ID: 1126795244

View in Genome Browser
Species Human (GRCh38)
Location 15:52255206-52255228
Sequence GAACCCAAGGTCCCAGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 251}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126795244 Original CRISPR GAACCCAAGGTCCCAGAGGG AGG Intronic
900607698 1:3531195-3531217 GAGCCCAAGGCACCAGAGCGCGG + Intronic
901922764 1:12548400-12548422 GAACCCACTTTTCCAGAGGGAGG + Intergenic
903337823 1:22636705-22636727 GAGGCCAGAGTCCCAGAGGGAGG + Intronic
903831520 1:26178093-26178115 GGGCCCAAGGACCCAGAAGGGGG + Intronic
905137038 1:35808084-35808106 GGACCCAGGGTCCCGGCGGGCGG - Intergenic
905514485 1:38552103-38552125 GAAACCCAGGGCCCAGAGAGGGG - Intergenic
906624521 1:47314116-47314138 GACCCCAACGTCCCAGAGGCGGG - Exonic
906804454 1:48766778-48766800 GGACCCATGTTCCCAGAGTGAGG + Intronic
907482071 1:54752074-54752096 GAACCTGAGCTCCCAGTGGGGGG + Intergenic
907516274 1:54995272-54995294 GAACTCAAGCCCCCACAGGGTGG - Intergenic
910803510 1:91167667-91167689 GAGGCTAAGGTGCCAGAGGGAGG - Intergenic
911348107 1:96721564-96721586 GAACGCCAGGTTCCAGAGGACGG + Intergenic
916479576 1:165202713-165202735 GATCCCAGAGTCCCAGAGTGGGG - Exonic
918360714 1:183754545-183754567 GATTCCCAGGTCCCAGAGGATGG - Intronic
918428229 1:184432472-184432494 GAACACAAGGACACAGAGAGGGG + Intronic
918438275 1:184539729-184539751 GTGCCCATGGACCCAGAGGGAGG - Intronic
918508606 1:185285154-185285176 GAACCCAGGGGCCCACGGGGAGG - Intronic
919154317 1:193742360-193742382 GAACCCATGGACACAGAGAGGGG - Intergenic
920786897 1:209050723-209050745 GGGACCAAGATCCCAGAGGGAGG + Intergenic
922385399 1:225076165-225076187 GAACCCAAGGCCACTGAAGGTGG + Intronic
923659186 1:235943947-235943969 GGACCCAAGGTTCCAGCGAGAGG - Intergenic
924486410 1:244487721-244487743 GGACCCAAGGTGCCAGAGCATGG + Intronic
1063307347 10:4917044-4917066 GAACACATGGACCCAGAGAGGGG + Intergenic
1063653455 10:7963610-7963632 GAACACATGGACACAGAGGGAGG + Intronic
1064276066 10:13906080-13906102 GATGCCAAGGTCCCAGACTGGGG - Intronic
1064562292 10:16605127-16605149 GAACACAAGGCCTAAGAGGGAGG - Intronic
1064920233 10:20508822-20508844 GACCCCAAGGTCAGAGAGGAAGG + Intergenic
1067435636 10:46274316-46274338 GAAGCCCAGGTCACACAGGGAGG - Intergenic
1067525492 10:47036001-47036023 GACCCCAAGGTCCCAGGTGTGGG + Intergenic
1068565922 10:58575220-58575242 GAACCCATGGACACAGAGAGGGG - Intronic
1070344714 10:75530669-75530691 GAAACCAAGGGCCTAGTGGGAGG - Intronic
1071570605 10:86694667-86694689 GATCCCATGGACCCAGAGGCAGG + Intronic
1073007856 10:100338576-100338598 GAATCAAAGGACCCAGTGGGAGG + Intergenic
1073114966 10:101086859-101086881 GAAAACAGGGTCCCAGAAGGAGG + Intergenic
