ID: 1126782507

View in Genome Browser
Species Human (GRCh38)
Location 15:52150681-52150703
Sequence AACCCAGCTGTGGCCTCCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 350
Summary {0: 1, 1: 1, 2: 4, 3: 47, 4: 297}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126782504_1126782507 5 Left 1126782504 15:52150653-52150675 CCACAGAGAATGCTGCCACTTTC 0: 1
1: 0
2: 2
3: 17
4: 246
Right 1126782507 15:52150681-52150703 AACCCAGCTGTGGCCTCCCATGG 0: 1
1: 1
2: 4
3: 47
4: 297
1126782503_1126782507 9 Left 1126782503 15:52150649-52150671 CCTGCCACAGAGAATGCTGCCAC 0: 1
1: 0
2: 2
3: 27
4: 219
Right 1126782507 15:52150681-52150703 AACCCAGCTGTGGCCTCCCATGG 0: 1
1: 1
2: 4
3: 47
4: 297
1126782505_1126782507 -10 Left 1126782505 15:52150668-52150690 CCACTTTCACTGTAACCCAGCTG 0: 1
1: 0
2: 1
3: 14
4: 215
Right 1126782507 15:52150681-52150703 AACCCAGCTGTGGCCTCCCATGG 0: 1
1: 1
2: 4
3: 47
4: 297
1126782502_1126782507 10 Left 1126782502 15:52150648-52150670 CCCTGCCACAGAGAATGCTGCCA 0: 1
1: 0
2: 1
3: 25
4: 253
Right 1126782507 15:52150681-52150703 AACCCAGCTGTGGCCTCCCATGG 0: 1
1: 1
2: 4
3: 47
4: 297

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126782507 Original CRISPR AACCCAGCTGTGGCCTCCCA TGG Intronic
900013820 1:136070-136092 GACCCCGCTGTTGCCTCCCAGGG + Intergenic
900043890 1:492053-492075 GACCCCGCTGTTGCCTCCCAGGG + Intergenic
900065327 1:727056-727078 GACCCCGCTGTTGCCTCCCAGGG + Intergenic
900302814 1:1986437-1986459 CACCCTGCTGGGGCCTTCCAGGG + Intronic
900391807 1:2436916-2436938 CACCCAGCTGAGGCCTCCTGGGG + Intronic
900483133 1:2909011-2909033 CACCCAGCTCTGGCTTCCAAGGG + Intergenic
900573088 1:3369308-3369330 AAGCCAGCTTTGGCTTCCAAGGG + Intronic
901664244 1:10817379-10817401 GCCCCTGCTGTGGCTTCCCAGGG + Intergenic
901733494 1:11297315-11297337 CTTCCAGCTGTGTCCTCCCATGG - Intergenic
906260136 1:44380674-44380696 AACCCAGATGTCCCCTCCCTTGG - Intergenic
907046390 1:51302639-51302661 AACCCAGCAGGGGCTTCCCAGGG + Intronic
914815042 1:151057045-151057067 AACCCAGATGTGTCCTACCCTGG - Intronic
915223373 1:154392781-154392803 ACCTCAGCCTTGGCCTCCCAAGG + Intergenic
919217114 1:194571528-194571550 AAGACAGATCTGGCCTCCCAGGG + Intergenic
920340256 1:205271271-205271293 AGCACATCTGGGGCCTCCCAAGG - Intronic
920835323 1:209505624-209505646 AGCCCAGCTGAGGCCTCCACTGG - Intergenic
921068729 1:211641637-211641659 AACCCAGCCCAGGCCTCCCTGGG - Intergenic
922344360 1:224684071-224684093 AACACAGCTGTGGCATCTCCCGG - Intronic
922575438 1:226658286-226658308 AACCCAGCTGGGCCCTGCCAGGG - Intronic
922734515 1:227972038-227972060 GGCCCAGCTGTTGCCTCCCAGGG - Intergenic
922734797 1:227973169-227973191 GGCCCCGCTGTTGCCTCCCAGGG - Intergenic
924343415 1:243054667-243054689 AAACCCGCTGTTGCCTCCCAGGG + Intergenic
1063361299 10:5461457-5461479 ATCCCAGCTAAGGCCTGCCAAGG + Intergenic
1063600436 10:7475693-7475715 ATCCCAGCTGTTTCTTCCCAGGG + Intergenic
1063974088 10:11401607-11401629 AGCCCAACTGTGGGCTCTCATGG + Intergenic
1066733054 10:38450848-38450870 GGCCCCGCTGTTGCCTCCCAGGG - Intergenic
1068008838 10:51422326-51422348 CACCTAGCTGTGGCATCCTATGG - Intronic
1069221211 10:65886118-65886140 AACCCAGCTGTGCCCTACCTTGG + Intergenic
