ID: 1126783668

View in Genome Browser
Species Human (GRCh38)
Location 15:52159471-52159493
Sequence TCCTCTCCCTGGACATGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 276}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126783668_1126783672 -8 Left 1126783668 15:52159471-52159493 CCTTCCCATGTCCAGGGAGAGGA 0: 1
1: 0
2: 3
3: 28
4: 276
Right 1126783672 15:52159486-52159508 GGAGAGGACGCTTGCCTCTGTGG 0: 1
1: 0
2: 1
3: 13
4: 153
1126783668_1126783675 10 Left 1126783668 15:52159471-52159493 CCTTCCCATGTCCAGGGAGAGGA 0: 1
1: 0
2: 3
3: 28
4: 276
Right 1126783675 15:52159504-52159526 TGTGGCCTCCCTGCTCAGTTGGG 0: 1
1: 0
2: 0
3: 14
4: 179
1126783668_1126783674 9 Left 1126783668 15:52159471-52159493 CCTTCCCATGTCCAGGGAGAGGA 0: 1
1: 0
2: 3
3: 28
4: 276
Right 1126783674 15:52159503-52159525 CTGTGGCCTCCCTGCTCAGTTGG 0: 1
1: 0
2: 2
3: 28
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126783668 Original CRISPR TCCTCTCCCTGGACATGGGA AGG (reversed) Intronic
900749782 1:4388028-4388050 TCCTGACCCTGGACAAGGAATGG + Intergenic
902515645 1:16988085-16988107 TCCCCTCCCTAGTCCTGGGACGG + Intronic
902757039 1:18555832-18555854 TCATCTCCCAGGGCTTGGGAAGG - Intergenic
903340464 1:22651169-22651191 ACCTGGCCCTGGACATGGCAGGG + Intergenic
903808872 1:26023373-26023395 TCCTCTGCCTGCCCCTGGGATGG + Exonic
904378489 1:30096099-30096121 TCCACTCACTGCACAGGGGATGG - Intergenic
905642034 1:39596700-39596722 ACCTCTTCCTGGGCAGGGGAAGG + Intergenic
906295850 1:44648737-44648759 CCCTCTCCCTGGAGTTTGGACGG + Intronic
906523737 1:46482031-46482053 TCTTCTCCTTGAATATGGGATGG + Intergenic
906567681 1:46812481-46812503 GCCTCTCCCTGGGGAAGGGATGG - Exonic
907942443 1:59101963-59101985 TCCTCTCCCTTGAACTTGGATGG - Intergenic
908200931 1:61794526-61794548 TCCTGTCCCTTCCCATGGGAAGG + Intronic
909494346 1:76261728-76261750 TCCTCTCACTGGAGCTTGGATGG + Intronic
911763038 1:101638733-101638755 TACTTTCCCTGGACATTGCAAGG + Intergenic
912801113 1:112720247-112720269 TCATCTCTCTGGCCTTGGGAGGG - Intergenic
914884366 1:151573277-151573299 TCCTCTCCCTGGACACACAAAGG + Intronic
915936498 1:160092930-160092952 GCCTCTCCCTGTACATGTGCGGG - Exonic
917500869 1:175583727-175583749 TCCTCTGACTGTACATGGGCAGG + Intronic
917653897 1:177106853-177106875 TCTTTTTCCTGGACTTGGGAGGG - Intronic
918258750 1:182774738-182774760 TCCTCTCGCTGTTCATGGGAAGG + Intergenic
918272690 1:182918526-182918548 TCCAATCCATGAACATGGGATGG - Intronic
918955215 1:191198958-191198980 TAAGCTCCCTGGTCATGGGAAGG + Intergenic
919829566 1:201531081-201531103 TCCTCTCCCTGAAAGTGGGGTGG + Intergenic
920081788 1:203380090-203380112 CCCTCTCCCTGCACAGGGGAGGG + Intergenic
920433701 1:205935135-205935157 TCATCTCCCTGGAAATGCGATGG - Intronic
920553958 1:206890294-206890316 TCCTCTTCCTGGAGGTGGGATGG + Intergenic
