ID: 1126789137

View in Genome Browser
Species Human (GRCh38)
Location 15:52204693-52204715
Sequence GCCCCGGGATGCTGGCGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 4, 3: 23, 4: 209}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126789137_1126789148 23 Left 1126789137 15:52204693-52204715 CCTGGGCGCCAGCATCCCGGGGC 0: 1
1: 0
2: 4
3: 23
4: 209
Right 1126789148 15:52204739-52204761 TACAGCAGTAGGGCCTAAACAGG 0: 1
1: 0
2: 0
3: 3
4: 59
1126789137_1126789144 12 Left 1126789137 15:52204693-52204715 CCTGGGCGCCAGCATCCCGGGGC 0: 1
1: 0
2: 4
3: 23
4: 209
Right 1126789144 15:52204728-52204750 TCGAATATCCCTACAGCAGTAGG 0: 1
1: 0
2: 0
3: 3
4: 30
1126789137_1126789149 24 Left 1126789137 15:52204693-52204715 CCTGGGCGCCAGCATCCCGGGGC 0: 1
1: 0
2: 4
3: 23
4: 209
Right 1126789149 15:52204740-52204762 ACAGCAGTAGGGCCTAAACAGGG 0: 1
1: 0
2: 1
3: 5
4: 110
1126789137_1126789145 13 Left 1126789137 15:52204693-52204715 CCTGGGCGCCAGCATCCCGGGGC 0: 1
1: 0
2: 4
3: 23
4: 209
Right 1126789145 15:52204729-52204751 CGAATATCCCTACAGCAGTAGGG 0: 1
1: 0
2: 0
3: 0
4: 31
1126789137_1126789150 25 Left 1126789137 15:52204693-52204715 CCTGGGCGCCAGCATCCCGGGGC 0: 1
1: 0
2: 4
3: 23
4: 209
Right 1126789150 15:52204741-52204763 CAGCAGTAGGGCCTAAACAGGGG 0: 1
1: 0
2: 0
3: 8
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126789137 Original CRISPR GCCCCGGGATGCTGGCGCCC AGG (reversed) Intronic
900226461 1:1535546-1535568 GCCCGGGAGTGCTGCCGCCCTGG - Intronic
900644741 1:3703822-3703844 GCCCCGGGATGTTCTTGCCCGGG + Intronic
901325783 1:8364375-8364397 GCCCTGGGGTGTTGGGGCCCAGG - Intronic
901631594 1:10650863-10650885 GCCCCGGGGTGGTCCCGCCCAGG - Intronic
902503095 1:16923382-16923404 CGCCAGGGATGTTGGCGCCCTGG + Intronic
902604480 1:17561277-17561299 GCCCCGTCATGCTGGCAGCCCGG + Intronic
902823327 1:18956503-18956525 GGCCCCGGATGCGGGCGCCGAGG + Exonic
903933305 1:26877050-26877072 GCCCAGGAATCCTGACGCCCAGG - Exonic
904236682 1:29121571-29121593 GGCCCGGGACCCTGGGGCCCCGG + Exonic
904756133 1:32769911-32769933 GCCCCGGGCTCCTGGTGCACGGG + Exonic
905293656 1:36940616-36940638 GCCCCGGGAGGCAGGCCCCAAGG - Intronic
906124601 1:43419993-43420015 GCCCAGAGATGATGGGGCCCTGG + Intronic
907089301 1:51709583-51709605 GCACCGAGATGCTGAAGCCCTGG - Intronic
908477745 1:64505796-64505818 GCCGCGGGGTCCTGGCGACCGGG - Intronic
908672082 1:66559102-66559124 GCCCAAGGATGCTTGAGCCCTGG - Intronic
908780672 1:67686470-67686492 GGCCCGGGTTGCTGACGCGCAGG - Exonic
912381430 1:109249968-109249990 GCCCCCGGGGACTGGCGCCCTGG + Intergenic