1069959295 10:72070222-72070244 GACCCAGCTGGGGCCTCCGGAGG - Intronic
1070401381 10:76056293-76056315 GACCCTGCTGTGGCCACCCATGG - Intronic
1070977261 10:80615046-80615068 CACTCAGCTGCTGCCTCCCAGGG - Intronic
1070998076 10:80804149-80804171 AATCCTGCTTTGGACTCCCATGG - Intergenic
1071265448 10:83960693-83960715 ATCCCAGCTGTGGCCTTGTAGGG + Intergenic
1071353508 10:84769757-84769779 AACCCAGCTCTCGCCTCCCACGG - Intergenic
1071485450 10:86099192-86099214 AACCCAGCTCTGCCATCCCCAGG + Intronic
1071829104 10:89354349-89354371 AACCAAGCTGTGCCCTACCTTGG + Intronic
1071899147 10:90100376-90100398 CATCCAGCTGTGCCCTCACATGG + Intergenic
1072953787 10:99871228-99871250 AATCCTGCCTTGGCCTCCCAAGG + Intergenic
1074440616 10:113474482-113474504 ACTGCAGCTGTGGTCTCCCAAGG + Intergenic
1075071450 10:119322416-119322438 ACCCCAGCGACGGCCTCCCAGGG - Intronic
1075484880 10:122814033-122814055 CCCCCAGCCCTGGCCTCCCATGG - Intergenic
1075484899 10:122814113-122814135 CCCCCAGCCCTGGCCTCCCATGG - Intergenic
1075677232 10:124303965-124303987 ATTCCAGATGTGGCCTGCCAAGG + Intergenic
1075961327 10:126569526-126569548 ACCCCAACTGTGGCCTGCCTGGG - Intronic
1076191280 10:128485190-128485212 CACTCATCTGTTGCCTCCCATGG - Intergenic
1076478541 10:130769027-130769049 GACCCAGCTCTGTCCTGCCAAGG - Intergenic
1076715052 10:132359482-132359504 CACCCAGCAGTGGCCACCCAAGG - Intronic
1076837355 10:133027894-133027916 AGCCCAGATGTGGCCTCCTGGGG + Intergenic
1076970164 11:128284-128306 GACCCCGCTGTTGCCTCCCAGGG + Intergenic
1077610062 11:3638655-3638677 AGCCCTGCTGTGGCCTCCCCAGG + Exonic
1078408472 11:11092049-11092071 ATCCCAGCTGAGTCCTCCCAAGG - Intergenic
1078930980 11:15911981-15912003 AGCTTAGCTGTGTCCTCCCAAGG - Intergenic
1080140750 11:28917009-28917031 AACACACCTGGGGCCTGCCAAGG + Intergenic
1080778028 11:35404349-35404371 AACCCCGCTGATGACTCCCAGGG + Intronic
1081284396 11:41249473-41249495 AACTCACCTGTGCCCTCCTAAGG + Intronic
1081303529 11:41483585-41483607 AATTCAACTGTGGCCTCTCAAGG + Intergenic
1081419301 11:42853848-42853870 CACCCCCCTCTGGCCTCCCAAGG + Intergenic
1083278078 11:61608799-61608821 AGCCCAGCTCTGCTCTCCCAGGG + Intergenic
1083648486 11:64186501-64186523 ACCCAAGCTGTGGCCTCCGCCGG - Intronic
1083820741 11:65170075-65170097 CACCCAGCTGTGGCTCCCCAGGG - Intergenic
1084030144 11:66476309-66476331 CCCCCAACTGTGGCCCCCCAAGG + Exonic
1084101626 11:66953451-66953473 ATACCAACTGTGGGCTCCCATGG - Intronic
1084857402 11:71997905-71997927 TCCCCAGCTGTGGCTTCCCATGG + Intergenic
1085531717 11:77195646-77195668 AGCTCAGCTGTGGGCTCCAAAGG - Intronic
1088802219 11:113316620-113316642 AACCCAGCTGTTCCCTTCAAGGG + Intronic
1089396682 11:118140703-118140725 AAGGCAGATATGGCCTCCCAGGG - Intronic
1090275309 11:125414544-125414566 GGCCCAGGTGTGGCCTGCCAAGG - Intronic
1090349493 11:126098438-126098460 CAAACAGCTGTGGCCTCCAAAGG + Intergenic
1090609970 11:128462317-128462339 AACCCTGCTGAGACCTTCCAAGG - Exonic
1090859473 11:130640217-130640239 AGCTCACCTGAGGCCTCCCAAGG + Intergenic
1091147694 11:133294282-133294304 AACAGAGCAGTGGCCTCCCCTGG + Intronic
1091226857 11:133962421-133962443 AACCAAGCTGTGGCCTTCAGAGG - Intergenic
1091234165 11:134008628-134008650 CACCCAGCTGGGGCCATCCAGGG + Intergenic
1091255297 11:134178885-134178907 AGCCCAGCTGTGTCCAGCCAGGG - Exonic
