ID: 1126784109

View in Genome Browser
Species Human (GRCh38)
Location 15:52163015-52163037
Sequence GGGGCGACTCACAGAGAGCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 116}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126784103_1126784109 26 Left 1126784103 15:52162966-52162988 CCTTCAACTGAGGTATTCAGATT 0: 3
1: 5
2: 32
3: 102
4: 276
Right 1126784109 15:52163015-52163037 GGGGCGACTCACAGAGAGCGAGG 0: 1
1: 0
2: 2
3: 6
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126784109 Original CRISPR GGGGCGACTCACAGAGAGCG AGG Intronic
900109666 1:1000208-1000230 GGCGTGACTGACAGCGAGCGGGG - Intergenic
901634915 1:10666062-10666084 GGGAGGAGTCACAGAGAGCCAGG + Intronic
905175273 1:36131299-36131321 GGGAGAACTCACAGAGAGAGAGG - Intergenic
909990969 1:82222269-82222291 GGGGAGACTCAGAGAGAGAAGGG - Intergenic
910559107 1:88570985-88571007 GGCGCTACTCACAGAGAGAAAGG + Intergenic
922768543 1:228169126-228169148 GGGGCAAACCACAGAGAGGGAGG - Intronic
924140038 1:241012747-241012769 AGGGGGACTCAGAGAGAGCCTGG - Intronic
1062761672 10:27582-27604 AGCTCGACCCACAGAGAGCGAGG + Intergenic
1065747936 10:28858851-28858873 GGGACCACCCACAGAGAGTGTGG - Intronic
1068036171 10:51762740-51762762 GGGGAGACTAAAAGAGAGCAAGG - Intronic
1076481240 10:130786526-130786548 GAGGCCACGCACAGGGAGCGGGG - Intergenic
1076835164 10:133017248-133017270 GGGGAGACCCGCAGGGAGCGTGG - Intergenic
1088037334 11:105333938-105333960 GGTGCGACCCACAGAGAGCAAGG + Intergenic
1091081428 11:132672520-132672542 GGAGCCACACACAGAGAGCAAGG - Intronic
1095774888 12:46000378-46000400 GGGGCGGCTCCCAGAGGGGGTGG - Intergenic
1096185965 12:49580753-49580775 GGGGCGCCTAACAGACAGCCTGG + Intronic
1097089447 12:56494139-56494161 GGGGCGGCTCCCAGAGGGGGTGG + Intergenic
1097089486 12:56494266-56494288 GGGGCGGCTCCCAGAGGGGGTGG + Intergenic
1097089532 12:56494428-56494450 GGGGCGGCTCCCAGAGGGGGTGG + Intergenic
1097089584 12:56494595-56494617 GGGGCGGCTCCCAGAGGGGGCGG + Intergenic
1106264583 13:28098954-28098976 GGGGGTACTGACAGAGAGGGTGG + Intronic
1106865457 13:33959535-33959557 GGGGAGACTCACTGGGAGTGAGG - Intronic
1111354359 13:87079629-87079651 GGGGCGACTCAGAGGGCGAGAGG + Intergenic
1113478926 13:110606314-110606336 GGGGCGACTCGCTGGGAGGGGGG + Intergenic
1114958111 14:27848927-27848949 GGCGTGACCCACAGAGAGCAAGG + Intergenic
1116457348 14:45134530-45134552 GGGGCCACTCACGGAGGTCGAGG + Exonic
1117251733 14:53946423-53946445 GGGGTGACTCAATGGGAGCGGGG - Intergenic
1119172509 14:72545821-72545843 GGGAGGACTCACAGAGAACAGGG + Intronic
1119485524 14:74984469-74984491 GGGGTGGCTCAGAGAGGGCGTGG + Intergenic
1124196789 15:27638858-27638880 GGTGCGACCCACAGAGAGCGAGG + Intergenic
1125950450 15:43746855-43746877 GAGGCGCCTCGCCGAGAGCGGGG + Intronic
1126784109 15:52163015-52163037 GGGGCGACTCACAGAGAGCGAGG + Intronic
1128181711 15:65610950-65610972 CTGGCGCCTCACAGACAGCGCGG + Intronic
1130047066 15:80453768-80453790 GGAGAGACTCAGAGAGAGAGGGG + Intronic
1132321547 15:100929278-100929300 ACGGCCACTCACAGAGAGCTGGG - Intronic
1136570244 16:31092519-31092541 AGGGTGACTCAAAGGGAGCGTGG + Intronic