922485792 1:225972269-225972291 TCCAGTCCCTGAGCATGGGAAGG + Intergenic
922759959 1:228122352-228122374 TCCCCTCCCCAGACATGGGGAGG + Intergenic
922779383 1:228239864-228239886 TCCCCTCCCTGGACCAGGCAGGG - Intronic
923065088 1:230510146-230510168 TCTTCTCCCTGGAGATCAGAGGG + Intergenic
923656372 1:235920708-235920730 TCCAGTCACTGGACCTGGGAGGG - Intergenic
923867937 1:237960600-237960622 TCCTAAATCTGGACATGGGAAGG - Intergenic
924728352 1:246690440-246690462 GCCTCCCCCTGGGCAAGGGATGG - Intergenic
1062807692 10:436676-436698 TCCGCCTCCTGGACATGGTAGGG + Intronic
1062807705 10:436736-436758 TCTGCTTCCTGGACATGGTAGGG + Intronic
1062807714 10:436795-436817 TCCGCCTCCTGGACATGGTAGGG + Intronic
1062807725 10:436854-436876 TCCACCTCCTGGACATGGTAGGG + Intronic
1062807762 10:437032-437054 TCCGCCTCCTGGACATGGTAGGG + Intronic
1062807773 10:437091-437113 TCCACCTCCTGGACATGGTAGGG + Intronic
1062807783 10:437146-437168 TCCGCCTCCTGGACATGGTAGGG + Intronic
1062807806 10:437264-437286 TCCGCCTCCTGGACATGGTAGGG + Intronic
1062807817 10:437319-437341 TCCACCTCCTGGACATGGTAGGG + Intronic
1063525589 10:6781698-6781720 TCCTCTCTCTGGAGAAAGGAAGG + Intergenic
1067148699 10:43712058-43712080 TCCTCTGCATGGGCATGGGTGGG - Intergenic
1067766429 10:49090905-49090927 TGGTCTCCCTGGACACAGGACGG - Intronic
1067982257 10:51099741-51099763 TCTTCTCCCTGGAAATGTGTAGG + Intronic
1069533011 10:69232776-69232798 TCCTTTCCCTGGATCTCGGAGGG + Exonic
1070764954 10:79051040-79051062 TCCTATGCCAGGAAATGGGATGG + Intergenic
1071995453 10:91143769-91143791 TCCTCTCCCTTGAGTAGGGATGG + Intergenic
1073635976 10:105199582-105199604 CCCTGTCCATGGACATGGGTAGG + Intronic
1074224872 10:111474979-111475001 TCCTCTCGCTGGAAACAGGAGGG - Intergenic
1074422358 10:113320373-113320395 TCCTCCCCCTGAATATGGGCAGG - Intergenic
1076713319 10:132350952-132350974 CCCTCTCCCTGCCCATGAGAGGG - Intronic
1077140754 11:1023836-1023858 CCCTCTCCCTGGACAGGCGCCGG - Intronic
1077154664 11:1085965-1085987 TGCTGTCCCTGGCCCTGGGAGGG + Intergenic
1078621859 11:12915460-12915482 TCCTTACCCTTGAAATGGGAAGG + Intronic
1079357245 11:19739970-19739992 TCCTCTCCTTGGAGAGGGAAAGG + Intronic
1080399616 11:31921935-31921957 TCCTCTCCATGGACATGTCAGGG + Intronic
1080915346 11:36652172-36652194 TCCTATCCATGAACATGGAATGG + Intronic
1081253334 11:40862061-40862083 ACCTCTGACAGGACATGGGAGGG + Intronic
1081772876 11:45660553-45660575 TCCTCTCCCAGGGCAGGAGAGGG + Intronic
1083705434 11:64510974-64510996 CCCTCTCCCTGTCCCTGGGAGGG + Intergenic
1084364172 11:68686711-68686733 TCCTCTCCCTGCCCATGGAGTGG + Intronic
1085045944 11:73353407-73353429 TCCTGACCCTGGACTTGGGCTGG + Intronic
1085680084 11:78565093-78565115 TTCTCTCCCTGTGGATGGGAGGG - Intronic
1089305330 11:117522825-117522847 TCCTCTCCATGAACCTGGCAGGG + Intronic
1090538791 11:127677529-127677551 TCATCTCTCTGGACTTGAGATGG - Intergenic