915600635 1:156920958-156920980 GCCCTGGTACGCTGGCGCCGGGG + Exonic
915724557 1:158008265-158008287 GCCCAGGGGTTCTGGCTCCCAGG - Intronic
916652480 1:166844805-166844827 GCCCCGGGAGTGTGGAGCCCAGG + Intronic
917630220 1:176884230-176884252 GCCCTGGGATACTGGGGACCTGG + Intronic
918042138 1:180919837-180919859 GCCCATGGATGCTGGGGGCCTGG - Intronic
922332737 1:224591692-224591714 GCCTAGGGATGCTGGCTTCCTGG - Intronic
922742614 1:228022715-228022737 GGCCCGGGATGCTGGCACACAGG - Exonic
922756084 1:228097676-228097698 GCTCCGGGATGCTGTCCTCCTGG + Exonic
1067248420 10:44566054-44566076 GCTCCTGGATGTTGGAGCCCTGG + Intergenic
1067369857 10:45672894-45672916 GCCCCAGGGCCCTGGCGCCCCGG - Intergenic
1067811396 10:49429726-49429748 GCCCCAGGTTGTTGGGGCCCAGG + Intergenic
1070289826 10:75106970-75106992 GCCCAGGGAGGCTGGTGTCCTGG - Intronic
1070593893 10:77819334-77819356 GGCCCGAGATGCTGGCCCCCAGG - Exonic
1071629053 10:87203661-87203683 GCTGCGGGAGGCTGGCGCTCGGG + Intergenic
1072151690 10:92689722-92689744 GCTCCGGGGAACTGGCGCCCTGG - Intergenic
1075119286 10:119652075-119652097 GCCCCGGGATTCGGTGGCCCGGG + Intronic
1075707510 10:124510430-124510452 GCCCCGGGAAGCTGTCGGCGAGG - Intronic
1076096112 10:127736301-127736323 GCCCGGGGTTGCTGCAGCCCGGG - Intergenic
1077016254 11:400284-400306 GGCCCGGGATGCGGGGTCCCTGG + Intronic
1077432068 11:2520611-2520633 GCCCTGGGATGTGGACGCCCAGG - Intronic
1078079459 11:8193328-8193350 GACCAGGGATGGTGGAGCCCAGG - Intergenic
1078090747 11:8263113-8263135 GCCCCGGGCTGCACGCGCCCGGG - Intronic
1079402682 11:20118408-20118430 GGCCCGGGATGCCTGCACCCAGG - Exonic
1081528491 11:43942808-43942830 GCCCCCGGCTGCTGCCTCCCGGG + Exonic
1081571519 11:44294286-44294308 GGCCCAGGAAGCTGGGGCCCAGG + Intronic
1081834428 11:46142697-46142719 ACCCCGGGCTGCCCGCGCCCCGG - Intergenic
1081866157 11:46361797-46361819 GCCTAGGGATGGTGGGGCCCGGG - Intronic
1083202764 11:61130481-61130503 GCCCGGGGCTGCTGGGGCCAAGG - Exonic
1083697055 11:64449926-64449948 GCCCCAGGAAGCTGGCCCCAAGG + Exonic
1084174370 11:67415840-67415862 GCCGCGGGGAGCGGGCGCCCGGG - Intronic
1084193137 11:67508022-67508044 GCCCAGGGGTGCTGGAGCCAGGG + Exonic
1084711937 11:70849018-70849040 GCCCAGGGATGCTGGCTGCAGGG + Intronic
1085052898 11:73388904-73388926 GCCCCGTGAGGCCGGCTCCCAGG + Intronic
1085470498 11:76754303-76754325 GCCCAGGGAAGCTGACGCTCAGG + Intergenic
1086395209 11:86408559-86408581 GCCTCTGGATGCTTGAGCCCAGG - Intronic
1091778683 12:3200525-3200547 GCACCGGGATCCAGGCTCCCTGG - Intronic
1096260155 12:50085359-50085381 GCTCCGGGAAGATGGCGGCCCGG + Exonic