1091541624 12:1467733-1467755 AAACAAGCTCTGGGCTCCCATGG - Intronic
1092526239 12:9311919-9311941 AGCCCAGCTGTGGGCTCTAATGG - Intergenic
1092541037 12:9419871-9419893 AGCCCAGCTGTGGGCTCTAATGG + Intergenic
1092997473 12:13963703-13963725 GACCCAGCTTTTGACTCCCATGG + Intronic
1093158832 12:15720769-15720791 GCCCCAGCTGTGGACTCCCTGGG + Intronic
1093941875 12:25064055-25064077 CCACCTGCTGTGGCCTCCCAAGG - Intronic
1094512008 12:31102615-31102637 AGCCCAGCTGTGGGCTCTAATGG - Intronic
1095511852 12:42959574-42959596 CATCTAGCTGTGTCCTCCCAGGG - Intergenic
1096480719 12:51939062-51939084 AACCAGGCTGGGGCTTCCCAAGG + Intergenic
1098009395 12:66034234-66034256 GACCCAGCACAGGCCTCCCAGGG + Intergenic
1098592257 12:72227919-72227941 ATGCAAGATGTGGCCTCCCATGG + Intronic
1100200858 12:92296535-92296557 AAGCCTTCTATGGCCTCCCAAGG + Intergenic
1103036277 12:117659379-117659401 AACCCAGAAGTTGCCTCTCATGG + Intronic
1103403884 12:120661249-120661271 AAGCCAGCAGTGGCCATCCATGG + Intronic
1103744894 12:123115879-123115901 AACCCAACTGTTCCCTCCCTTGG - Intronic
1104255757 12:127136133-127136155 GAGCCAGCTGAGGGCTCCCAAGG - Intergenic
1105443046 13:20431110-20431132 ATCACAGATGTGGCCTCCCGCGG - Intronic
1106950976 13:34883573-34883595 AACCCAGCTGTGGGAGGCCAGGG + Intergenic
1107874795 13:44780833-44780855 ACTGCAGCTGTGACCTCCCAGGG - Intergenic
1108290184 13:48951790-48951812 AACACAACTGTGGCTACCCAGGG - Intergenic
1108502815 13:51083976-51083998 AACAGACCTGTGGCTTCCCAGGG - Intergenic
1108505847 13:51111521-51111543 CATCCAGCTGGGGCCTTCCACGG - Intergenic
1112258718 13:97858342-97858364 AACACAGCTGTGGCCACATATGG - Intergenic
1116460431 14:45166534-45166556 CCTCCAGCTTTGGCCTCCCAAGG - Intronic
1117620111 14:57576944-57576966 AACCCAGCTGTCTCCTCTCTTGG + Intronic
1118177006 14:63450475-63450497 AAACCAGCTTTGGTCTCCTAAGG - Intronic
1118181732 14:63500588-63500610 AAGCCCGCTGTGCCCACCCAGGG - Intronic
1118863383 14:69683212-69683234 ATCCCAGCTCTTGCTTCCCAGGG - Intronic
1121086991 14:91154194-91154216 AACCAAGCTGTGGCCAGGCATGG - Intronic
1122268274 14:100556808-100556830 AACCCAGCTGTCCCCTCACTAGG - Intronic
1124323956 15:28740315-28740337 GCGCCTGCTGTGGCCTCCCAAGG + Intergenic
1124624302 15:31299264-31299286 CACCAAGATGGGGCCTCCCAGGG + Intergenic
1125676213 15:41503805-41503827 AAACCAGCCCAGGCCTCCCAGGG - Exonic
1125780020 15:42256959-42256981 CTGCCTGCTGTGGCCTCCCAAGG + Intronic
1126185728 15:45829333-45829355 AACCCACCTATGGCCACCCATGG - Intergenic
1126526994 15:49667166-49667188 AATCCAGCAGTGGCTTCCCAAGG + Intergenic
1126782507 15:52150681-52150703 AACCCAGCTGTGGCCTCCCATGG + Intronic
1126911299 15:53419761-53419783 ACCTCATCTGTGGACTCCCAAGG - Intergenic
1127260531 15:57323608-57323630 AACTCAGCAATGGGCTCCCAGGG + Intergenic
1127559524 15:60122066-60122088 GAGTCAGCTGTGGCCTCCCAAGG - Intergenic
1129656774 15:77529790-77529812 AACCTAGCTGTAGGCTTCCATGG + Intergenic
1129809297 15:78494814-78494836 CCTCCCGCTGTGGCCTCCCAGGG + Intronic
1131061161 15:89405577-89405599 TACCCAGCAGTGCCCGCCCAGGG + Intergenic
1131742276 15:95406195-95406217 AAACCAGCTGTGGCCAGACACGG + Intergenic
1132167204 15:99605724-99605746 CACCCACCTTTGGCCTCCCAAGG - Intronic