1140235533 16:73155362-73155384 GGGGCAACTCCCAGACAGCAAGG + Intergenic
1142566516 17:843749-843771 GGTGCTACTCAGAGTGAGCGTGG - Intronic
1145799074 17:27671952-27671974 TGGGCATCTCACAGAGAGCCAGG - Intergenic
1148397791 17:47324013-47324035 GGGGCTGACCACAGAGAGCGCGG + Exonic
1152954579 18:27912-27934 AGCTCGACCCACAGAGAGCGAGG + Intergenic
1154356802 18:13627781-13627803 GGGCCGAGCCTCAGAGAGCGGGG - Intronic
1158452694 18:57581021-57581043 GGGGAGCCTCACAGACAGCCTGG - Intronic
1158454416 18:57593677-57593699 GGGCCGGCTCACAGGGAGCCTGG + Intergenic
1159397005 18:67872267-67872289 GGGGTGACCCACAGACAGCATGG + Intergenic
1159922150 18:74236365-74236387 GTGGGGACTCACAGAGATTGAGG - Intergenic
1161161360 19:2763338-2763360 GGGGCGGCTCACAGAGCTCAGGG - Intronic
1166946884 19:46402886-46402908 GGGGGGAGACACAGAGAGGGAGG - Intergenic
926136842 2:10342517-10342539 GAGGGGACTCCCAGGGAGCGGGG + Intronic
926453766 2:13039919-13039941 ATGGCGACCCACGGAGAGCGAGG + Intergenic
927157852 2:20231907-20231929 GGGCTGAGTCACAGAGAGCCTGG - Intergenic
927508407 2:23629168-23629190 GGGGCACCTCTCACAGAGCGGGG - Intronic
932425632 2:71632844-71632866 TGGGGGACTCACAGAGAGTCGGG - Intronic
934159444 2:89234441-89234463 GGGGTGACGGACAGAGAGAGTGG + Intergenic
934207832 2:89947991-89948013 GGGGTGACGGACAGAGAGAGTGG - Intergenic
939398279 2:141660162-141660184 GGCGTGACCCACAGAGAGTGAGG + Intronic
941647458 2:168056624-168056646 GGAGTGATTCACAGAGAGTGAGG + Intronic
942043839 2:172087761-172087783 GGGGCAGCTCTCAGAGAGCCAGG - Intronic
943725123 2:191245305-191245327 GGGGCGAATCCCAGGCAGCGAGG + Intronic
943865571 2:192921757-192921779 GGGATGAGTCACAGAGAGCTAGG - Intergenic
945523984 2:210865995-210866017 GGGGTGACCCACGGAGAGTGAGG + Intergenic
946856690 2:223957324-223957346 GGGGCGACTGAGAGAGGGCAGGG - Intergenic
1168855363 20:1003964-1003986 GGGGAAACACACAGAGAGTGTGG + Intergenic
1171226050 20:23442919-23442941 AGGGAGACTAACAGAGAGCTTGG - Intronic
1172777535 20:37416207-37416229 GGGGAGACGGACAGAGAGAGGGG - Intergenic
1180092787 21:45541629-45541651 GAGGCGTCTCAGAGAGAGCCTGG - Intronic
1180615191 22:17121619-17121641 GGGGGGACTCCCATGGAGCGCGG + Exonic
1184355041 22:43974217-43974239 AGTCCGACTCACAGAGAGTGGGG + Intronic
1185232791 22:49693067-49693089 TGGGCGACTCACAGAGGTCCAGG + Intergenic
949515959 3:4807141-4807163 GGGGGGACTTACAAAGAGAGGGG + Intronic
950480182 3:13239055-13239077 GGGGAGATTCACAGGGAGCAGGG - Intergenic
954699584 3:52444206-52444228 GGGGAGAGTGACAGAGAGGGTGG - Intronic
959883630 3:111474119-111474141 GGTGCGACCCACAGAGAGTGAGG - Intronic
963531290 3:146476229-146476251 GGTGTGACTCACAGAGAGTAAGG + Intronic
964474973 3:157089986-157090008 GGGGAGACTCACACAGACAGAGG + Intergenic
968691298 4:1991807-1991829 GGGGCAACTGCCAGAGAGCCCGG - Intronic
969583484 4:8078861-8078883 GGGGTGACTGGCACAGAGCGAGG + Intronic
971328012 4:25659745-25659767 GAGGCGAATCACAGTGAGGGAGG - Intronic
977524459 4:98126554-98126576 GGTGCAACCCACAGAGAGTGAGG - Intronic
978189613 4:105896168-105896190 GGGGCCGCTCACACAGAGAGTGG + Intronic
981844127 4:149146967-149146989 GGAGAGAATGACAGAGAGCGAGG - Intergenic