1096468941 12:51864349-51864371 GCCCCGGGCCGGGGGCGCCCAGG - Intergenic
1096542380 12:52314961-52314983 ACCCCGGTCTGCTGGCTCCCAGG - Intronic
1097176513 12:57146585-57146607 TCCCCGGGATGGTGGCGAGCAGG + Intronic
1097237491 12:57550068-57550090 GCAGCGGGATGCGGGCGACCTGG - Exonic
1101948272 12:109154654-109154676 GGCCCGGGACTCTGGCGCGCAGG + Intronic
1104970464 12:132528491-132528513 GCCACGGGGTGCTGGCTCCCTGG - Intronic
1108373285 13:49792098-49792120 GAACGGGGATGCTGCCGCCCGGG - Intronic
1113669385 13:112165143-112165165 GCCCCAGGCTCCTGGTGCCCAGG - Intergenic
1114415315 14:22538911-22538933 GCCCCCGAGTGCTGGAGCCCAGG - Intergenic
1120881390 14:89417329-89417351 GCCCCAGGCCGCTGGCGGCCAGG - Intronic
1120976899 14:90256800-90256822 GCCCGGGGATCCTGGGGCCGGGG + Intronic
1121312999 14:92945199-92945221 ACCCAGGGCTGCTGTCGCCCAGG - Intronic
1122320298 14:100851478-100851500 GCCCCGGGACCCAGGAGCCCTGG + Intergenic
1122383966 14:101331392-101331414 GCCCTGGGACCCTGGAGCCCAGG + Intergenic
1122627901 14:103093676-103093698 GCCCTAGGATGCTGGTGCACTGG + Intergenic
1122815327 14:104309401-104309423 GCCCCCTGATGTTGGGGCCCTGG - Intergenic
1123044412 14:105504243-105504265 GCCCCGGGCTGGTGGAGCCCTGG + Intergenic
1125375422 15:39023917-39023939 GCCTCGGGATGCAGGAGACCAGG + Intergenic
1126789137 15:52204693-52204715 GCCCCGGGATGCTGGCGCCCAGG - Intronic
1127117399 15:55742454-55742476 GCCCCGGCGGGCTGGCGACCCGG + Intronic
1129440655 15:75578857-75578879 GCCCCGGGCTGCTGAGGCGCGGG - Exonic
1130179367 15:81609562-81609584 GCCCCGGGATCATGACACCCAGG - Intergenic
1130371107 15:83285492-83285514 GCCGCAGGATCCTGGAGCCCAGG + Intergenic
1132609612 16:808791-808813 GACCTGGGATGCTGGCAGCCTGG + Intronic
1132676113 16:1121893-1121915 GCACAGGGATGCTGGGGCCTGGG + Intergenic
1133029684 16:3004467-3004489 GGCCCGAGCCGCTGGCGCCCTGG + Intergenic
1133611956 16:7441909-7441931 GCCCAGAGATGCTGGCAGCCTGG + Intronic
1136518635 16:30782668-30782690 GCCCCAGCAGGCTGTCGCCCTGG + Exonic
1137926777 16:52547506-52547528 GCTTGGGGATGCTGGGGCCCGGG - Intronic
1141275928 16:82588275-82588297 TCCCCCGGATGATGGCTCCCTGG - Intergenic
1141781474 16:86164742-86164764 GCCTCGGAGTGCTGGCTCCCAGG + Intergenic
1141945153 16:87304627-87304649 GCCTGGAGAGGCTGGCGCCCAGG + Intronic
1142031442 16:87840531-87840553 GCCCTGGGATGCTCTCTCCCCGG - Intronic
1142126791 16:88414456-88414478 GCCCAGGGATGCTGTGGCGCCGG + Intergenic
1142129826 16:88427533-88427555 GCCCCGGGCTGCTGGCAACTTGG - Exonic
1142799756 17:2337763-2337785 ACCCCGGGGGGCTCGCGCCCTGG + Intronic
