ID: 1126787744

View in Genome Browser
Species Human (GRCh38)
Location 15:52191847-52191869
Sequence CCTCATCAGCAGTAGGATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126787734_1126787744 29 Left 1126787734 15:52191795-52191817 CCACACACACACAGTCCTCCAAC No data
Right 1126787744 15:52191847-52191869 CCTCATCAGCAGTAGGATGAAGG No data
1126787739_1126787744 -5 Left 1126787739 15:52191829-52191851 CCTTCAGTTCTCTTCCCACCTCA No data
Right 1126787744 15:52191847-52191869 CCTCATCAGCAGTAGGATGAAGG No data
1126787737_1126787744 14 Left 1126787737 15:52191810-52191832 CCTCCAACGGGACTTTGCTCCTT No data
Right 1126787744 15:52191847-52191869 CCTCATCAGCAGTAGGATGAAGG No data
1126787738_1126787744 11 Left 1126787738 15:52191813-52191835 CCAACGGGACTTTGCTCCTTCAG No data
Right 1126787744 15:52191847-52191869 CCTCATCAGCAGTAGGATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126787744 Original CRISPR CCTCATCAGCAGTAGGATGA AGG Intergenic
No off target data available for this crispr