1090640431 11:128725009-128725031 TCCTCCCCCTGGACAGAGCATGG - Intronic
1091592664 12:1854108-1854130 TCTTCTCCCTGAACTTAGGATGG - Intronic
1092000529 12:5027915-5027937 TCCTCTTCCTGGCTGTGGGAGGG + Intergenic
1092289248 12:7149411-7149433 CCCTCTCCCTGGCCCTGGAAAGG + Intronic
1093457179 12:19376531-19376553 TCCTCAACTTTGACATGGGAGGG - Intergenic
1093654059 12:21674931-21674953 TCCCCTCCCTGGAGGTGGCAGGG - Intronic
1095218955 12:39585140-39585162 TCCTATCCATGAACATGGGATGG + Intronic
1095542621 12:43328715-43328737 TCCTATCCATGAGCATGGGATGG + Intergenic
1098042634 12:66367885-66367907 TCCTCTTTGTAGACATGGGAGGG - Intronic
1098240722 12:68464197-68464219 TCCTCTCCCTGGAGGTTGGGAGG + Intergenic
1099373921 12:81872550-81872572 GCCTCTCCCTTGACATGGGGGGG + Intergenic
1099853336 12:88133034-88133056 TCCTTTGCAGGGACATGGGATGG - Intronic
1101282767 12:103276489-103276511 GCTCCTCCTTGGACATGGGATGG - Intronic
1102172013 12:110849394-110849416 TTCTCTTCATGGTCATGGGAGGG + Intronic
1103863809 12:124035307-124035329 TGCTCTCCCTGTTCATGAGAAGG - Intronic
1106024372 13:25942939-25942961 CCCTGTCCATGGACAGGGGAGGG - Intronic
1106368125 13:29104028-29104050 GCATCCCCCTGGACATGAGATGG + Intronic
1107116229 13:36748852-36748874 TCCTATCCATGAACATGGAATGG + Intergenic
1107541643 13:41394519-41394541 TCCTCACTGTGGCCATGGGAGGG + Intergenic
1108846211 13:54680279-54680301 CCCCCTCCCAGGACATGTGATGG - Intergenic
1112326686 13:98446431-98446453 TCTTCTGCCTGGACAAGGGACGG + Intronic
1113652261 13:112042331-112042353 TCCTTTCCCTGCTCCTGGGAGGG - Intergenic
1113659533 13:112096142-112096164 ACCTTTCCCTGGACAGAGGAAGG - Intergenic
1113838249 13:113343633-113343655 TCCTCACCCTGGAAATGGGGTGG + Intronic
1114066161 14:19061686-19061708 GCCTCTCCCTGGGAATGGGCGGG + Intergenic
1114096107 14:19338338-19338360 GCCTCTCCCTGGGAATGGGCGGG - Intergenic
1114416511 14:22548440-22548462 TCCTCTCCCTGCCCTTGGTAGGG - Intergenic
1114526235 14:23368342-23368364 TCTTCTCCCTGAATATGGCAAGG - Intergenic
1114772554 14:25444821-25444843 TCCTCTCCCTGGAAATTGGAGGG - Intergenic
1115380125 14:32727183-32727205 TTCTCACCCTTGACATGGGAAGG + Intronic
1117254022 14:53960312-53960334 TCCTCTCCCTGGGCAAGTGAGGG + Intergenic
1117731300 14:58724484-58724506 TCCTTTGGCTGGAGATGGGATGG + Intergenic
1119441055 14:74629140-74629162 TACTCTCCCAGGATGTGGGAGGG + Intergenic
1119657429 14:76427119-76427141 CTCTCTCACTGCACATGGGAGGG + Intronic
1119873334 14:78035376-78035398 TCCTATCCCTGGAGCTGGGATGG + Intergenic
1122488643 14:102098059-102098081 CCCTCTCCCTGGAGGTGGCAGGG - Intronic
1125404161 15:39335527-39335549 TCCTCTTCTTGGACCTGGGTTGG - Intergenic
1126783668 15:52159471-52159493 TCCTCTCCCTGGACATGGGAAGG - Intronic
1128069025 15:64782373-64782395 TCCTCTCTTTGAAGATGGGAGGG + Intergenic
1128638734 15:69319868-69319890 TGCTGCCCCTGGACATGTGAAGG + Intronic