1143137508 17:4720085-4720107 GGCCTGGGCTGCTGGGGCCCTGG + Intronic
1143259001 17:5584428-5584450 GCCCCGGGCTGCTGGCTCCCAGG + Exonic
1143284779 17:5781043-5781065 CCTCAGGGATGCTGGTGCCCAGG + Intronic
1143321228 17:6070453-6070475 CCCCGGGGCTGCTGGCGTCCGGG - Intronic
1143443867 17:6996039-6996061 GCCCAGGGCTGCCGGCGCCTCGG - Intronic
1144782139 17:17813674-17813696 GCCCTGGGCTGCTGGGGCCGGGG + Exonic
1145019175 17:19416351-19416373 GCCCCCAGATGCTGCCTCCCAGG - Exonic
1148445595 17:47735097-47735119 GACCTGGGATGCTGGGTCCCAGG + Intronic
1148629435 17:49095452-49095474 GCCCTGGGATGCTGGCAGCATGG - Intergenic
1148804553 17:50257660-50257682 GCCCCTGGGTGCTGGTGCCTAGG + Intergenic
1149532182 17:57404382-57404404 GCCCCGGAGTGCTGGGGACCTGG + Intronic
1151854502 17:76711079-76711101 GCCCCGGGAGGGTGACGCACAGG + Intergenic
1153219024 18:2846650-2846672 GCCCCGGGAGGCTGGCACCCAGG + Intergenic
1153274297 18:3352871-3352893 GCCCCAGAGTGCTGGGGCCCTGG + Intergenic
1154384287 18:13879611-13879633 GCCCTGGGATGCTGATGCCCTGG - Intergenic
1157535886 18:48457078-48457100 CCCCAGGGAGGCTGACGCCCTGG + Intergenic
1157946072 18:51982258-51982280 GCCCCTGGATGCTGGAGTCTTGG - Intergenic
1159655684 18:71028538-71028560 TCCCTGGGATGCTGCCGCCCGGG + Intergenic
1160499662 18:79395640-79395662 GCCCGGGGAGGGGGGCGCCCGGG - Intergenic
1161222380 19:3123588-3123610 GCCGGGGGCTGCTGCCGCCCGGG - Exonic
1161492798 19:4571616-4571638 GCCCCAGGATTCTGGCTCCGGGG + Intergenic
1161779335 19:6280302-6280324 CCCCCGGGACGCTCCCGCCCTGG - Intergenic
1162457036 19:10791618-10791640 CCCCCAGGAGGCTGGTGCCCAGG + Intronic
1162958898 19:14114653-14114675 GCCCCAGGGGGCAGGCGCCCAGG - Intronic
1165065484 19:33225855-33225877 GCCCCGGGCGGCGGGGGCCCGGG + Intergenic
1165112702 19:33511509-33511531 CCCCCCGGATTCTGACGCCCAGG + Intronic
1166198613 19:41221989-41222011 GCTCCAGGATGCTGTCCCCCTGG + Exonic
925025751 2:605976-605998 ACCCAGGTGTGCTGGCGCCCAGG - Intergenic
926268133 2:11344507-11344529 GCCCCGGGAGGCTGAAGCCCAGG + Exonic
931253823 2:60554047-60554069 GCACCGGGAGGCTGCAGCCCCGG + Intergenic
933858459 2:86441536-86441558 GGCCCGGGAGACGGGCGCCCGGG + Intronic
935137842 2:100322568-100322590 GCCGCGGGCTGCTGGCGCGCCGG + Exonic
937283513 2:120736147-120736169 GCCCCGGCTGGCTGGAGCCCCGG + Intronic
938583906 2:132670640-132670662 GCCGCGGGAGCCTGGCGCCCCGG + Intronic
938953991 2:136281982-136282004 GCCGTGGGATGCTGCTGCCCAGG + Intergenic
939612950 2:144332344-144332366 GCCCCGCGAGGCGGGCGCCGGGG + Intronic
942452645 2:176117775-176117797 GCCCCACGCTGATGGCGCCCGGG + Intronic