1073721948 10:106182718-106182740 GCAGCCAAGGTCCAAGAGGTAGG + Intergenic
1074056071 10:109923615-109923637 GAACCCCAGGTCCGGGAGTGTGG - Intergenic
1075911762 10:126131182-126131204 GCACCCAGGGTCCCCGAGGCAGG - Intronic
1076005126 10:126942629-126942651 GATCCCAGGGTCCCAGATGACGG - Intronic
1076128100 10:127992081-127992103 GAACCCAAGAACCTAGAGGATGG + Intronic
1076514187 10:131033895-131033917 ACACCCAGGGTCCAAGAGGGAGG + Intergenic
1077252337 11:1566182-1566204 GAACCCCAGGGCCCACAGGAAGG - Intronic
1077304601 11:1863473-1863495 GCATCCAAGGTCACAGAGTGAGG - Intronic
1077538046 11:3133892-3133914 GACCCCAAGGTCCCCTAAGGAGG + Intronic
1078938444 11:15973827-15973849 TCACCCTAGATCCCAGAGGGTGG + Intronic
1079071819 11:17353570-17353592 GGACCCAAGGCCCCTGAGGAGGG - Intronic
1083683253 11:64360917-64360939 GGCCCCAAGGTCCCAGAGAGAGG - Intronic
1084051119 11:66600587-66600609 GGACCCAAAGTCTCAGAGGCAGG + Intronic
1085729010 11:78980531-78980553 GAGCCCAAGGTCCTATAGGAAGG + Intronic
1088167013 11:106950929-106950951 GAACACATGGTCACAGAGAGGGG - Intronic
1088776803 11:113093207-113093229 GCACCCTAGCTCCCAGATGGAGG + Intronic
1089138281 11:116266713-116266735 GAACCCAAGGTTCCACAGCTGGG - Intergenic
1090357238 11:126148093-126148115 GACCCCATGGCCCCAGAGGCAGG - Intergenic
1093431061 12:19085347-19085369 GAAGGCAAGGACCCAGAGGCCGG - Intergenic
1093535532 12:20218665-20218687 TAACCCAAGGACCCTGTGGGAGG + Intergenic
1093769654 12:23003683-23003705 GAACCCATGGTCCCAGGGAAAGG - Intergenic
1096720011 12:53514193-53514215 GTACCCAAGGCCACAGAGGGAGG - Exonic
1099719463 12:86342133-86342155 GAAACAAAGCTCCCAGAGGGAGG + Intronic
1101948570 12:109156785-109156807 GAACCGAAGTTCCTGGAGGGCGG - Intronic
1102483780 12:113242422-113242444 TTGCCCAAGGTCACAGAGGGAGG - Intronic
1104171060 12:126281062-126281084 GACCCCTGGATCCCAGAGGGTGG + Intergenic
1105026464 12:132852587-132852609 GGACCCAGGACCCCAGAGGGAGG + Intronic
1105675739 13:22670033-22670055 GCACCCAGCGTCCCAGAGGAGGG - Intergenic
1106868716 13:33995815-33995837 GAAATCAAGGCCCCAGAGGCAGG - Intergenic
1107996410 13:45865413-45865435 GAAGCAAAGCACCCAGAGGGTGG - Intergenic
1108112294 13:47088129-47088151 GAACCCAAGATCAAACAGGGTGG - Intergenic
1109458540 13:62625454-62625476 GAACCCAAGTGCCAAGAGGGCGG - Intergenic
1110035080 13:70672899-70672921 GGAACAAAGCTCCCAGAGGGAGG - Intergenic
1110402846 13:75114143-75114165 GAACACATGGACCCAGAGAGGGG + Intergenic
1111542129 13:89682694-89682716 GAACACATGGTCACAGAGAGGGG + Intergenic
1113794023 13:113046344-113046366 GGACCCAGGGTCCCAGAGCCTGG - Intronic
1114152776 14:20063825-20063847 TCACACAAGGACCCAGAGGGAGG + Intergenic