1132418452 15:101642685-101642707 ACCCCAGCTGTGGCCAGTCACGG + Intronic
1132863201 16:2081527-2081549 TACCCATCTCTGGCCCCCCAGGG - Intronic
1133760033 16:8791224-8791246 ATTCCTGCTGTGGTCTCCCATGG - Intronic
1133918406 16:10130204-10130226 AACCCTGCCGTGGAGTCCCAGGG - Intronic
1135994576 16:27238389-27238411 TTCCCAGCTCTGTCCTCCCATGG + Intronic
1136096448 16:27960516-27960538 CACTCAGCTGTGTTCTCCCAAGG - Intronic
1136372464 16:29844915-29844937 TTCCCAGCAGTGGCCTGCCATGG - Intronic
1138085682 16:54131862-54131884 AACCCATCTGTAGCTTCCCCAGG - Intergenic
1138526735 16:57612784-57612806 AACCCTGCAGAAGCCTCCCAGGG - Intronic
1141324433 16:83042471-83042493 AAACAAGCTGAGGGCTCCCATGG + Intronic
1142450513 16:90170848-90170870 GACCCCGCTGTTGCCTCCCAGGG - Intergenic
1142457049 17:62843-62865 GACCCCGCTGTTGCCTCCCAGGG + Intergenic
1143294147 17:5857948-5857970 AACCCAGGTCTGGCCTCCACAGG + Intronic
1143294401 17:5859896-5859918 AGCCCAGTTCTGGCCTCCCCAGG + Intronic
1143884993 17:10058648-10058670 AACAGAGCTGTGGCCTGCTATGG + Intronic
1144452327 17:15391356-15391378 AGGCCAGCTGGGGCCTCCCCTGG - Intergenic
1144737891 17:17565034-17565056 AAACCAGCTGTTGTCTCGCAAGG - Intronic
1145255288 17:21318849-21318871 CTCCCTGCTGTGTCCTCCCATGG - Intergenic
1145321323 17:21769106-21769128 CTCCCTGCTGTGTCCTCCCATGG + Intergenic
1146000313 17:29126719-29126741 GACCCTGCTGAGGCCTCCCAGGG - Intronic
1146623540 17:34418955-34418977 CATACAGCTGTGGACTCCCAAGG - Intergenic
1147701738 17:42400450-42400472 AGCCAAGCTATGGCATCCCAGGG + Intergenic
1148834861 17:50460709-50460731 AACGTAGCTGAGGCCTCCGATGG - Exonic
1148966498 17:51440350-51440372 AACCCAGCTGTCACGTCACAGGG - Intergenic
1149558697 17:57592953-57592975 AACTCAGCCATGGCCTGCCATGG + Intronic
1151239779 17:72748843-72748865 AACCCAGGTGTGGACGACCATGG - Intronic
1151599890 17:75099802-75099824 ACCCCAGATCTGCCCTCCCAAGG - Intronic
1151877884 17:76877591-76877613 GAGCCTGGTGTGGCCTCCCACGG + Intronic
1152590172 17:81207798-81207820 GGCGCAGCTGTGGCCTCCCATGG - Intronic
1152600182 17:81258408-81258430 AAACCAGATGTGGCCTCGGAGGG + Intronic
1152876016 17:82786582-82786604 GAGCCAGCTGTGGCTGCCCAGGG + Intronic
1153466219 18:5390599-5390621 AACCCAGGTGTGTCTACCCATGG + Intergenic
1154106362 18:11527256-11527278 ATCCCAGCTGTGCCCTCCCCAGG + Intergenic
1154323599 18:13374288-13374310 GACCCAGCTCTGGCCTCCACAGG - Intronic
1154910432 18:20641647-20641669 AACCCAGCCCTTGCATCCCAGGG - Intergenic
1155617027 18:27734236-27734258 AGGCCAACTGTAGCCTCCCAGGG - Intergenic
1157039979 18:44027467-44027489 ATACCAGCAGTGGTCTCCCAAGG + Intergenic
1157223363 18:45842282-45842304 CACCCAGCTGGGGGCTGCCAAGG - Exonic
1157569095 18:48700403-48700425 CAGCCAGCTGTGACCTACCAGGG + Intronic
1160389462 18:78519037-78519059 AAGCCACCTGTGGACCCCCAGGG - Intergenic
1160646962 19:198202-198224 GACCCCGCTGTTGCCTCCCAGGG + Intergenic
1160992414 19:1865102-1865124 AAGCCAGCTGAGCCCTCCCTGGG + Intergenic
1161050299 19:2160282-2160304 CACCCTGCTTTGGTCTCCCAAGG - Intronic
1163403114 19:17106460-17106482 AACCCAGCTCTGGTCTCCCGAGG + Intronic
1163476919 19:17532063-17532085 TTCCCAGCTGTGCCCACCCAGGG + Intronic
1166586685 19:43955199-43955221 GACCCATCTGTAGCCTCCCAGGG + Intronic
