ID: 1126791585

View in Genome Browser
Species Human (GRCh38)
Location 15:52226501-52226523
Sequence CTGGAGCCCTTAAATACTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 135}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126791585_1126791591 4 Left 1126791585 15:52226501-52226523 CCCTGAGTATTTAAGGGCTCCAG 0: 1
1: 0
2: 2
3: 14
4: 135
Right 1126791591 15:52226528-52226550 TGTTTCTACAGAGAGTAAGCAGG 0: 1
1: 0
2: 2
3: 12
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126791585 Original CRISPR CTGGAGCCCTTAAATACTCA GGG (reversed) Intronic
900983574 1:6060212-6060234 CTGGAGCCCTGCCATACTCCTGG + Intronic
902625559 1:17674218-17674240 CTGGAGCCCTGGAAGGCTCAGGG - Intronic
903127960 1:21260542-21260564 CAGGGGCCCTCACATACTCACGG - Intronic
905182327 1:36175096-36175118 CTGGAGCCCTCACATACTCCAGG + Intronic
905251002 1:36648306-36648328 CTGGACCCCTGAACTGCTCAGGG + Intergenic
906696830 1:47828786-47828808 GTGGAGCCCTTAAAAGATCAGGG + Intronic
906728520 1:48061602-48061624 CTGGAGCCCTGAAATCACCATGG + Intergenic
907262144 1:53227137-53227159 CTGGATCCCTAAAATACAAAAGG + Exonic
908177444 1:61569701-61569723 CTGGAGTCCCTCAAAACTCAAGG - Intergenic
909049715 1:70753222-70753244 CTGGAGCTCTTCACTGCTCAGGG + Intergenic
911505239 1:98740987-98741009 TTGGAGCCCTTAAATGATCAGGG + Intronic
912244502 1:107946811-107946833 CTGGATCCCTCAACTACCCAAGG + Intronic
913425867 1:118728843-118728865 TTGGAGCCCTTATATACTGCTGG + Intergenic
916597444 1:166257942-166257964 CTGGAGTCCTGAAGTCCTCAGGG + Intergenic
919790936 1:201290525-201290547 CTGCAGCTCTCAAATACCCAAGG - Intronic
921320330 1:213932235-213932257 CATAAGCCCTTAAATACTAAGGG - Intergenic
921507341 1:215988620-215988642 CTGGAACCCTTAAATACTGTTGG - Intronic
922899480 1:229124871-229124893 TTGGGGCCCTTGGATACTCAGGG - Intergenic
1065604503 10:27403477-27403499 CTGGAGACCTTTAATTCCCAGGG + Intronic
1078283589 11:9928475-9928497 CTGGAACTCTCATATACTCATGG + Intronic
1082881991 11:58046895-58046917 CTGGTGACCTTAGATACTTAGGG + Intronic
1083327418 11:61879836-61879858 CTGGAGCCCTGGACTTCTCAGGG + Intronic
1095501800 12:42847857-42847879 TTGGAGCCCTTTAATTCTTAAGG + Intergenic
1099445015 12:82742040-82742062 CTGGAGCCCATAAAAATTCTAGG + Intronic
1102195154 12:111020182-111020204 CTGGAGCCCTCATACACTCTAGG - Intergenic
1106570104 13:30919459-30919481 CTGGGGTCATTATATACTCATGG - Intronic
1106845095 13:33729964-33729986 ATGGAGCACTTAGATACTCTGGG - Intergenic
1107406327 13:40117582-40117604 CTGGGGCTGTTATATACTCAAGG - Intergenic
1109697030 13:65974234-65974256 ATGGAGCCCTTATATACTGTTGG - Intergenic
1110602347 13:77389116-77389138 CAGCAGCCCTGAAATACTGAGGG - Intergenic
1112625205 13:101096101-101096123 CTGGAACCCTTACATACTGGTGG + Intronic
1113230716 13:108212084-108212106 ATGTAGTCATTAAATACTCAGGG - Intronic