942947034 2:181683191-181683213 GCGTCGCGATGCCGGCGCCCCGG - Intergenic
946411995 2:219520088-219520110 GCCCCAGGCTCCTGGCCCCCCGG - Intronic
947753364 2:232544256-232544278 GCCCCGGTATGCTGCCTCCATGG + Intronic
948454915 2:238100479-238100501 GCTGCTGGAGGCTGGCGCCCTGG + Exonic
948887265 2:240890505-240890527 ACCCCTGGAGGCTGCCGCCCTGG - Intronic
1169065864 20:2693756-2693778 GCGCCGCGGTGCTGGCGTCCAGG - Exonic
1171398924 20:24859178-24859200 GCACCAGGATGCTGGCACCAGGG - Intergenic
1172273888 20:33669524-33669546 ACCCTGGGATTCTGGCCCCCTGG + Intronic
1173383208 20:42565058-42565080 GCCCTGGTGTTCTGGCGCCCCGG + Intronic
1173506514 20:43591202-43591224 AGCCCGGGTTCCTGGCGCCCCGG + Intronic
1174287672 20:49483944-49483966 GCCCCAGGAGGCGGCCGCCCTGG - Intergenic
1175905996 20:62379738-62379760 GCTCCGGAATGCTGGGGCCTGGG + Intergenic
1175996010 20:62812668-62812690 GCCCCAGGATGCGGGACCCCTGG + Exonic
1176070730 20:63224939-63224961 GCGCCAGGATGCTGGCCCCTTGG + Intergenic
1176368097 21:6045679-6045701 GCCCTGGGGTGCTGTTGCCCTGG + Intergenic
1178695711 21:34791916-34791938 GCCGCCGTCTGCTGGCGCCCCGG - Exonic
1179570417 21:42275309-42275331 GCCCAGGGATGCTGGGCCCAGGG - Intronic
1179755422 21:43492863-43492885 GCCCTGGGGTGCTGTTGCCCTGG - Intergenic
1179974118 21:44854041-44854063 GCCCCATGCTGCTGGTGCCCTGG - Intronic
1180099967 21:45579532-45579554 GCCCTGGGATGCCGGTGCCCTGG + Intergenic
1180100106 21:45579887-45579909 GCCCTGGGACGCGGGTGCCCCGG + Intergenic
1180174120 21:46079237-46079259 GCCCCGGGCTGCCGGTCCCCTGG - Intergenic
1180636022 22:17263747-17263769 CACCAGGGATGCTGCCGCCCTGG - Intergenic
1181547200 22:23608846-23608868 GCCCAGGGATGCTGGCGTGGAGG - Intronic
1181729159 22:24832025-24832047 CCCCCGGAATCCTGGCTCCCTGG + Intronic
1181934635 22:26429644-26429666 GGGCCGGGATGCGGGCGCCCGGG - Intronic
1183062119 22:35342618-35342640 GCTCTGGGATGCCAGCGCCCTGG - Intronic
1183728877 22:39605864-39605886 GACAGGGGATGCTGGAGCCCAGG + Intronic
949414304 3:3799546-3799568 GCCTAGGGATGCCGCCGCCCGGG - Exonic
950107038 3:10394852-10394874 GCCCCGCCATCCTGGCCCCCTGG + Intronic
952902993 3:38121867-38121889 GTCCCTGCATGCTGGCTCCCAGG + Intronic
953875333 3:46663459-46663481 GCCCAGGCATGCTGTCACCCAGG + Intergenic
954558914 3:51539218-51539240 GGCTCTGGATGCTGGCGCCCCGG + Intergenic
954685877 3:52369902-52369924 GCCCCAGGATGCTGGGCTCCAGG - Exonic
959078837 3:101779270-101779292 GGCCAGGGATCCTGACGCCCCGG - Intronic
961442660 3:126962057-126962079 GCCCCTGGAAGCTGGCTCTCTGG - Intergenic
968450899 4:675499-675521 GACCCGTGATCCTGGCGGCCTGG + Intronic