1166747486 19:45148262-45148284 AAACCAGCAGTGGCTTCCTAAGG - Intronic
1167493056 19:49802778-49802800 CATCCAGCAGTGGCCTCCAATGG - Intronic
1168050949 19:53829470-53829492 ACCTCAGATGTGGCCTCCCACGG - Intergenic
925814962 2:7738425-7738447 AAACCAGCTGTGAACTCCAAAGG + Intergenic
926061347 2:9807010-9807032 AGACTAACTGTGGCCTCCCATGG - Intergenic
926222806 2:10947478-10947500 AGCTGAGCTGTGGTCTCCCATGG + Intergenic
927019344 2:19000826-19000848 CACACAGCTGTGGACTCTCAAGG - Intergenic
927960918 2:27240275-27240297 GACCCCGCCGTGGCATCCCAGGG + Exonic
928086686 2:28350448-28350470 AACTCCACGGTGGCCTCCCAGGG - Intergenic
929666687 2:43838991-43839013 GACCCAGCTGCTGCCTGCCAGGG - Exonic
930021337 2:47003845-47003867 TCCCCAGCTCTGGCCACCCAGGG - Intronic
930116027 2:47718834-47718856 CACCCAGCTGAGCCCTCCGAAGG - Intronic
930444690 2:51455486-51455508 AACCCAGCAGTGGCTTTCCATGG - Intergenic
930916793 2:56701371-56701393 AATCCTTCAGTGGCCTCCCATGG + Intergenic
931236459 2:60417095-60417117 AAGCCAGCTTTGGCCTTCCCAGG + Intergenic
931693593 2:64855705-64855727 AAGCCAGATGTGGCCGGCCATGG + Intergenic
932258363 2:70305963-70305985 AACCCAGCTATGGCCAACCTTGG + Intergenic
933178547 2:79203892-79203914 ATGCCAGCTGTTGCTTCCCATGG + Intronic
933259610 2:80117614-80117636 AAGCCAGCTGTGACTTCACAGGG - Intronic
935139678 2:100342176-100342198 ACCCCAACTGTGCCCTTCCATGG + Intergenic
935141320 2:100355354-100355376 ACACCTGCTTTGGCCTCCCAAGG - Intergenic
935236879 2:101146519-101146541 CACCCAGCTGTGTCCTCTGAAGG - Intronic
936730137 2:115373055-115373077 AACCCTCCTGTGGCTTCCAAGGG - Intronic
937476143 2:122217091-122217113 ACTCTTGCTGTGGCCTCCCATGG - Intergenic
938540421 2:132280259-132280281 GCCCCAGTTGTGGCCACCCATGG - Intergenic
938932878 2:136102128-136102150 AACCCAACTGAGAGCTCCCAAGG - Intergenic
941784092 2:169479324-169479346 AGCCCAGCTGTGTCCGCCAAGGG - Exonic
946410422 2:219512802-219512824 AGCCCAGCTGTGGGGTCCCTGGG + Intergenic
947401381 2:229734683-229734705 AACCCATCTGTCTCCTCCCGTGG - Intergenic
947860386 2:233354070-233354092 ATCCCAGCTCTGGCGTCCCGAGG + Intergenic
948205692 2:236161742-236161764 TGCCCAGCCGTGGCTTCCCAGGG - Intergenic
948652914 2:239459736-239459758 AACCGTGCTGTGGCCAGCCAAGG + Intergenic
1168924115 20:1565810-1565832 GTCCCAGCAGTGGCCTCCAAGGG + Intronic
1170800250 20:19584589-19584611 CCGCCTGCTGTGGCCTCCCATGG + Intronic
1171869346 20:30513264-30513286 GCCCCAGTTGTGGCCGCCCATGG - Intergenic
1172032940 20:31994467-31994489 CATCCTGCTTTGGCCTCCCAGGG - Intronic
1173335367 20:42108228-42108250 AACACAGCTTTGTCCTCACAAGG - Intronic
1175610223 20:60345070-60345092 CACCCAGCTGAAGCCTCCCTGGG + Intergenic
1175773201 20:61636628-61636650 AGCCCAGCTGTGGCCTAGGATGG + Intronic
1176169559 20:63690752-63690774 ACCCCAGCTGGGGCCCCCCGTGG + Intronic
1176215414 20:63945486-63945508 GACCCAGCTGTGGCATGCCTGGG + Intronic
1177094074 21:16809400-16809422 CATCTAGCTGTGTCCTCCCATGG - Intergenic
1179247260 21:39644837-39644859 ACCCCAGCACTGGCCTCCCCAGG + Intronic
1179365551 21:40755601-40755623 CACTCTGCTGTGGCCTCTCAGGG - Intronic
1179372150 21:40816335-40816357 CAGCCTGCTTTGGCCTCCCAAGG - Intronic
1180005183 21:45017532-45017554 AACCCATCAGAGCCCTCCCAGGG + Intergenic
