ID: 1126782867

View in Genome Browser
Species Human (GRCh38)
Location 15:52153312-52153334
Sequence GGTTGCCGACAGCTGGACTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 74}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126782867 Original CRISPR GGTTGCCGACAGCTGGACTA AGG (reversed) Intronic
900500011 1:2999763-2999785 GGCTGCCGGCAGCAGGACCAAGG + Intergenic
901923694 1:12552959-12552981 AGTTGCAGACAGCCGGACTGTGG - Intergenic
902931494 1:19734709-19734731 GGCAGACGGCAGCTGGACTAGGG - Intronic
905239205 1:36571490-36571512 GGTGGCGGACAGCTGGACTGAGG - Intergenic
905239314 1:36571866-36571888 GGTGGGGGACAGCTGGACTGGGG - Intergenic
905239339 1:36571950-36571972 GGTGGGGGACAGCTGGACTGGGG - Intergenic
905239354 1:36571991-36572013 GGTGGGGGACAGCTGGACCAGGG - Intergenic
905239380 1:36572074-36572096 GGTGGGGGACAGCTGGACTGGGG - Intergenic
909067770 1:70956638-70956660 TGGTGCCAACAACTGGACTATGG + Intronic
917615257 1:176737162-176737184 TGTTACCGACAGCTTGACTATGG - Intronic
918368755 1:183837706-183837728 GGTTGGGGACTGCTGAACTAAGG - Intronic
919667983 1:200310789-200310811 GGATGCAGAGAGCTGGGCTATGG - Intergenic
919931602 1:202224802-202224824 GGTTGGGGACCCCTGGACTAAGG + Intronic
920876125 1:209837559-209837581 GGTTGTCCACAGCTGTAATATGG - Intronic
921188769 1:212692017-212692039 GGTTGCTGGCAGTTGGACTACGG - Intronic
1073208101 10:101779344-101779366 GTTTGCCGACTGCTGGAGGAAGG - Intronic
1074744969 10:116523420-116523442 GGTTGCCTACAGATGGCCCAGGG - Intergenic
1075662584 10:124208412-124208434 AGTTGCCCACAGCTAGAATATGG + Intergenic
1077431057 11:2516176-2516198 GGTTGGCGAGAACTGGACTCCGG - Intronic
1086428281 11:86708875-86708897 TGTTGCCTACAGCTGGAATGTGG + Intergenic
1092322041 12:7486669-7486691 GTTTGCAGACAGCTGGGCTGTGG - Exonic
1092770586 12:11892839-11892861 GGGTGCAAACAGATGGACTATGG + Exonic
1093844804 12:23956614-23956636 GGTTGGGGACTGCTGCACTAAGG + Intergenic
1101917191 12:108904684-108904706 GGTTGGGGACACCTGGCCTAGGG + Intergenic
1110669250 13:78156952-78156974 GTTTGCTGACATCTGGTCTAGGG - Intergenic
1110831943 13:80041891-80041913 GGTTGCCTAGAGCTGGAGGAGGG - Intergenic
1119217884 14:72883108-72883130 GGTTGAGGACAGCAGGAGTAGGG + Intronic
1120076982 14:80169957-80169979 GGATGCCGAAAGCTGGAGCAAGG - Intergenic
1122803981 14:104247546-104247568 GGGTGCCGACTGCTGAACGAGGG + Intergenic
1126782867 15:52153312-52153334 GGTTGCCGACAGCTGGACTAAGG - Intronic
1127314833 15:57785149-57785171 GTTTGCCAACCCCTGGACTAGGG - Intergenic
1130137569 15:81194977-81194999 GCTTGCAGTGAGCTGGACTATGG + Intronic
1137454442 16:48607770-48607792 GATTGCAGACAGCTGGTCTAAGG - Intronic
1157260657 18:46173595-46173617 GGATGCCGATAGCTGGGCTCGGG - Intronic
1165501250 19:36191195-36191217 GTTTGCCGACCCCTGGTCTAGGG + Intronic
926428516 2:12762532-12762554 GGTTGGTGACAGCTGGACTCAGG - Intergenic
928716796 2:34070867-34070889 GGTTGGGGACCGCTGGCCTAGGG + Intergenic
942267376 2:174242142-174242164 GGTTGGCGGCTGCTGGTCTAAGG - Intronic