1114593841 14:23894234-23894256 ATGCACTCCTTAAATACTCAGGG + Intergenic
1115129054 14:30031651-30031673 CTGGAGCCCTGAAATGCTTGGGG + Intronic
1115868942 14:37778682-37778704 CTGGACCCCTCCAATAGTCAGGG + Intronic
1116928333 14:50664883-50664905 CTGGAGACATTAAATTCTCTAGG + Intronic
1118053963 14:62058724-62058746 CTGGAGCCCTCATACACTCCTGG - Intronic
1120360247 14:83491567-83491589 CTGATGCCCATAATTACTCAGGG - Intergenic
1122587757 14:102821733-102821755 GTGTGGCCTTTAAATACTCAGGG + Intronic
1126481237 15:49122786-49122808 CTGTAAGGCTTAAATACTCAAGG - Intronic
1126791585 15:52226501-52226523 CTGGAGCCCTTAAATACTCAGGG - Intronic
1129376559 15:75137425-75137447 CTGCAGCCCTTCACTAATCATGG - Intergenic
1130313798 15:82777900-82777922 CTGGAACCCTTATATACTGTTGG + Intronic
1131543244 15:93292371-93292393 TTGTAGACTTTAAATACTCAAGG - Intergenic
1131925627 15:97380405-97380427 CTGCAGCCCTTAAATGCAAAAGG - Intergenic
1132769059 16:1550967-1550989 CTGGTGCCCTCGAATGCTCACGG - Intronic
1136515193 16:30764087-30764109 ACTGAGCCCTTCAATACTCATGG - Intronic
1136530090 16:30862228-30862250 CTGTAGCCCAGAAATAGTCAGGG - Intronic
1138943240 16:61815648-61815670 CTGAAGCCCTTACATGCTCCTGG + Intronic
1145407604 17:22619031-22619053 CTGTAGCTCTCAAATACTGATGG + Intergenic
1148716183 17:49717745-49717767 CTGCAGGCCTGAAATACTCAGGG - Intronic
1149173658 17:53843895-53843917 CTGGAGCCCTTCAAGAAACAAGG + Intergenic
1150719026 17:67598532-67598554 CTGGGGCCCTTAAAACCTAAGGG - Intronic
1154103065 18:11494644-11494666 CTGCAGCCCTCCAATTCTCATGG - Intergenic
1157401157 18:47389651-47389673 ATAGAGCCCCTAAATACACATGG - Intergenic
1161334319 19:3704226-3704248 CTGGAGCCTTAAAATGGTCAAGG - Intergenic
1162049907 19:8026818-8026840 CTGATGCCCTCAAATCCTCATGG + Intronic
1163394059 19:17048772-17048794 CTGGAGCCCTTTAATATTGAGGG - Intergenic
1166271137 19:41714851-41714873 CCTGAGCCCTTAAAAACCCACGG - Intronic
1167734585 19:51284982-51285004 CTGGTGCATTTAAATACTGATGG + Intergenic
925014153 2:509215-509237 CTGTAGCCCTGAAGTTCTCAGGG - Intergenic
925955398 2:8959080-8959102 CTGGTGCCCTTATAGTCTCAGGG - Intronic
927313817 2:21659004-21659026 CTGGAGCCCTTAGAGCCTCAGGG + Intergenic
927530274 2:23791376-23791398 CTGGAGTCCTTATATACTGCTGG - Intronic
928700038 2:33889271-33889293 CTGGAACCCTTAAAAAATCTGGG + Intergenic
929476002 2:42249799-42249821 CTGGCCACCTTAAAAACTCATGG - Intronic
931727451 2:65125137-65125159 CTGGAGCCATGATATACTTAAGG + Intronic
932438151 2:71715387-71715409 TTGGAGCCCTTTTATACACAGGG + Intergenic
935029089 2:99304880-99304902 ATGGAGCCCTTATACACTCTAGG + Intronic
939091542 2:137786084-137786106 CTGGATCCCTCAAAGCCTCAGGG + Intergenic
940284465 2:152019995-152020017 ATGAAGCTCTTAAAAACTCAAGG + Intronic
941283554 2:163581713-163581735 CTGGTTCCCTTAAATACTGGGGG - Intergenic