1117280141 14:54232450-54232472 GAACCCACAGACACAGAGGGTGG + Intergenic
1118138830 14:63057198-63057220 GAACAGAAGGTCACAGAAGGGGG + Intronic
1118917301 14:70118328-70118350 GAACGCAAGGTGTCAGAGGGTGG - Intronic
1122716168 14:103698262-103698284 GGAGCCAAGGACCCAGAGGTGGG + Exonic
1122942740 14:104989714-104989736 TGGCCCAAGGCCCCAGAGGGAGG + Intronic
1122985261 14:105208884-105208906 GCACCCAGGGGCCCCGAGGGAGG - Intergenic
1123063747 14:105606073-105606095 GCACCCAGGGTCCCAGGGGCAGG - Intergenic
1202873531 14_GL000225v1_random:187753-187775 GAACACCAAGTCCCAGAGGCAGG + Intergenic
1124049972 15:26187860-26187882 CAACCCAAGGTCCCATAGTGGGG + Intergenic
1124828056 15:33119341-33119363 GCACCCATGGTGCCAAAGGGTGG + Intronic
1124909570 15:33905696-33905718 GCACCTGTGGTCCCAGAGGGAGG + Intronic
1125671526 15:41476900-41476922 GAACCCCAGGCCTCACAGGGTGG - Intronic
1126343451 15:47668734-47668756 GAACCCCAGGTACAAGGGGGAGG - Intronic
1126525890 15:49653901-49653923 GGAGCCAAAATCCCAGAGGGAGG + Exonic
1126671703 15:51121250-51121272 TCACCCAAGGTCACAGAGGGAGG + Intergenic
1126795244 15:52255206-52255228 GAACCCAAGGTCCCAGAGGGAGG + Intronic
1126962886 15:54017873-54017895 GAAGCCAAGCTCCAAGAGGATGG - Intronic
1128254771 15:66188588-66188610 GGACCCCAGGGCCCAGAGGGAGG + Intronic
1128563509 15:68683821-68683843 GAACCAAAGGTCCCTCAGTGAGG + Intronic
1129376762 15:75138507-75138529 CTTCCAAAGGTCCCAGAGGGGGG + Intergenic
1132470972 16:102790-102812 GGCCCCAAGGTCCCAGAGGAGGG + Intronic
1132806527 16:1777608-1777630 GGCCCCAGGGTCCCAGGGGGTGG - Intronic
1134145397 16:11756862-11756884 CAAGCCACAGTCCCAGAGGGCGG + Intronic
1134187021 16:12092380-12092402 GAAACCGAGTTCCCAGAGGGCGG + Intronic
1138339077 16:56276842-56276864 AATCTCCAGGTCCCAGAGGGAGG - Intronic
1138634382 16:58325280-58325302 TTACACAAGGTCCCAGAGGCAGG - Intronic
1138659779 16:58510180-58510202 GAGCCCTAGGGCCCACAGGGAGG + Intronic
1139097467 16:63722066-63722088 GAACACATGGTCACAGAGAGGGG - Intergenic
1139323980 16:66137451-66137473 CATCCCAAGGTCCCAGAGTTAGG + Intergenic
1139466540 16:67156932-67156954 GAGCCCAAGGTCACAGTGGAGGG + Intronic
1140032192 16:71347790-71347812 GCACCCAAGGTCACAGAGCTGGG + Intergenic
1140671724 16:77286153-77286175 GACCCCAAAGTCCCCGAGGCAGG - Intronic
1141588233 16:85049384-85049406 GAACCCAAGGTAGGTGAGGGTGG - Intronic
1141628742 16:85275602-85275624 GACCCCAAGGACCCTGGGGGTGG - Intergenic
1141764895 16:86051852-86051874 GGACCCAAGGTCCCAGCCTGGGG + Intergenic
1142430211 16:90022439-90022461 GAACCTAAGCTCCACGAGGGGGG - Intronic
1142537900 17:632675-632697 GAACGCTGGGTCCCAGAGGCTGG - Intronic
1142978767 17:3659735-3659757 GGAGCCAAGGCCCCAGTGGGAGG + Intronic