1129664866 15:77573849-77573871 TCCACTCCCTGAACAAGGCAAGG + Intergenic
1129665504 15:77577366-77577388 AGTTCTCCCTGGACATGGTATGG + Intergenic
1133022111 16:2971334-2971356 TCCTCGCCCTGGACATGTGTGGG + Exonic
1133111228 16:3549424-3549446 TCCTCTCCCTGTACTGCGGATGG - Intronic
1133141294 16:3746620-3746642 TCCTTTCCCCTGACATGGGAGGG - Intronic
1133284828 16:4685847-4685869 TGCTGTCCCTGTAGATGGGAGGG + Intronic
1133937354 16:10280005-10280027 TGCTTTCCCAGGAAATGGGATGG - Intergenic
1135806518 16:25547584-25547606 TCCACTTCCTGCACACGGGATGG - Intergenic
1136397813 16:30002650-30002672 CTCCCTCCCTGGAGATGGGAGGG + Intronic
1137467295 16:48721563-48721585 TGCTTTCCCAGGACCTGGGAAGG - Intergenic
1139589790 16:67927224-67927246 ACCTCTCTCTGGAAAGGGGAGGG + Intronic
1139787796 16:69407915-69407937 TTCTCTCCCTCCACATGGGAGGG + Intronic
1139968212 16:70757311-70757333 TCCTCTCCCTGGACTCAGGGCGG + Intronic
1141196571 16:81865594-81865616 CTCTGTTCCTGGACATGGGATGG + Intronic
1141304833 16:82852443-82852465 TCCTATCCATGGAAATAGGAAGG - Intronic
1141725873 16:85788014-85788036 CCATCTCCCTGGACACTGGAGGG + Intronic
1142037429 16:87870413-87870435 TCCTAGGCCTGGAAATGGGAAGG + Intergenic
1142713813 17:1737349-1737371 TCCTCTCCCGGGACAGGCGGTGG + Exonic
1142851495 17:2706955-2706977 TCGTCTCCCTGGGCTGGGGAAGG - Intronic
1143227380 17:5317820-5317842 TCCTCTCCCTGGAGGTTGGGAGG - Intronic
1143617995 17:8064808-8064830 TCCTCTCCCCAGACCTGGGGTGG - Intergenic
1144376778 17:14650721-14650743 ACCTCTCCCTGGTCCTGAGATGG - Intergenic
1145865371 17:28237832-28237854 CCCTCTCCCTGGTAAGGGGAGGG + Intergenic
1145901487 17:28493298-28493320 TCCTCACCCTGGGCAAGGGAGGG + Intronic
1146634859 17:34496401-34496423 CCCTCTCCCTGGACATTGCCAGG + Intergenic
1147672695 17:42185663-42185685 TCTGCTCCCTGGAGATGGGGCGG + Intergenic
1147692105 17:42322493-42322515 ACCTGTCACAGGACATGGGAAGG + Exonic
1147898346 17:43767242-43767264 ACCACTGCCTGGTCATGGGAGGG + Exonic
1148382553 17:47210286-47210308 TCCTCTCCCTGGAGCTGGTGTGG + Intronic
1152051399 17:77981330-77981352 TACCCTCCCTGGAGATTGGAGGG + Intergenic
1152097268 17:78279294-78279316 TCCTCTCCCTGGGAAAGGGGAGG - Intergenic
1152279744 17:79378413-79378435 TCCTCTACCTGTTCTTGGGATGG - Intronic
1152310631 17:79547789-79547811 CCCTCTCCCTGGACAAGGCTTGG + Intergenic
1152469272 17:80481937-80481959 CCCACTCACTGGACATGGGTGGG - Intergenic
1153584361 18:6606064-6606086 TCTTCTCTGTCGACATGGGATGG - Intergenic
1154300319 18:13186179-13186201 TACTCTCCCTGGGCCTGGGCTGG - Intergenic
1155366563 18:25055036-25055058 TCCTATCACTGGAAATGGAAAGG + Intergenic
1155605615 18:27602309-27602331 TCCTCTGCCTGGCCATGGGATGG - Intergenic
1156492748 18:37505990-37506012 TACTCTCCCTGGGCCTGGGAGGG - Intronic
1157975653 18:52324090-52324112 TCCTCTCCCTGGAGGTGGAGGGG - Intergenic