943550320 2:189330917-189330939 CTGGATCACATATATACTCATGG - Intergenic
945817811 2:214627112-214627134 CAGAAGGCCTTGAATACTCAAGG + Intergenic
946721055 2:222608282-222608304 CTGGAGCCCTCAAATAATGGAGG - Intronic
947138659 2:227000691-227000713 CTGGAGCCCCTAGAAACCCAAGG - Intergenic
948028713 2:234799369-234799391 CTGCACCCCTTAAAACCTCAGGG + Intergenic
1169690530 20:8325873-8325895 CTGGAGCTTTTAAATATCCAAGG - Intronic
1169798569 20:9492580-9492602 TTGGAGCCCTCAAAGACACAGGG + Intergenic
1173614539 20:44394271-44394293 CTGGAGCCCCTGAATACCCGAGG + Intronic
1173948109 20:46967842-46967864 CTGGAGGCCTCCAATACACAAGG - Intronic
1174503403 20:51001647-51001669 ATGGAGCCCTTTAAAATTCAGGG - Intergenic
1177028079 21:15947055-15947077 CTGCAAACTTTAAATACTCATGG + Intergenic
1177659373 21:24063066-24063088 CTGGAAGCCTTTAATCCTCATGG - Intergenic
1179138505 21:38701300-38701322 TTGGAGGCCTTAAATACAGAAGG + Intergenic
1179457003 21:41507218-41507240 CTGGAGCACTTGACCACTCAGGG + Intronic
1180002318 21:45000964-45000986 CTGGACCCCGCAAGTACTCATGG + Intergenic
1181368620 22:22398956-22398978 CTGGAGCCCAGAGATGCTCAGGG - Intergenic
1182412087 22:30195868-30195890 CTGCAATCCTTAAAAACTCATGG + Intergenic
1183520749 22:38294894-38294916 CAAGAGCCCTTAACTACTCAAGG + Intronic
950818123 3:15729066-15729088 CTGGAGCATTTAATTACTGATGG - Intronic
953743589 3:45556783-45556805 CTGCAGCCCCTAGATACTCAGGG + Intronic
953841079 3:46390688-46390710 CTGCAGCCCAGGAATACTCAGGG + Intergenic
959465994 3:106688342-106688364 CTGGAGCTCTTAAATATTTAAGG + Intergenic
963251417 3:143106685-143106707 GTGGAGCCCTTAAACAAACAGGG - Intergenic
963855175 3:150245980-150246002 CTGGAGCTCTTTCATCCTCAGGG - Intergenic
964376847 3:156056244-156056266 CTCCAGCCATTAAAGACTCAAGG + Intronic
965063370 3:163809959-163809981 CTTGAACCCATAAATACTCTCGG + Intergenic
965278804 3:166722291-166722313 ATGGAGCCCTTCAATAAACAGGG + Intergenic
967515588 3:190364905-190364927 GAGAAGCCCTAAAATACTCAGGG - Intronic
973082951 4:46017295-46017317 ATGAAGCCCTTAATTGCTCATGG - Intergenic
974650738 4:64750664-64750686 CTAAAACCCTTAAAAACTCAAGG - Intergenic
975749842 4:77511610-77511632 CTGGGACCCTGAAATGCTCAGGG - Intergenic
977034237 4:91929356-91929378 GTGAAGCACTTAAATACTTAAGG - Intergenic
978663776 4:111157914-111157936 CTGGAGGACTTAAATACATAGGG + Intergenic
979227070 4:118298698-118298720 CTGGAGCCCTAAACAAGTCAAGG - Intronic
980091764 4:128450290-128450312 ATGGAGCTCTTAAAAACACAGGG - Intergenic
981366575 4:143911220-143911242 CTGGAGACATTAAATTCTCTAGG + Intergenic
981817375 4:148846527-148846549 CTGGAAAACTTAAATACTAAGGG + Intergenic
983525255 4:168754091-168754113 CTAGAGGCTCTAAATACTCAAGG - Intronic
986614272 5:9600682-9600704 CTGGAGCCCTTAAGTCCTCCAGG + Intergenic
989459584 5:41682175-41682197 CTGGAGCCCTTAATCACTCCTGG + Intergenic