1149543115 17:57483628-57483650 GAACCCAAGGCCTCTGAGGAGGG + Intronic
1151418567 17:73982755-73982777 GAAACCAGGGTCACAGAGGAGGG - Intergenic
1151705419 17:75764716-75764738 GAGCCCCAGCCCCCAGAGGGCGG + Intronic
1152989916 18:353740-353762 AAGCCCCAGGTCCCAGAGAGAGG - Intronic
1156576824 18:38326944-38326966 TAACTCAAGGTCTCAGATGGAGG + Intergenic
1158383208 18:56958934-56958956 AAACACAAAGTCCCAGATGGAGG + Intronic
1158639265 18:59189349-59189371 GAAACCCATGACCCAGAGGGAGG - Intergenic
1159129143 18:64260068-64260090 GGTCTCAAGGCCCCAGAGGGTGG + Intergenic
1159529467 18:69637051-69637073 TGACCCAGGGTCCCAGAGTGAGG - Intronic
1160545234 18:79648783-79648805 GGACCCAGGGTGCTAGAGGGGGG - Intergenic
1161032213 19:2062694-2062716 GACCCCAAGGTCCCAGCAGGAGG - Intergenic
1161316005 19:3618028-3618050 GCACCCAAGGCCTGAGAGGGAGG + Intronic
1161423872 19:4191327-4191349 GAACACAAGGTCCCAGTGACAGG - Intronic
1161767642 19:6216157-6216179 CCACCCAAGGCCCCAGATGGGGG + Intronic
1162067247 19:8133266-8133288 GAACTCAACGTCCCAGCGGACGG - Intronic
1162109281 19:8391334-8391356 CAACCCAAAGTCCCAGATGCTGG - Intronic
1163685154 19:18708399-18708421 GAACCCAGGGTGCCCGAGAGAGG + Intronic
1166420693 19:42633794-42633816 GAACCCAGGGTGCAAGAGAGTGG - Intronic
1166496264 19:43305297-43305319 GAACCCAGGGACCAAGAGAGTGG - Intergenic
1166527496 19:43521578-43521600 GAACTGAGGCTCCCAGAGGGAGG + Intronic
925336746 2:3104373-3104395 AAACCCAGGGTCCCAGAGCAGGG + Intergenic
926923024 2:17958121-17958143 GAACCCCATGACCCTGAGGGTGG + Intronic
927809250 2:26172849-26172871 GGACCCGGGGTCCCAGAAGGGGG + Intergenic
927998406 2:27503052-27503074 GAACCCTCAGTACCAGAGGGAGG - Intronic
928172147 2:29010711-29010733 GAACCTGAGCTCCCGGAGGGCGG + Intronic
929406361 2:41647140-41647162 GAAACCAGGTTCCCAGATGGTGG + Intergenic
930584274 2:53251166-53251188 GAACACACGGACCCAGAGAGGGG - Intergenic
931228769 2:60356513-60356535 CCACCCAAGGCCCCAGAGTGTGG + Intergenic
932318387 2:70801758-70801780 CAACCCAAGGTCACAGAGAGTGG + Intergenic
932490181 2:72115368-72115390 GAAGCCCAGGTGCCAGAGGCTGG + Intergenic
933342829 2:81044353-81044375 AAACACAAGGTACCAGAGGCAGG + Intergenic
933748857 2:85590417-85590439 GACCACAAACTCCCAGAGGGAGG - Intronic
933765650 2:85706862-85706884 GGACACAAGGTCCCACAGTGGGG + Intergenic
934682180 2:96291992-96292014 GAAGCCAAGGTCCTGGAGAGGGG + Intronic
937085200 2:119167073-119167095 GAATACAAGGTCACAGAGGGTGG - Intergenic
937250905 2:120523030-120523052 GAAACTGAGGTCCCAGAGGTTGG - Intergenic
940427539 2:153547623-153547645 GAACATAAGCTCCAAGAGGGTGG - Intergenic
941334690 2:164228132-164228154 GAACACAAGGACACAGAGAGGGG + Intergenic