1158106896 18:53895549-53895571 TACTTTCCCTAGACCTGGGAGGG - Intergenic
1158360192 18:56663934-56663956 TCCTCTACCTAGACACGTGAAGG - Intronic
1160527332 18:79545388-79545410 TCCTCTCGCTGGTAATGGGGTGG - Intergenic
1161565115 19:4997588-4997610 TCCTCTCCTGGGAAATGGGCTGG + Intronic
1161683792 19:5693388-5693410 TGCTGTCCCTGGCCATGGGCAGG - Exonic
1161841236 19:6681935-6681957 TCATCTACCTGGACAAGGTAAGG - Exonic
1161884042 19:6979672-6979694 TCCTCTTCCTGTATCTGGGATGG - Intergenic
1164622652 19:29706407-29706429 TCCAGTCCCTGGTCATGGGCGGG - Intronic
1165149463 19:33752232-33752254 TCCTCTCCCCGGGCAGGGGGTGG - Intronic
1165545215 19:36529419-36529441 TCCCCTCCCCCGCCATGGGAGGG - Intergenic
1166621549 19:44305903-44305925 CCCTCTCCCAGGGCATGTGATGG + Intergenic
1167036023 19:46995453-46995475 TCCTCTGACAGGACAGGGGATGG - Intronic
1168198427 19:54793887-54793909 TCTTCTCACTCTACATGGGAGGG - Intronic
1168378268 19:55899008-55899030 TCCTTTCCTTGGACGTGAGATGG - Intronic
1168649703 19:58085412-58085434 TCCTCTCCCTGGCCCTGGGCGGG - Intronic
1168678174 19:58294160-58294182 TCCCTTCCCGTGACATGGGATGG - Exonic
925462479 2:4075360-4075382 CCCTCTCCCTGGCCTGGGGATGG + Intergenic
928983143 2:37156684-37156706 TCCTTTCCCTGGATTTGGGGAGG + Intronic
931781463 2:65582470-65582492 CCGTCTCCCTGGACCTGGGCAGG - Intergenic
932040590 2:68295102-68295124 TCCCCTCCCATGACAGGGGAGGG - Intronic
932448292 2:71793968-71793990 TCTTCTTCCTAGACTTGGGAGGG + Intergenic
933408907 2:81899496-81899518 TCCTCTCTCTTGACTTTGGAAGG - Intergenic
937172293 2:119886794-119886816 TCCTCTCCCAGAACATGGTCAGG - Intronic
938408161 2:131044208-131044230 TCCTCTCCCCAGCCATAGGAGGG - Intronic
938483564 2:131681822-131681844 GCCTCTCCCTGGGAATGGGCGGG + Intergenic
942989850 2:182187339-182187361 TCCTCTGCCTAAACATGGGATGG - Intronic
943010439 2:182441542-182441564 TCCTCTCACTGGACATAGCTAGG - Intronic
943369539 2:187001317-187001339 CCCTGTCCCTGGCCCTGGGAAGG - Intergenic
943731561 2:191308026-191308048 TCCCCTCCCTGGAGGTGGGGAGG + Intronic
947834067 2:233162885-233162907 TCCTCCCTCTGGACATGGTCAGG + Intronic
948487823 2:238291858-238291880 GCCTGTCCCTGGACATGAGGTGG + Intergenic
1168876714 20:1176934-1176956 TCCTCTCCCTGGGCCTTGGTAGG - Intronic
1171104145 20:22416392-22416414 TCCTCTCTCTGGAGAGGAGATGG - Intergenic
1171391281 20:24803091-24803113 TCCTTGCCATGGCCATGGGACGG - Intergenic
1172788225 20:37484515-37484537 TCCTCTCCCTGGAGATCACATGG + Intergenic
1173842370 20:46166231-46166253 ACCTCTTCCTGGGCTTGGGATGG + Intergenic
1174859359 20:54076143-54076165 CCCTGTCCCTGGAGATAGGATGG + Intergenic
1175165845 20:57043987-57044009 CCCTCTCTGTGGACAGGGGAAGG - Intergenic
1175188925 20:57198452-57198474 TCATCTCCCTGGGGATGGGCTGG - Intronic
1175391240 20:58628699-58628721 TCCTCTGCCTGTCCTTGGGAGGG + Intergenic
