ID: 1126782585

View in Genome Browser
Species Human (GRCh38)
Location 15:52151205-52151227
Sequence GGGGCCACACACCTGTATCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 86}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126782581_1126782585 -1 Left 1126782581 15:52151183-52151205 CCTTTAGCGCAGAAACTGGAGTG 0: 1
1: 0
2: 0
3: 4
4: 74
Right 1126782585 15:52151205-52151227 GGGGCCACACACCTGTATCGTGG 0: 1
1: 0
2: 0
3: 2
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126782585 Original CRISPR GGGGCCACACACCTGTATCG TGG Intronic
903443882 1:23408369-23408391 GGAGCCACACCCCTGATTCGGGG + Intronic
904910923 1:33933680-33933702 TAGGCCACACACCTGTGTAGGGG + Intronic
914909627 1:151774061-151774083 GGGGAGACACACTTGTAGCGTGG + Exonic
1063692722 10:8302710-8302732 AGGGCCACACACCTGGAGAGGGG - Intergenic
1067790916 10:49287057-49287079 GCGGCCACCCACCTGTGTCTTGG + Intergenic
1073044314 10:100627741-100627763 GGCCCCACACACCTGTAACTGGG + Intergenic
1077395756 11:2320369-2320391 GGGGCCACACCCCCCTATGGAGG - Intergenic
1083955345 11:65979707-65979729 GGGGCCAGGCACCAGTATCCTGG - Exonic
1084014680 11:66371551-66371573 GGGCCCACTCACCTGTCCCGCGG + Exonic
1084365268 11:68693483-68693505 GAGGCCGCACACCTGCATGGAGG - Intergenic
1089465126 11:118679936-118679958 GAGGCCACACACCTGTAACCTGG + Intergenic
1092700922 12:11229941-11229963 AGGGCCACACACCTGTTTATAGG + Intergenic
1096366134 12:51029935-51029957 GGGGGCACACAACTGTATGTGGG - Intergenic
1104448860 12:128853608-128853630 GCGGCCACACACCGGCAACGCGG + Exonic
1113555405 13:111230043-111230065 GGGGAGACACACCTGTCTCCAGG - Intronic
1113952300 13:114078890-114078912 GGAGCCACACCCCTGTACCCAGG + Intronic
1119655333 14:76413335-76413357 CCGGCCACACACCTGTGTCCCGG + Intronic
1120680665 14:87477358-87477380 CAGGCCACAAACCAGTATCGAGG - Intergenic
1121661165 14:95636124-95636146 GGAGCCACACTCCTGTGTCCTGG - Intergenic
1121839789 14:97123838-97123860 GGGGCCGCATTCCTGTTTCGAGG + Intergenic
1121974603 14:98391273-98391295 GGGGCCACAAAGCTGTGTCTAGG - Intergenic
1126782585 15:52151205-52151227 GGGGCCACACACCTGTATCGTGG + Intronic
1129310912 15:74708391-74708413 GGGGCCACACACCTGAGGCAGGG - Intergenic
1132694720 16:1196792-1196814 CGGGCCACCCACCTGCATCAGGG + Intronic
1134348182 16:13411330-13411352 AGGACCACACACCTGGATAGTGG - Intergenic
1135413387 16:22251312-22251334 GGGGCCACGCACCTGCTTGGGGG - Exonic
1139201701 16:64984163-64984185 GGGGCCACACAAATCTATCTGGG - Intronic
1141162095 16:81636125-81636147 TGGCCCGCACACCTGTATCATGG - Intronic
1142537832 17:632120-632142 GGGGGCACACACCTGTACTCGGG + Intronic
1145912181 17:28549200-28549222 GGGGCCACACAGCTCTGTCTTGG + Intronic
1147541351 17:41362700-41362722 GGGGCCAGGCACCAGTACCGTGG + Intergenic
1151785464 17:76272867-76272889 GGGGCCAGAAACCTGTTTCTGGG + Intergenic
1157131544 18:45012278-45012300 GGGGACAAAAACCTGTATTGTGG + Intronic
1160856429 19:1220011-1220033 GAGGCCACAGACCTGCATCCAGG - Intronic
1161045160 19:2130667-2130689 GGGGCCACAGACCAGCATCTTGG + Intronic
1162828696 19:13270553-13270575 GAGGCCAGAAACCTGTAACGGGG + Intronic
1163306462 19:16482666-16482688 GAGGCCACACACCTGGTACGGGG + Exonic
1164130070 19:22353878-22353900 GGGCCCAGATACCTGTATCCTGG - Intergenic
1164754383 19:30679136-30679158 GAGGCCACACAGCTGCATGGAGG + Intronic
1166699686 19:44874959-44874981 AGGGCCACACACCTAGAGCGCGG + Intronic