941771770 2:169352804-169352826 GAACACATGGTCACAGGGGGGGG + Intronic
941773965 2:169371881-169371903 GAACCCATGGACCCAGGGAGGGG + Intergenic
942249003 2:174032152-174032174 TCACCCAAGGTCACACAGGGAGG - Intergenic
944351058 2:198727029-198727051 GAACACATGGACACAGAGGGGGG + Intergenic
946981417 2:225220141-225220163 GAACACACGGTCACAGAGAGGGG - Intergenic
948516922 2:238509952-238509974 CACCCCAAGGTCCCACAGCGAGG + Intergenic
948585300 2:239015432-239015454 GGACCCACGGACCCATAGGGAGG + Intergenic
949042571 2:241856088-241856110 GAACCCAGGAACACAGAGGGTGG + Intronic
1169873640 20:10273095-10273117 GAACAAAAGTTCCCAGAGGCAGG - Intronic
1171442005 20:25172213-25172235 GAACCCATGGACCCAGAGAGGGG + Intergenic
1172895685 20:38298625-38298647 GGACCCTAGATCCCAGAGAGGGG + Intronic
1173894586 20:46541407-46541429 TTACCCAAGGTCACACAGGGAGG + Exonic
1174159744 20:48542390-48542412 GAATTCAAGCTCCAAGAGGGAGG - Intergenic
1174838046 20:53876632-53876654 GAACACAATGACCAAGAGGGAGG - Intergenic
1175477652 20:59288351-59288373 GAACCCAGGGGCCCCCAGGGTGG - Intergenic
1175525938 20:59633454-59633476 GAACACATGGTCACAGAGAGGGG + Intronic
1175783892 20:61700114-61700136 GCCTCAAAGGTCCCAGAGGGTGG + Intronic
1175944756 20:62553520-62553542 GAGTCCAGGTTCCCAGAGGGTGG - Exonic
1178291422 21:31371923-31371945 GAACCCAAGTTCACCGAGGGTGG - Intronic
1179999143 21:44987262-44987284 GAACCCCAGGGCCGAGAGGCTGG - Intergenic
1180141548 21:45896297-45896319 GAGTCCAAGGTCTCAGAAGGTGG + Exonic
1180284573 22:10731848-10731870 GAACACCAAGTCCCAGAGGCAGG - Intergenic
1181626030 22:24122883-24122905 GTACACCAGGTCCCAGAGGTGGG + Intronic
1181927539 22:26372070-26372092 GAAACCAAGGTCAGAGAGGGAGG - Intronic
1182250123 22:28993439-28993461 GAAACCAAGGTACGAGAGGTGGG + Intronic
1182334092 22:29571532-29571554 ATACCCAAGGTCCCAGCAGGAGG + Intronic
1184149881 22:42631718-42631740 GAACCCAGGGTCCCAAAGGGAGG + Intronic
1184597757 22:45524512-45524534 CTGCCCAAGGCCCCAGAGGGAGG - Intronic
952959217 3:38579338-38579360 GAACCCCAGGCCCCAGGGTGCGG - Exonic
954010917 3:47637413-47637435 GAACACAAAGGCCCAGAGGCTGG + Intronic
955533747 3:59901282-59901304 TTACCCAAGGTCCCACAGGTAGG - Intronic
955647586 3:61156500-61156522 GAACCCAAAGTCCCTGAGACAGG + Intronic
956366235 3:68506077-68506099 GAACACATGGACACAGAGGGGGG - Intronic
957450585 3:80377074-80377096 GAACCCAGGATGCCAGAAGGCGG - Intergenic
957791819 3:84951565-84951587 GAACTCATGGTCGCAGAGAGTGG + Intergenic
958106304 3:89077870-89077892 GAACACATGGACCCAGAGAGGGG + Intergenic
960676700 3:120202343-120202365 GAACACATGGTCACAGAGAGGGG - Intronic
961449435 3:126995809-126995831 GAAACCAAGGCCCCAGAGGATGG - Intronic