983820849 4:172192512-172192534 GGAGTGACCCACAGAGAGCAAGG + Intronic
992193444 5:74316505-74316527 GGGGTGAGTAACAGAAAGCGAGG + Intergenic
993020543 5:82585335-82585357 GGCGCGACCCACAGAGAGACAGG - Intergenic
996005762 5:118419501-118419523 GGTGCTACCCACAGAGAGCGAGG + Intergenic
999402554 5:151277440-151277462 GGGGCAACTCATAGAGGGCTTGG + Exonic
999736176 5:154515004-154515026 AGGGGGACTCACAGAGGGAGGGG - Intergenic
999938495 5:156515486-156515508 GGTGTGACCCACAGAGAGTGAGG + Intronic
1003290301 6:4775006-4775028 GGGGCGTCTCACAGACCCCGCGG - Intronic
1004342021 6:14816344-14816366 GGAGCGACTCACAGAGAGCCTGG + Intergenic
1006472647 6:34237307-34237329 GGGACGACTCACCGCGAGCTCGG - Exonic
1007621865 6:43220418-43220440 GGGGCTGCTCACAGACAGTGTGG - Intronic
1013931891 6:115544904-115544926 GGCATGACCCACAGAGAGCGAGG + Intergenic
1015801154 6:137063338-137063360 GGGGTGAGTCAGGGAGAGCGAGG + Intergenic
1019179225 6:170176477-170176499 GGGGGGACCCACAGAGGGCAGGG + Intergenic
1023025705 7:36047961-36047983 GGGGCCACTCACAGAGAGAAGGG + Intergenic
1023528465 7:41129649-41129671 GGGGGGACTGACACAGAGGGTGG - Intergenic
1026820362 7:73543683-73543705 CAGGAGACTCACAGAGAGGGAGG + Intronic
1026837697 7:73649401-73649423 GGGGGGACTCAGAGGGAGCATGG - Intergenic
1028221362 7:88200944-88200966 GGGGCTACTCACACACAGCTGGG - Intronic
1028779577 7:94720170-94720192 GGTGTGACTCACAGAGAGGAAGG - Intergenic
1029513746 7:101013132-101013154 GGGGACACTCACAGGCAGCGGGG - Exonic
1033586797 7:142780273-142780295 GAGGCGGGGCACAGAGAGCGTGG - Intergenic
1035241592 7:157534141-157534163 GGGGGGCCTCACAGAGAGCCAGG - Intergenic
1035555194 8:562552-562574 AGGGGGTCTCACAGAGAGCTGGG + Intergenic
1037262915 8:17027567-17027589 CGGGCGACCCTCAAAGAGCGCGG + Exonic
1040593668 8:48818495-48818517 GGGGCGACTGCCAGACAGTGAGG + Intergenic
1041474410 8:58248455-58248477 GGTGCGACCCACAGAGAGTGAGG + Intergenic
1042773532 8:72404938-72404960 GGTGTGACCCACAGAGAGCAAGG + Intergenic
1048350105 8:133609004-133609026 CGGGCCACTCACAGACACCGAGG + Intergenic
1048495370 8:134931153-134931175 GGGGCAATTCTCAGTGAGCGTGG - Intergenic
1049844175 8:144792144-144792166 GGGGCGACTCACGATTAGCGCGG + Intronic
1050393015 9:5167087-5167109 GGCGTGACTCAGAGAGAGCAAGG + Intronic
1052300416 9:26947100-26947122 GGGGCGACTCGGAGAGCGCCGGG + Exonic
1061661070 9:132130715-132130737 GGGGTGAGGCACAGAGAGGGTGG - Intergenic
1061839377 9:133348665-133348687 TGGGCGACGCGAAGAGAGCGTGG + Intronic
1061967744 9:134025600-134025622 GGGGCGACCCAGAGCGCGCGGGG + Intergenic
1062142729 9:134968729-134968751 CGGGAGACTCACACAGAGGGTGG - Intergenic
1062275255 9:135727467-135727489 GGGGAAACTGACAGAGAGAGAGG - Intronic
1185724339 X:2407295-2407317 GGGGCCACTCACAGACACTGAGG + Intronic
1191225297 X:58035749-58035771 GGTGTGACCCACAGAGAGCAAGG - Intergenic
1196167866 X:112555323-112555345 GGTGCAACCCACAGAGAGTGAGG + Intergenic
1196558817 X:117122461-117122483 GGTGCTACCCACAGAGAGCAAGG + Intergenic
1199172981 X:144753482-144753504 GGGGCCACTCACAGACACCAAGG + Intergenic
1200523813 Y:4247122-4247144 GGCGTGACCCACAGAGAGCAAGG + Intergenic