926153729 2:10439030-10439052 GGGGCCACTCACGTGTAGCACGG + Intergenic
926241681 2:11093693-11093715 GGGGCCTCACACTTGCATCCTGG + Intergenic
927689098 2:25194913-25194935 GGGGTCACACAGCAGCATCGTGG - Intergenic
931399993 2:61922818-61922840 GGGGACACACATCTGTTTGGAGG + Intronic
935945305 2:108280762-108280784 GTGGCCACACACCTCGATGGTGG + Intergenic
937298534 2:120824378-120824400 GGGCCCACACCCCTGTAAGGGGG - Intronic
937532611 2:122847036-122847058 GGTGGCACACACCTGTAACTTGG + Intergenic
940830836 2:158463567-158463589 TGGGACACACACCTGCATAGTGG - Intronic
948585720 2:239018441-239018463 GGGGCCTCACACCTGCAGCCGGG - Intergenic
1171558297 20:26097573-26097595 GGGGTCACACAGCTGTGTAGTGG - Intergenic
1175588003 20:60161210-60161232 GGCTCCACACACCTGTGTGGTGG - Intergenic
1175841431 20:62030111-62030133 GTGGCCGCACACCCCTATCGGGG - Intronic
1178249158 21:30985466-30985488 GGGGCCAAAATCCTGTTTCGTGG - Intergenic
1180285508 22:10741697-10741719 GGGGCCGCACACCCGGCTCGGGG + Intergenic
1181567899 22:23750969-23750991 GGGGCCACTCACCTGGGCCGGGG + Exonic
1184283019 22:43449653-43449675 AGGGCCACACACATGCATCAGGG + Intronic
1185066949 22:48637136-48637158 GGGTACAGACACCTGTATGGTGG + Intronic
949860999 3:8504621-8504643 GGGGCCACATACATACATCGTGG + Intronic
960058546 3:113295217-113295239 GTGGCCACACATCTGTATAATGG + Intronic
965048059 3:163604535-163604557 GGTGGCACACACCTGTATTTGGG + Intergenic
968553312 4:1235242-1235264 GTGGCCACACTCCTTTATCCCGG - Intronic
969705959 4:8791766-8791788 GGGACCACACACCTTTCTCGTGG - Intergenic
970134057 4:12902920-12902942 GTGGCCACACACATGTATGATGG + Intergenic
970794694 4:19897405-19897427 GGGAACACACACCTGTAATGGGG - Intergenic
975697808 4:77030978-77031000 GGTGTCACCCCCCTGTATCGGGG + Intronic
994305660 5:98201078-98201100 GGGGCCTGACACCTGTGTAGGGG + Intergenic
1000155790 5:158550168-158550190 CAGGCCACTCACCTGTATCCTGG + Intergenic
1004223198 6:13764610-13764632 GGTGGCACACACCTGTACTGAGG - Intergenic
1006987138 6:38183424-38183446 GGGGCCACACAGCTGGCTGGAGG + Intronic
1007035185 6:38666745-38666767 GGGCCCAGACACCTGTATTTAGG + Intergenic
1011820593 6:91248658-91248680 GGGGACACACACCTGAAGAGTGG - Intergenic
1018664143 6:166118946-166118968 AGGGCAATACATCTGTATCGTGG + Intergenic
1019088401 6:169502598-169502620 GGGGCCACAGCCCCGGATCGGGG - Intronic
1021147585 7:17107737-17107759 GGTGCCACTCACCTGTTTTGGGG + Intergenic
1023728777 7:43170387-43170409 GGGACCACGGACCTGTTTCGTGG - Intronic
1034417965 7:150975107-150975129 CCGGCCAGGCACCTGTATCGGGG - Intronic
1037710931 8:21355021-21355043 GGCCCCACACACCTGTCTGGAGG + Intergenic
1042751223 8:72160060-72160082 GCGGCCACAAAGCTGTATCTTGG - Intergenic
1048899566 8:139024413-139024435 GGGGACACACACTTATATGGGGG + Intergenic
1052971767 9:34381044-34381066 GGGTCCACGCACCCGCATCGGGG + Exonic
1053011394 9:34635790-34635812 GGGGCCAAACACATGGATGGTGG - Exonic
1057523970 9:95783660-95783682 GTGGCCACCCACCTGTGACGGGG + Intergenic
1059940078 9:119350160-119350182 GGGGACACACACCAGCATCTGGG + Intronic
1062343743 9:136105290-136105312 GGGGCCACACCCCTGTCCCCAGG + Intergenic
1062531113 9:137000852-137000874 GGAGACACACACCTGTTTGGGGG + Intergenic
1062540700 9:137040502-137040524 GGGGCCACACACCGAGATCCGGG + Exonic
1187296429 X:18005687-18005709 GGGGCCACACCTCTGGATGGCGG + Intergenic
1192312760 X:70030077-70030099 GTGGCCACACAGCTGTAGCAAGG - Intronic
1200841033 Y:7781995-7782017 GGGGCCACAGACTGGTATGGGGG + Intergenic