGTAGG - Intergenic
1192508653 X:71708229-71708251 ATAGAAAGAAGATATTGTGGGGG + Intergenic
1192518044 X:71773324-71773346 ATAGAAAGAAGATATTGTGGGGG - Intergenic
1193004091 X:76596568-76596590 GCAGAAAGAAAATGTGGGGTTGG - Intergenic
1193206179 X:78750529-78750551 ACAGACATGCTATATTGGGTAGG + Intronic
1193733095 X:85125145-85125167 AGAAAAAGAATAGACTGGGTTGG + Intergenic
1194300613 X:92181897-92181919 GCAGAAGGGAAATATTGGGTGGG + Intronic
1195168244 X:102241132-102241154 ACAGAAAGAATGAATAAGGTGGG - Intergenic
1195190613 X:102445955-102445977 ACAGAAAGAATGAATAAGGTGGG + Intronic
1195525623 X:105886185-105886207 ACAGAAAGGATATATGGGTCTGG - Intronic
1196903506 X:120409818-120409840 AGAGAAGGAAAATATGGGGTTGG - Intergenic
1197038987 X:121911688-121911710 ACAGAAAACATACATTGGATTGG - Intergenic
1197640258 X:128959565-128959587 ACAGAAAGGAAATGTGGGGTTGG - Intergenic
1198469055 X:136929345-136929367 ACAAAAACAAAATATTGGGCTGG - Intergenic
1198566088 X:137906877-137906899 ACAGAAAGAAAATTTGGGGTTGG + Intergenic
1198693321 X:139307780-139307802 ACAGAAAGAAAATATGAGGTTGG + Intergenic
1199198744 X:145062491-145062513 ATAGAATGTATATATTAGGTTGG - Intergenic
1200455794 Y:3390604-3390626 ACAAAAAGAATATGTGGGGCAGG - Intergenic
1201118143 Y:10850410-10850432 ACAGAAAGAATTTAATGGAATGG - Intergenic
1201266739 Y:12214021-12214043 ACAGAAAGTGTGTATTGGATAGG - Intergenic
1201292209 Y:12431847-12431869 ACAGAAAGAAGAGATTTGGGTGG + Intergenic
1201383151 Y:13407969-13407991 ACAGAATGGATATATTGTGATGG - Intronic
1202277137 Y:23134528-23134550 ACAGAAAGGAGATCTTGGCTGGG - Intronic
1202288891 Y:23286161-23286183 ACAGAAAGGAGATCTTGGCTGGG + Intronic
1202430129 Y:24768252-24768274 ACAGAAAGGAGATCTTGGCTGGG - Intronic
1202440663 Y:24901835-24901857 ACAGAAAGGAGATCTTGGCTGGG + Intronic