1175769012 20:61611213-61611235 TCCTCTCCCTGGGGATCAGAGGG + Intronic
1176309273 21:5141215-5141237 TCCTCTCCCAGGAGACAGGAGGG + Intronic
1176350413 21:5789988-5790010 TCCTATCCGTGAGCATGGGATGG + Intergenic
1176357227 21:5910572-5910594 TCCTATCCGTGAGCATGGGATGG + Intergenic
1176544734 21:8188058-8188080 TCCTATCCGTGAGCATGGGATGG + Intergenic
1176563685 21:8371103-8371125 TCCTATCCGTGAGCATGGGATGG + Intergenic
1176933380 21:14841046-14841068 TCCTCTCACAGGGCATGTGATGG + Intergenic
1177567847 21:22847067-22847089 TCCCCTCCATGAACCTGGGAGGG - Intergenic
1178851632 21:36217120-36217142 GCCTCTCTCTGGCCTTGGGATGG + Intronic
1179501509 21:41812176-41812198 TCTTGTCCCTGGACCTGGGGAGG - Intronic
1179847789 21:44120818-44120840 TCCTCTCCCAGGAGACAGGAGGG - Intronic
1180925189 22:19548891-19548913 CCCTCTCCTTGCACCTGGGAAGG + Intergenic
1182251668 22:29005575-29005597 TCCTCTCCCTGCAGCTGGGGTGG + Intronic
1182280998 22:29217626-29217648 TCCTCACCCGGGAAATGGGCAGG + Intronic
1182622406 22:31625397-31625419 TCCCCTTCCTGCCCATGGGAGGG - Intronic
1182795319 22:32987467-32987489 TCCTCCCTCTGGCAATGGGAAGG - Intronic
1183103451 22:35598208-35598230 TCCTCTCCCTGGCCCTCAGAAGG - Intergenic
1183832450 22:40425532-40425554 TCCTCCCTCAGGACCTGGGAAGG + Intronic
1184419891 22:44373722-44373744 GCCTCTCCCTGGCAGTGGGAGGG - Intergenic
1184980697 22:48094093-48094115 TCCTCTCCCGGTGCAGGGGACGG - Intergenic
1185362320 22:50415705-50415727 TACTCTTCCTCAACATGGGAAGG + Intronic
1203249604 22_KI270733v1_random:104295-104317 TCCTATCCGTGAGCATGGGATGG + Intergenic
952879650 3:37975550-37975572 TCCTCTCCGTGTACATAAGATGG - Intronic
952977778 3:38710539-38710561 GCCACTCCCTGGACAAGGGTGGG - Intronic
956212372 3:66814952-66814974 TTCTCTCCCTGGAGATTGGGGGG + Intergenic
958930819 3:100206095-100206117 TACTCTCCGAAGACATGGGATGG + Intergenic
960056615 3:113280276-113280298 TGATCTCCCTGGACATGTGAGGG - Intronic
961043710 3:123694727-123694749 TCCTCTCCCAGGGCAAGGCATGG + Intronic
961372006 3:126437047-126437069 TCCTCCCCATGGAGATGGGGTGG + Intergenic
961430515 3:126879211-126879233 TTCTCTCCCTGGATCTTGGATGG - Intronic
961660891 3:128468288-128468310 TTCTCTCCCTGGCCATGGCTCGG - Intergenic
962648453 3:137463860-137463882 TGCTCTCCCTTTAGATGGGAGGG - Intergenic
966550980 3:181203715-181203737 TCCTCTCACTGGACAAGAAAGGG - Intergenic
967684132 3:192399916-192399938 TCCTCACCCTGAACATAGGGAGG - Intronic
969907680 4:10412270-10412292 TCCTCCTCCTGGACATGGTGAGG + Intergenic
970435904 4:16035127-16035149 GCCTCTTCGTGGACATGGGATGG - Intronic
971478014 4:27090253-27090275 TGCTCTTCCTGGACATGGGTGGG + Intergenic
973043365 4:45502735-45502757 ACCAATCCCTGGACATGGGTTGG - Intergenic
979325014 4:119368912-119368934 TCCTCTGACTAGAGATGGGATGG + Intergenic
981187014 4:141815917-141815939 TAAGCTCCCTGGACATGGGAAGG + Intergenic