1180207577 21:46271306-46271328 AACCCAGGTGTGGTGGCCCATGG - Intronic
1181469865 22:23131711-23131733 AACCCAGCACTGGTCCCCCATGG + Intronic
1181922400 22:26330623-26330645 GACCCAGCTGTGGACTTCCTGGG + Intronic
1182522712 22:30893315-30893337 AAGCCAGCTGGGGGCTTCCAAGG + Intronic
1183075276 22:35422885-35422907 AGTCCTGCTGTGGCCTCCAAGGG + Intronic
1183191739 22:36326023-36326045 AACCCAGCAGTGTCCTCGCTAGG - Intronic
1184659612 22:45959881-45959903 AACCCAGCTGGAGCCTGCCCGGG + Intronic
1184710254 22:46245451-46245473 ATCCCAGCTGTTCCCACCCAGGG - Intronic
949268094 3:2184227-2184249 CCACCAGCTTTGGCCTCCCAAGG + Intronic
951611450 3:24495508-24495530 ATCCCGGCCGTGCCCTCCCAGGG + Intergenic
952793447 3:37218299-37218321 GGCCCAGCTGCAGCCTCCCAGGG + Intergenic
953309650 3:41864173-41864195 AACTCAGCTGATGCCTGCCATGG - Intronic
953335526 3:42091002-42091024 AATGCATCTGTGGCCTCCCAGGG + Intronic
953387798 3:42516486-42516508 AGGCCAAGTGTGGCCTCCCAAGG + Intronic
953722463 3:45368537-45368559 AACCCAGCTGATGCCTGCCAAGG + Intergenic
953923739 3:46969679-46969701 TGCCCAGCTTTGGGCTCCCAAGG + Intronic
954280258 3:49572301-49572323 AACCCAGGTTTGGGCTCCCTAGG + Intronic
954967428 3:54623915-54623937 AAACCAGCTCTTGTCTCCCAGGG - Intronic
955522754 3:59791195-59791217 AATCCAGATCTGGCCTCTCAGGG + Intronic
956499887 3:69870951-69870973 AAACCAGCTGTAGTATCCCAGGG + Intronic
957913769 3:86659069-86659091 AACCCTGCACTGACCTCCCAGGG - Intergenic
962170484 3:133096399-133096421 AATCCTGCCTTGGCCTCCCAAGG + Intronic
963790579 3:149578444-149578466 AAGGCAGCTCTGGCCTTCCAAGG + Intronic
964445145 3:156750609-156750631 AACCCAGCTGAGGCTTGCCCAGG - Intergenic
964812203 3:160677807-160677829 AACCCTGCTGTGCCCTCACAGGG + Exonic
966164610 3:177003669-177003691 CCTCCTGCTGTGGCCTCCCAAGG - Intergenic
966890328 3:184402916-184402938 CTGCCCGCTGTGGCCTCCCAAGG + Intronic
968370720 3:198221321-198221343 GACCCCGCTGTTGCCTCCCAGGG - Intergenic
968648771 4:1752278-1752300 CGGCCAGGTGTGGCCTCCCAGGG - Intergenic
968816054 4:2822596-2822618 AAGTCAGCTGTGGCCTCCCTGGG + Intronic
968991707 4:3917746-3917768 TGCCCAGCTGTGGTCACCCAGGG + Intergenic
969259414 4:6024044-6024066 CATCCAGGGGTGGCCTCCCAAGG + Intergenic
970299802 4:14669327-14669349 CACCAAGCTGTAGCCTCTCAGGG - Intergenic
970354075 4:15235160-15235182 AACCCATCAGTGGCTGCCCAGGG - Intergenic
973134916 4:46695434-46695456 AAACAAGCTCAGGCCTCCCACGG - Intergenic
976579321 4:86717054-86717076 AATCCAGCAGTGGTCTCCCAGGG + Exonic
979818509 4:125141123-125141145 AGCCCAGCTCTGTCCTACCAGGG + Intergenic
984068622 4:175082469-175082491 AACTCACCTGGTGCCTCCCACGG - Intergenic
984599928 4:181714190-181714212 CCCCCTGCTTTGGCCTCCCAAGG - Intergenic
986020727 5:3799505-3799527 AAGGCAGCTGTGACCTCTCAGGG + Intergenic
990950092 5:61289992-61290014 AAGCCAGCTGTGGTATCCCATGG - Intergenic
992147688 5:73868622-73868644 ACCCCATCTGTTGCCTCCTAGGG + Intronic
993006937 5:82438756-82438778 AACCCAAGTGTGGCCTGCCTAGG + Intergenic
993120326 5:83766483-83766505 AACACTGCTCTGGCATCCCAAGG - Intergenic
993166414 5:84360015-84360037 ATCCTAGGTGTGACCTCCCAGGG - Intronic
993372483 5:87109893-87109915 TGCCCTGCTGTGTCCTCCCATGG + Intergenic
993425798 5:87762868-87762890 AAATCAGATGAGGCCTCCCAGGG - Intergenic