969252693 4:5980118-5980140 GCCCCGGGGTGTGGGAGCCCTGG + Intronic
969297425 4:6278152-6278174 GAGGCGGGATGCTGGGGCCCTGG + Intronic
969476670 4:7426034-7426056 GCCCCGGGATGCTGGAGGCGTGG + Intronic
969705007 4:8786890-8786912 GGCCCTGGAGGATGGCGCCCGGG - Intergenic
972265431 4:37454538-37454560 CCCCAGGGGTGCTGGCGGCCTGG + Intronic
982288843 4:153760099-153760121 GAACCGGGGTGCTGGCGACCGGG - Exonic
984481530 4:180309840-180309862 GCCCCTAGATGCTGGCAGCCTGG + Intergenic
985657094 5:1137831-1137853 GCCCCGGGGAGCTGGTGCCGGGG - Intergenic
985828201 5:2208187-2208209 GACCTGGGATGCTGCCGGCCGGG - Intergenic
989274598 5:39572230-39572252 GCACCTGGATGCTGGTGACCTGG + Intergenic
991587810 5:68216715-68216737 GCTCCGGGTTGCAGGCTCCCTGG - Intronic
993716558 5:91280653-91280675 GCCCCGGGCTGCGGCCGCCCAGG - Intergenic
997302067 5:132813593-132813615 GCCCTGGGTTCCTGGCTCCCGGG - Exonic
998019051 5:138754051-138754073 GAACCGGGAGGCTGGAGCCCGGG + Intronic
999218230 5:149954087-149954109 GCCCCGGGAGGCCGGAGCCTGGG - Intergenic
1002093477 5:176817810-176817832 GCTGCGGGAGGCTCGCGCCCGGG + Intronic
1002709211 5:181184151-181184173 GCCCCGGGATCTCGGCGCGCAGG - Intergenic
1003076122 6:2985173-2985195 CCCCTGGGATCCTGCCGCCCTGG + Intergenic
1007450102 6:41935987-41936009 GCCCTTGGCTGCTGGAGCCCCGG + Exonic
1014230376 6:118895275-118895297 GCGCCGGGATGCTGGCGCGCAGG + Intronic
1017830101 6:158118986-158119008 GGCCCTGGTTGCTGGGGCCCTGG - Intronic
1019365137 7:629282-629304 GCCCTGGGGTGGTGGCGCCCTGG - Intronic
1019365221 7:629562-629584 GCCCTGGGGTGGTGGCGCCCTGG - Intronic
1019365308 7:629842-629864 GCCCTGGGGTGGTGGCGCCCTGG - Intronic
1019365326 7:629898-629920 GCCCTGGGGTGGTGGCGCCCTGG - Intronic
1019365345 7:629954-629976 GCCCTGGGGTGGTGGCGCCCTGG - Intronic
1019365364 7:630010-630032 GCCCTGGGGTGGTGGCGCCCTGG - Intronic
1021740374 7:23680320-23680342 GCCCAGGGATCCTGGCCCCTCGG - Intronic
1022113790 7:27246284-27246306 GCCCCGGGCTGCCGCCGCCTCGG + Exonic
1023810241 7:43906310-43906332 CCCCCGGGATGCGGGGGTCCGGG - Intronic
1025943390 7:66089225-66089247 GACCCGGGATCCTGCCCCCCTGG - Intronic
1032080191 7:128854791-128854813 GACCCGGGAGGCTGGCGCTGGGG + Exonic
1033361868 7:140643632-140643654 GCCCCCCCATGCTGGCTCCCTGG + Intronic
1033406144 7:141073115-141073137 GCCCCGGGAGCCTGCCGCCCAGG - Intergenic
1034928184 7:155140356-155140378 GCTCAGGGATGCTGGGGCTCAGG - Intergenic
1034928197 7:155140404-155140426 GCTCAGGGATGCTGGGGCTCAGG - Intergenic
1034928202 7:155140420-155140442 GCTCAGGGATGCTGGGGCTCAGG - Intergenic