985139303 4:186822282-186822304 TCCCCTCCCTGGAGATTGGGGGG + Intergenic
985193169 4:187399958-187399980 TGCTGTCCATGGACATGGGGAGG + Intergenic
985669730 5:1201174-1201196 CCCTCTCCCTGGACTGGGGTGGG + Intergenic
985776580 5:1847362-1847384 TTCTCTCCCTGGAGAGGGGTCGG + Intergenic
985984899 5:3506714-3506736 TGCTCTCCCTGGAAATGCTAGGG - Intergenic
990300100 5:54441438-54441460 TCCACTCACTGGACAGGGGTTGG + Intergenic
991605431 5:68396109-68396131 TCCTCCCCCTGGAGCTGGGCTGG - Intergenic
992779642 5:80116366-80116388 TCCTCTTCCTGGACAGAGAATGG + Intronic
993562133 5:89423134-89423156 ACCCCTTCCTGAACATGGGATGG - Intergenic
995797012 5:115952100-115952122 TCCACCCCTTGGACATGGAAAGG - Intergenic
996621098 5:125504180-125504202 TCCTCTCCCTGTGTATGCGATGG + Intergenic
997981407 5:138469862-138469884 TCCTCTAACTGCACATGGCAGGG - Intergenic
998332249 5:141339501-141339523 ACTTCTCCCTGGACGTGCGAAGG + Exonic
999231794 5:150066056-150066078 TCCTGTCCCTGGAGGTGGGTGGG + Intronic
1002608302 5:180396790-180396812 TCCCCTCCTTGGACATGGGATGG - Intergenic
1004105241 6:12661280-12661302 TCCTCTCCCTGACAATGGGCTGG - Intergenic
1006398193 6:33800711-33800733 CCTTCTCCCTGGAGATGGGGAGG + Intronic
1006565886 6:34956837-34956859 TCCTCTACCTGCACAGGAGAGGG - Intronic
1007053145 6:38853537-38853559 TCCTCCTCTGGGACATGGGATGG - Intronic
1012443193 6:99281418-99281440 TCCTCTCACAGTACATGGCAAGG + Exonic
1013299958 6:108795569-108795591 ACCTCTCCCTGGACAGAAGATGG - Intergenic
1014477434 6:121890575-121890597 TCACCCCTCTGGACATGGGATGG + Intergenic
1017504937 6:155059692-155059714 CCCTCTCCTTGCACATGGTAGGG + Intronic
1017882578 6:158572160-158572182 GCCTCACCCTGGCCCTGGGACGG + Intronic
1017983847 6:159425384-159425406 TCCTTCCCCTGCACATGAGAGGG + Intergenic
1018968701 6:168509466-168509488 TCCACTATCTGGAAATGGGAGGG - Intronic
1019158880 6:170056567-170056589 TTCTCTCACTGGACAGGGAAAGG - Intergenic
1019930994 7:4223007-4223029 TGCTCTCCCTGGATATGGGGAGG - Intronic
1020133139 7:5570588-5570610 TTCTCTCCCTGCCCAGGGGAGGG + Intergenic
1021557595 7:21937164-21937186 TCCAATCCATGAACATGGGATGG - Intronic
1022603062 7:31779896-31779918 TGTTCTTCCTGGACATGAGAGGG - Intronic
1025093669 7:56082039-56082061 TGCTCCACCTGGACATGCGAGGG + Exonic
1025850081 7:65237940-65237962 TCCTCTCCTGGGATCTGGGAAGG + Intergenic
1026601399 7:71780475-71780497 CTCTCTCCCTGGTCATGGGTGGG + Exonic
1026880336 7:73903567-73903589 TCCTGGCGCTGCACATGGGATGG + Intergenic
1027266641 7:76498384-76498406 TCCTCCCCCAGGGCAGGGGAAGG - Intronic
1027318022 7:76996502-76996524 TCCTCCCCCAGGGCAGGGGAAGG - Intergenic
1027808865 7:82866437-82866459 TTCTCTTCTTGGACATGTGAGGG - Intronic
1028368177 7:90059476-90059498 TCCTCTCACTGAAAATGGGCAGG - Intergenic
1029262939 7:99315628-99315650 TTCACTCCCTGGACTTGGGGAGG + Intergenic
1029419312 7:100464227-100464249 TCCTCTCCCTGTCCCAGGGAGGG - Exonic