995742521 5:115369517-115369539 AGCCCAGCTGCAGCCTCACAGGG + Intergenic
998160373 5:139809627-139809649 GACCCAGATGTGGCCTTCCATGG + Exonic
998568975 5:143240069-143240091 AACCCAGCTGTTGATTCACAGGG - Intergenic
1002729953 5:181326876-181326898 GACCCCGCTGTTGCCTCCCAGGG - Intergenic
1002777634 6:342358-342380 CACGCTGCTGTGGCCCCCCAAGG - Intronic
1002777815 6:343442-343464 CACGCTGCTGTGGCCCCCCAAGG + Intronic
1006412312 6:33881426-33881448 TCAACAGCTGTGGCCTCCCATGG - Intergenic
1007128681 6:39449237-39449259 AACTCTCCTGTGGCTTCCCATGG + Intronic
1007241644 6:40430912-40430934 GACCCAGCAGAGGTCTCCCAGGG + Intronic
1012169867 6:96003315-96003337 CTCCCAGATGTGGGCTCCCAGGG + Intergenic
1013864356 6:114677170-114677192 AAAACAACTGTGGCCTCTCAAGG + Intergenic
1019547495 7:1585542-1585564 AAACGAGGTGTGGCCTCCCAAGG - Intergenic
1019556447 7:1633849-1633871 GACTCACCTGTGGCCTCCCAGGG - Intergenic
1019609286 7:1928807-1928829 AAGCCAGCTGTGCCCTCCCACGG - Intronic
1022104705 7:27189519-27189541 CACCCAGCTGTATCCTCCCTTGG - Intergenic
1023401120 7:39793418-39793440 GGCCCTGCTGTTGCCTCCCAGGG - Intergenic
1024074624 7:45812150-45812172 GGCCCCGCTGTTGCCTCCCAGGG - Intergenic
1024426214 7:49229417-49229439 TACCTAGCTGTGGTCTCTCAAGG - Intergenic
1024556705 7:50610001-50610023 AACCCAGCTCTGCCTTTCCATGG + Intronic
1024648493 7:51387263-51387285 GGCCCTGCTGTTGCCTCCCAGGG + Intergenic
1025052343 7:55741732-55741754 GGCCCCGCTGTTGCCTCCCAGGG + Intergenic
1025052736 7:55743280-55743302 GGCCCCGCTGTTGCCTCCCAGGG + Intergenic
1025129297 7:56367415-56367437 AGCCCCGCTGTGGCCTCCCAGGG + Intergenic
1025130016 7:56370266-56370288 GGCCCCGCTGTTGCCTCCCAGGG + Intergenic
1025130322 7:56371516-56371538 GGCCCCGCTGTTGCCTCCCAGGG + Intergenic
1025130642 7:56372814-56372836 GGCCCCGCTGTTGCCTCCCAGGG + Intergenic
1025130958 7:56374108-56374130 GGCCCCGCTGTTGCCTCCCAGGG + Intergenic
1025185602 7:56855948-56855970 GCCCCAGCGATGGCCTCCCAGGG + Intergenic
1025686327 7:63721002-63721024 GCCCCAGCAATGGCCTCCCAGGG - Intergenic
1026125347 7:67574692-67574714 AACCCACATGTGGTCTCCCAAGG + Intergenic
1026470678 7:70692486-70692508 TACCCAGCTGTGGTCCTCCAGGG - Intronic
1026582071 7:71626884-71626906 CACCCAGCTTTGGCCACCCATGG - Intronic
1027296699 7:76780898-76780920 TGCCCAGCTGTGTCCTCACATGG - Intergenic
1032051623 7:128653800-128653822 GACCCCGCTGTTGCCTCCCAGGG - Intergenic
1033262683 7:139857195-139857217 AGCCCAGATGTAGCATCCCACGG - Intronic
1034091489 7:148368371-148368393 CTCCCAGCTGAGGCCTCCCCTGG + Intronic
1034222151 7:149455146-149455168 ATCCCAACTGGGGCTTCCCAAGG - Intronic
1034349485 7:150406829-150406851 AACCAGGGTGTGGGCTCCCAGGG - Intronic
1035758084 8:2049164-2049186 AACACGGCTGGGCCCTCCCAGGG + Intronic
1036286058 8:7445057-7445079 AACACACCCGTGGCATCCCATGG + Intronic
1036335415 8:7866472-7866494 AACACACCCGTGGCATCCCATGG - Intronic
1036606289 8:10308517-10308539 AAACCAGCTGTGGCCCCCTCTGG + Intronic
1037937974 8:22927964-22927986 AACAAAGCTGTGTCCTGCCAGGG - Intronic
1038869732 8:31481152-31481174 AACCAAGCTGTGGCCGGGCACGG + Intergenic
1040551100 8:48438309-48438331 AACCCAGCTGTGGCATACACAGG - Intergenic
1042148694 8:65758846-65758868 ATCCCATCTGTAGCCCCCCAGGG + Intronic