962415453 3:135177745-135177767 GAACCCAAGGTAAGACAGGGTGG + Intronic
964899358 3:161639325-161639347 GAACACATGGACACAGAGGGAGG - Intergenic
965851345 3:173029464-173029486 GAACCATAGATCCCAGATGGTGG + Intronic
966340937 3:178924242-178924264 GGAACAAAGCTCCCAGAGGGAGG + Intergenic
966822736 3:183937801-183937823 GAGCTCATGGTCCCAGGGGGCGG + Intronic
967829867 3:193909663-193909685 GAACCCAAGGTGCCTGAGAAGGG - Intergenic
967968653 3:194983692-194983714 GAGCCCAGTGTCCCAAAGGGAGG - Intergenic
968442030 4:629023-629045 GAACCACAGGTCCCAGAAGGCGG + Intronic
968966995 4:3773762-3773784 CAGCCCCAGGTCCCAGAGGCTGG + Intergenic
969443098 4:7228790-7228812 GGACTGAAGGTCCCAGAGGGTGG - Intronic
969443848 4:7233138-7233160 GTCCCCAAGGTACCCGAGGGAGG + Intronic
969621356 4:8280472-8280494 GAACTCAAGTTCCCAGGGGCAGG + Intronic
970004903 4:11400917-11400939 TAGCCCATGGTCCCAGAGGGAGG + Intronic
974806864 4:66891917-66891939 GAACCCATGGTCACATAGAGGGG + Intergenic
975475309 4:74816315-74816337 GAACCCATGGACCCAGGGAGGGG - Intergenic
975739459 4:77414904-77414926 GAAGCCAAGGGCCAAGAGGCAGG + Intronic
976892561 4:90067828-90067850 GAACACAAGGACACAGAGAGGGG - Intergenic
979383686 4:120038481-120038503 AAAACCAAGGACCCAGAGGGTGG + Intergenic
983871388 4:172828362-172828384 GCACCCCACGTCCCACAGGGAGG + Intronic
985235198 4:187865153-187865175 GAACCCATGGACACAGAGAGGGG - Intergenic
985544910 5:504663-504685 GTGCCCATGGCCCCAGAGGGAGG - Intronic
986093938 5:4537592-4537614 GAACCCAGGTGCCAAGAGGGCGG + Intergenic
986548057 5:8920777-8920799 GAAACCAAGATCCCAGAGAAAGG + Intergenic
987454416 5:18125285-18125307 GAACACATGGTCACAGAGAGGGG + Intergenic
987514847 5:18892144-18892166 GAACACATGGACCCAGAGAGGGG + Intergenic
988060015 5:26154466-26154488 GAACCCATGGACACAGAGAGGGG + Intergenic
988480529 5:31626653-31626675 GAACCCATGCTTCCAGAGGCTGG - Intergenic
990093091 5:52080297-52080319 GGACCCAGGCTCACAGAGGGAGG + Intronic
991001744 5:61789913-61789935 AATCCCCAGGTCCCAGAGCGGGG + Intergenic
996030563 5:118699819-118699841 GGACCCAAGGACCCATAGCGAGG + Intergenic
996580786 5:125029927-125029949 ATACCCAAGGTCCCAGAGTGCGG + Intergenic
997377547 5:133408202-133408224 GTAAACAAGGTCCCAGAGGGAGG + Intronic
999318696 5:150600373-150600395 GACCCCAGAGCCCCAGAGGGAGG - Intergenic
1002102201 5:176863148-176863170 GAGCCCAAGTTCCCACAGAGAGG + Intronic
1002394860 5:178944721-178944743 GAACCAAAGGTCCAAGAGAAAGG - Intronic
1010818973 6:80391121-80391143 AATCACAAGGTTCCAGAGGGAGG - Intergenic
1011240812 6:85269297-85269319 GAACACTTGGTCCCAGAGAGAGG - Intergenic
1011284424 6:85707820-85707842 GGACCCAAGGACTCAGAGGGAGG - Intergenic