1031719437 7:125152950-125152972 TCCTCTCTTTGGTCATGTGATGG + Intergenic
1032018076 7:128392459-128392481 CCCTGTCCCTGGCCATGGGTAGG - Exonic
1032078773 7:128848459-128848481 TCCTCCCCATAGACATGGGCAGG - Intronic
1034558006 7:151862130-151862152 TCCTCTGCCTGGAGACGGGCCGG - Intronic
1035472885 7:159121324-159121346 TCCTCTCCCTTCACAGGGGATGG + Intronic
1036494970 8:9262030-9262052 TCCTCTCCCTCCACATGAGAAGG + Intergenic
1036729919 8:11253645-11253667 TCTTCTCCCTGGCCATTGCACGG + Intergenic
1037715535 8:21394423-21394445 TCCTGCCCCTGGGCATGGGGTGG - Intergenic
1037799417 8:22024415-22024437 TCCTCTCCATGGGCTGGGGAGGG + Exonic
1037827815 8:22169762-22169784 TCCTCCCCCAGGGCATGGCAAGG - Intronic
1039908459 8:41804553-41804575 TTCTCTCCCTGGCTATGAGAGGG + Intronic
1044608630 8:94070189-94070211 TCCTCTCTCTGTCCATGAGATGG - Intergenic
1044717442 8:95113414-95113436 TCCTCTCCCTGGGATGGGGATGG - Intronic
1048038176 8:130697510-130697532 TCTTCCCCCTGAACAAGGGAAGG - Intergenic
1048257080 8:132913181-132913203 ACCTCTCCCAGGACATGGTTTGG + Exonic
1049565641 8:143337096-143337118 TCCAGTCCGTGAACATGGGATGG - Intronic
1051681659 9:19613685-19613707 ACCTATCCCTGGACCAGGGATGG - Intronic
1055333688 9:75209853-75209875 TCCTCTCCTTAGAGATGGGGTGG + Intergenic
1056936201 9:90916526-90916548 TCATCTCCCTGGGCATGGATGGG - Intergenic
1057171300 9:92964845-92964867 TCCTCTGCCTGAACAGAGGAGGG + Intronic
1057499967 9:95589184-95589206 TCCTCCCCTTGGATATGGGCTGG + Intergenic
1059341782 9:113601439-113601461 TCCTCTCCCTAGCCAGGGAAGGG + Intergenic
1060528636 9:124334652-124334674 GGCTCTCCCTGGCCAGGGGAGGG + Intronic
1060787153 9:126459841-126459863 TTCTCTCCCTCGAGATGGGTGGG - Intronic
1062169261 9:135125662-135125684 TCCTCTCCCTGGGTATGTGCTGG + Intergenic
1203465998 Un_GL000220v1:87556-87578 TCCTATCCGTGAGCATGGGATGG + Intergenic
1186338520 X:8618260-8618282 TTCTCAGCCTGGAAATGGGAAGG - Intronic
1187818582 X:23260424-23260446 TCCTCTCCATGAGCATGGAATGG - Intergenic
1188005679 X:25014293-25014315 TCCTCTGCCCCGACGTGGGAAGG - Intronic
1189009051 X:37027749-37027771 TCCTCTCTCTGGATAAAGGAAGG + Intergenic
1189176828 X:38965997-38966019 TCCTGTCCCTCGGCATGGGAAGG + Intergenic
1190462533 X:50692725-50692747 TCCTATCCATGTACATGGGCAGG + Intronic
1192240691 X:69325234-69325256 TCATCTACCTGGAGATGGGATGG - Intergenic
1192322779 X:70105437-70105459 TTCTTTCCATGGAGATGGGAAGG + Intergenic
1192797954 X:74440137-74440159 TCCTCACCCTGGTCATGGCTGGG - Intronic
1193617008 X:83701384-83701406 TTCTCTCCATGAACATGAGATGG + Intergenic
1195871635 X:109492590-109492612 TCCTCTCCCTCCTCTTGGGAGGG + Intergenic
1197268022 X:124396818-124396840 TCCTTTCCCTGGAAAAGAGAAGG + Intronic
1199893292 X:152109529-152109551 TCCAATGTCTGGACATGGGAAGG - Intergenic
1200282773 X:154792194-154792216 TCCTGTCCCTTGACCTGGGCAGG + Exonic