1042411406 8:68470732-68470754 ATCCTAGCTGTGTCCTCACATGG + Intronic
1042487215 8:69359947-69359969 TACCCAGCTGTGGCCACTCCAGG + Intergenic
1042855239 8:73260609-73260631 ATCCCTGCTGTGTGCTCCCACGG - Intergenic
1043912128 8:85875394-85875416 AGCACAGCTGTCCCCTCCCAAGG + Intergenic
1044731143 8:95229518-95229540 ATCCCAGGTCAGGCCTCCCAGGG + Intergenic
1047523771 8:125615516-125615538 CATCCAGCTGTGCCCTGCCAGGG + Intergenic
1048210179 8:132448348-132448370 AAACCAGCTGAGGCGTCCCAGGG - Intronic
1048317320 8:133371790-133371812 AGCTCAGCTCTGGCTTCCCAGGG + Intergenic
1048875526 8:138834225-138834247 AACTCACCTGTGCCCCCCCAGGG + Intronic
1049225583 8:141449074-141449096 AACACAGCTGTGGCCTCATCAGG + Intergenic
1049594112 8:143475661-143475683 AGCCCAGGCCTGGCCTCCCAAGG + Intronic
1049658532 8:143809472-143809494 ATCCCAGCTGAGGCCCCGCAGGG + Intronic
1050589381 9:7146933-7146955 ATCCCAAAGGTGGCCTCCCAAGG + Intergenic
1053412868 9:37926981-37927003 GACTAACCTGTGGCCTCCCAAGG + Intronic
1053432052 9:38048845-38048867 AACCCAGTGGTGCCCTCCTAGGG - Intronic
1054862096 9:69964581-69964603 CAGACAGCTGTGTCCTCCCATGG - Intergenic
1056065192 9:82926148-82926170 CCACCCGCTGTGGCCTCCCAAGG - Intergenic
1057903530 9:98967322-98967344 AACAGAGCTGTGGCTCCCCAGGG - Intronic
1059465804 9:114468081-114468103 CACACAGCTGTGCCCTCCCCTGG - Intronic
1059647892 9:116285558-116285580 AGCCCAGGTGTTGCCTCCTAAGG + Intronic
1060521942 9:124298943-124298965 AGCTCACCTGTGGCCTCACATGG - Intronic
1060618802 9:125044272-125044294 GGCCCATCCGTGGCCTCCCATGG + Intronic
1062021051 9:134319596-134319618 CACCCTGCTGGGGCCTCCCATGG - Intronic
1062149377 9:135009758-135009780 ATCCAATCTGTGGCCTCCCTGGG - Intergenic
1062308060 9:135920702-135920724 ACCCCTGCTGGGTCCTCCCAGGG - Intergenic
1062496219 9:136833036-136833058 GACCCAGCTGGGGCAGCCCAGGG - Intronic
1062496282 9:136833208-136833230 GACCCAGCTGGGGCAGCCCAGGG - Intronic
1062496298 9:136833252-136833274 GACCCAGCTGGGGCAGCCCAGGG - Intronic
1062496362 9:136833427-136833449 GACCCAGCTGGGGCAGCCCAGGG - Intronic
1062496410 9:136833559-136833581 GACCCAGCTGGGGCAGCCCAGGG - Intronic
1062496425 9:136833602-136833624 GACCCAGCTGGGGCAGCCCAGGG - Intronic
1062754368 9:138279390-138279412 GACCCCGCTGTTGCCTCCCAGGG - Intergenic
1203578272 Un_KI270745v1:23550-23572 GACCCCGCTGTTGCCTCCCAGGG - Intergenic
1189510432 X:41656330-41656352 AACCCATCTGTGGCCTCCCAGGG - Intronic
1189516248 X:41715922-41715944 AACCCATTTGTGGCCTCCCAGGG - Intronic
1190116008 X:47626772-47626794 AACACAGCTGTGCCCTGCCCTGG - Exonic
1193501044 X:82275504-82275526 ATGCCAGATGTGGGCTCCCATGG + Intergenic
1195440945 X:104897055-104897077 AACGAAGCTGTGGACTCTCATGG - Intronic
1198522195 X:137464476-137464498 AGCCCAGCAGTGGCCCCTCAGGG + Intergenic
1199265060 X:145818980-145819002 AAAGCAGCTGTGGACTCTCAAGG + Exonic
1199719442 X:150531753-150531775 AACCCAGCAGGGGCAGCCCAGGG + Intergenic
1200962952 Y:9011737-9011759 GAGCCAGCAGTGGCCACCCACGG - Intergenic
1202073184 Y:21013874-21013896 AACCCACCTGTACCCTCACATGG + Intergenic
1202077884 Y:21055728-21055750 AACCCACCTGTACCCTCACATGG + Intergenic
1202353236 Y:24017287-24017309 AAACCAGAAGTGGCCACCCAAGG + Intergenic
1202517543 Y:25652828-25652850 AAACCAGAAGTGGCCACCCAAGG - Intergenic