990179846 5:53148615-53148637 TTTGAGCAGTTAAATACTCAGGG + Intergenic
990554528 5:56917896-56917918 CTGGATCCCTCAAAAATTCATGG + Intergenic
994244579 5:97465761-97465783 CTGGAGCCCTTCAAGAATCAAGG + Intergenic
995652113 5:114381472-114381494 TTAGAGCCCTTAGATTCTCATGG - Intronic
998820340 5:146052296-146052318 CTGGAGCCTTGAAATACACTGGG - Intronic
999629078 5:153551488-153551510 CTGGAGCCTTTAAAGACTACTGG - Intronic
1001076245 5:168630161-168630183 CTGGTGCCCTTGCCTACTCAGGG - Intergenic
1005775865 6:29130162-29130184 CTGAAGCCCATAAAAACTCCCGG + Intergenic
1006510148 6:34517035-34517057 CTGGAGCCCTGAGATGCCCATGG - Intronic
1007212478 6:40206464-40206486 CAGGAGACCTGAAATCCTCAGGG + Intergenic
1007790837 6:44307228-44307250 CTGTAGCCCTTCCAGACTCACGG + Exonic
1010378752 6:75204127-75204149 CTAGACCCCTTAGATACTTAGGG - Intronic
1010501745 6:76609678-76609700 CTGCAGCTCTTAACTCCTCACGG - Intergenic
1011230969 6:85161696-85161718 CAGGAGCAGTTAAGTACTCAGGG + Intergenic
1012473742 6:99599412-99599434 CTGAAGCCCTTATACACTCCTGG + Intergenic
1015916399 6:138221834-138221856 CTAGAGCTCCTAAATACTCAAGG - Intronic
1019217714 6:170454352-170454374 ATGGTGCCCTGAAACACTCACGG + Intergenic
1019413000 7:914704-914726 CTGGAGCCCCTGAACACACAAGG + Intronic
1022151029 7:27606596-27606618 CTGGAGGCAATAAATACTCTTGG - Intronic
1022553939 7:31272589-31272611 CTGGAGCCCTGAAATTCTGCTGG - Intergenic
1022781898 7:33594088-33594110 CTGGAGCCCTTATACCCTAAGGG + Intronic
1026573931 7:71556142-71556164 CTGTAGCCCTTAAATACGCAAGG + Intronic
1031355097 7:120780062-120780084 CTGTAGCCCTGGAATAGTCAGGG + Intergenic
1032180227 7:129669715-129669737 CTGGAACCCTTATATACTATAGG + Intronic
1034746628 7:153529202-153529224 CTGGAGGCTTTAAATACTCAAGG - Intergenic
1040983549 8:53269507-53269529 CAGGAGACCTTGAATCCTCAGGG + Intergenic
1043717804 8:83508070-83508092 CTGTAGCCCATGAATAGTCAGGG + Intergenic
1048263032 8:132961673-132961695 CCGGAACCCTTCAATAGTCAGGG - Intronic
1049159187 8:141086532-141086554 CTGGAGCCCTCACAGCCTCACGG + Intergenic
1054840118 9:69729459-69729481 CTGTAGCCCTTCAATAATGAGGG - Intronic
1056483748 9:87033476-87033498 CATAAGCCCTTAAATTCTCATGG + Intergenic
1058164762 9:101606865-101606887 CTGGAGCTCTTAAATTCACTTGG + Intronic
1059807701 9:117821714-117821736 CTGGGCCCCTTAAATACAAAGGG + Intergenic
1185454279 X:300230-300252 CTGGAGCCCTTACAGACCCAGGG + Exonic
1186975694 X:14901690-14901712 CTGGAGGCCTTAAGGAATCAGGG - Intronic
1189174959 X:38947174-38947196 CTGGTTCACTAAAATACTCATGG - Intergenic
1192150707 X:68710660-68710682 CTGCAGCCCTCAGTTACTCATGG - Intronic
1196525382 X:116723878-116723900 CTGTAGCCCAGAAATAGTCAGGG + Intergenic
1198089139 X:133310550-133310572 ATGTATCCCTTAAATTCTCAGGG + Intronic
1201977623 Y:19869793-19869815 CTGGAGCCAGCAAATACTCCTGG + Intergenic