942401569 2:175608969-175608991 GGTTGCCCACAGCTGGCTGATGG - Intergenic
945049461 2:205809329-205809351 GGTGGCTGACAGGTGGAATAGGG + Intergenic
947634342 2:231672630-231672652 GGTGGCAGACAGCTGGGCCACGG + Intergenic
1175607724 20:60324617-60324639 GTTTGCCGACCCCTGGTCTAAGG - Intergenic
1175875417 20:62227287-62227309 GGTCCCCCACAGCTGGACTTGGG - Intergenic
1180928248 22:19570854-19570876 GGTGGCCTACAGTTGGAGTAAGG + Intergenic
1183516207 22:38268001-38268023 GGTGGCTGACAGCTGGAATTAGG - Intronic
1183729847 22:39612014-39612036 GGTTGCCAACACATGAACTATGG - Intronic
950914466 3:16629825-16629847 GGTTGCCAAAAGCTGGAGAAGGG + Intronic
953180169 3:40587649-40587671 GTTTGCCAACATCTGGTCTATGG + Intergenic
955304371 3:57815011-57815033 GGTTGGAGACTGCTGGATTAGGG - Intronic
957992468 3:87644775-87644797 GGTTCCCAACACCTGGACTGTGG + Intergenic
962497143 3:135952316-135952338 GGTTGCCTACAGCTGGAAGTGGG + Intergenic
963744828 3:149115561-149115583 GGTTGGAGACCGCTGGTCTATGG + Intergenic
964378324 3:156071366-156071388 GGTTGGGGACTGCTGGTCTATGG + Intronic
965948230 3:174268778-174268800 GATTACCGACAGCTGGACACGGG - Intronic
969641323 4:8400751-8400773 GGTTGCGGACTGCTGCCCTAAGG - Intronic
973547085 4:51992762-51992784 TGATGCCAACAGGTGGACTAGGG + Intergenic
977027051 4:91833075-91833097 GGTTGGGGACTGCTGGTCTAAGG - Intergenic
977585009 4:98765063-98765085 GGCTGCCTAGAGCTGTACTAGGG - Intergenic
978952071 4:114572763-114572785 GGTTGGGGACAGCTGGTGTATGG + Intergenic
980554328 4:134383417-134383439 GGTCGACTACAGCTGGACGATGG + Intergenic
984081493 4:175253925-175253947 GGTTGCAGACAGCAGGAAAAAGG + Intergenic
1002132650 5:177091011-177091033 GGTTGCCTGCAGCTGGACAGCGG - Exonic
1007004396 6:38346841-38346863 GGTTGCAGACAGCAGCACTCAGG - Intronic
1014539047 6:122651835-122651857 GGTTGCTGCCAACTGTACTATGG - Intronic
1017194087 6:151681760-151681782 GGTGGCCCACAGCTGGACGCGGG + Intronic
1018232961 6:161693403-161693425 GGTTGACTACAGGTGGACCAAGG + Intronic
1021560267 7:21962465-21962487 GGTTGGGGACTGCTGCACTAGGG - Intergenic
1029355450 7:100048464-100048486 GGTTGGGGACCGCTGAACTAAGG - Intergenic
1037544214 8:19902106-19902128 GTTTGCTTACAGCTGGATTAGGG - Intronic
1039237685 8:35520387-35520409 GGTTGCCAAGGGCTGGAATAAGG + Intronic
1041436782 8:57850518-57850540 GCTTGCCAACATCTGCACTAGGG - Intergenic
1043218045 8:77620833-77620855 GGGTGCCGACATCTAGACGAGGG + Intergenic
1049329267 8:142041400-142041422 GGTTGGGGACAGCTGCTCTAGGG - Intergenic
1058191856 9:101926819-101926841 GGTTGCCAAGAGCTGGGGTAAGG - Intergenic
1059303236 9:113332624-113332646 GGTTGGCAAGAGCTGGAATAAGG + Intronic
1185596883 X:1312655-1312677 GGTGGCTGACAGGTGGTCTAGGG + Intergenic
1188702054 X:33277248-33277270 GGTTGCCAACAGCTGGGTGAGGG + Intronic
1190979171 X:55440693-55440715 GGTTGCAGACTGATGGAGTAGGG - Intergenic
1197161760 X:123331494-123331516 TGTTGCCTACAGCTGGACCTAGG + Intronic
1198532519 X:137560240-137560262 GTTTGCCGACCCCTGGACTAGGG - Intergenic
1201383601 Y:13413653-13413675 GGGTGCTGGCAACTGGACTACGG - Intronic