1034928221 7:155140484-155140506 GCTCAGGGATGCTGGGGCTCAGG - Intergenic
1034928230 7:155140516-155140538 GCTCAGGGATGCTGGGGCTCAGG - Intergenic
1034928247 7:155140580-155140602 GCTCAGGGATGCTGGGGCTCAGG - Intergenic
1034928252 7:155140596-155140618 GCTCAGGGATGCTGGGGCTCAGG - Intergenic
1034928261 7:155140628-155140650 GCTCAGGGATGCTGGGGCTCAGG - Intergenic
1034928266 7:155140644-155140666 GCTCAGGGATGCTGGGGCTCAGG - Intergenic
1034928275 7:155140676-155140698 GCTCAGGGATGCTGGGGCTCAGG - Intergenic
1034928280 7:155140692-155140714 GCTCAGGGATGCTGGGGCTCAGG - Intergenic
1034928289 7:155140724-155140746 GCTCAGGGATGCTGGGGCTCAGG - Intergenic
1034928294 7:155140740-155140762 GCTCAGGGATGCTGGGGCTCAGG - Intergenic
1035387649 7:158485019-158485041 CTCCCGGGACGCTGGCGGCCGGG - Intronic
1036748616 8:11428725-11428747 TCCCCGTGATGCGGGAGCCCTGG + Intronic
1036808980 8:11854203-11854225 AGCCCTGGATGCAGGCGCCCAGG - Intronic
1037595341 8:20349967-20349989 GCCCCGGGATGCTGAGCCCCTGG + Intergenic
1041098532 8:54373474-54373496 CCCCTGGGGTGCTGGCTCCCCGG - Intergenic
1048999140 8:139813661-139813683 GCCTCGGAAAGCTGGTGCCCAGG + Intronic
1049611090 8:143555654-143555676 GCCCCTGGAAGCCAGCGCCCTGG - Intronic
1049657679 8:143805957-143805979 GCCCCCGGATGCCCGTGCCCCGG + Intronic
1054870608 9:70044429-70044451 GCCCGGGGATGCTGGGGGACAGG + Intronic
1055308212 9:74952254-74952276 CCCCCGGGAGCCGGGCGCCCGGG + Exonic
1059471117 9:114505377-114505399 GCCCCGGGATGCAGCCGCCCGGG + Intronic
1060201065 9:121651959-121651981 GCCCTGGGATGCTAGGGACCGGG + Intronic
1061119357 9:128633773-128633795 GCCCCGGGAAGCTGAGGACCTGG - Exonic
1061180012 9:129019614-129019636 GACCCGGGATGCTTGAACCCAGG + Intronic
1061257791 9:129462703-129462725 GCCTGGGGATGCTGGGGTCCAGG + Intergenic
1061258789 9:129467792-129467814 GCCCAGGGAGGCTGGTGTCCTGG - Intergenic
1062004900 9:134234156-134234178 GCCCCTGGAGGCTGCAGCCCAGG - Intergenic
1062024672 9:134334817-134334839 GGCCTGGGTTGCTGGCGTCCAGG + Intronic
1062039465 9:134397399-134397421 GCCCCGGAATGCCAGCACCCAGG - Intronic
1062165454 9:135105262-135105284 GCCCCGGCAACCTGGCTCCCGGG - Intronic
1202799633 9_KI270719v1_random:163492-163514 GCCCAGGGGTGCTGGAGCCGGGG + Intergenic
1199772639 X:150984152-150984174 GCCCCGGGCCGCGGGCGCCGGGG - Intronic
1199790785 X:151153230-151153252 GGCTGGGGATGCTGGAGCCCCGG - Intergenic
1200216553 X:154370631-154370653 GCCCCGGCTGGCCGGCGCCCAGG - Intronic
1200233716 X:154458479-154458501 CCCCCGGGCTGCCGGAGCCCCGG - Intronic
1200753586 Y:6969220-6969242 AGCCAGGGATGCTGGCACCCTGG + Intronic