1012748197 6:103122163-103122185 GAACACAAGGACCCATAGAGGGG + Intergenic
1013911658 6:115282684-115282706 GAACCTGAGGCCCCAGAGGGAGG - Intergenic
1015204383 6:130618437-130618459 GAACCCAGGAACCCAGAAGGCGG - Intergenic
1019211358 6:170407941-170407963 GAACCCAAAGGCCAACAGGGAGG - Intergenic
1019494030 7:1329290-1329312 GCACCAAAGCTCCCAGAGGAAGG - Intergenic
1020019167 7:4852278-4852300 GAAGCCAAGATCCCAGAGGGTGG + Intronic
1020153963 7:5706396-5706418 GAACCCTGGGTGCCAGAGGCTGG - Intronic
1022502246 7:30889112-30889134 GAATCCAGACTCCCAGAGGGTGG - Intronic
1023886425 7:44360436-44360458 GAAACAGAGCTCCCAGAGGGAGG - Intergenic
1023899880 7:44467503-44467525 GAACCCAAGCTCCCAGATCAAGG + Intronic
1024673759 7:51619993-51620015 GAACCCTAGAGCCCAGAGAGTGG - Intergenic
1026941802 7:74291337-74291359 GAGCCCAAAGTCCCAGCAGGGGG + Intronic
1028215384 7:88125906-88125928 GAACCCAAGGTGCCACAAGCAGG - Intronic
1029365413 7:100113312-100113334 GGACCCAGAGACCCAGAGGGTGG + Intronic
1036542082 8:9725534-9725556 GAGCCCAATGTCCAAGTGGGAGG - Intronic
1039701690 8:39968663-39968685 GAACACAAGGACACAGAGAGGGG + Intronic
1039776673 8:40744140-40744162 GAATCCAAGGTCCCACGGAGGGG - Intronic
1040558155 8:48499313-48499335 GAACCAAAGACCCCAGAGGGCGG + Intergenic
1041366447 8:57110809-57110831 GAACCCATGGTCACAGGGAGGGG + Intergenic
1042323938 8:67508420-67508442 GAATTTAAGGTTCCAGAGGGTGG + Intronic
1044348654 8:91136961-91136983 CAGCCCAAGGTCCCACAGGTGGG - Intronic
1045309253 8:100986335-100986357 GAATCCAAGTTCCATGAGGGAGG - Intergenic
1046929520 8:119828197-119828219 GAACCCAGGGTCACAGAGACAGG - Intronic
1047546077 8:125818491-125818513 AGAGCCAAGATCCCAGAGGGAGG + Intergenic
1047600500 8:126421418-126421440 GAACACAAGGGACCAAAGGGAGG + Intergenic
1048319800 8:133389589-133389611 CGACCCAAGGTCCCACAGGCAGG + Intergenic
1049297178 8:141848214-141848236 GAACCCACGGAAACAGAGGGTGG + Intergenic
1049446360 8:142633305-142633327 GAACCCATGGCCTCTGAGGGTGG + Intergenic
1049797008 8:144501457-144501479 GAACCCAAGGCCAGGGAGGGGGG + Intronic
1053023115 9:34709313-34709335 GAACCCAAGATGCAAGAAGGAGG - Exonic
1055373522 9:75625026-75625048 GAACAGAGGTTCCCAGAGGGAGG - Intergenic
1056559308 9:87716446-87716468 TTACCCAAGGTCCCTGCGGGAGG + Intergenic
1056755919 9:89382058-89382080 GAACCAAGTGTCCCAGAAGGTGG - Intronic
1057998036 9:99837990-99838012 GAACTGAAGGTCCCAGAGCCAGG - Intronic
1058670899 9:107359683-107359705 GAACTCAAGGTTCCAGAAGCAGG + Intergenic
1058781781 9:108344309-108344331 GAAACCAAGGCCCCACATGGAGG - Intergenic
1059757573 9:117308130-117308152 GAAGCCAGAGTCCCAGAGGAAGG - Intronic
1060629343 9:125142767-125142789 GAGCCTGTGGTCCCAGAGGGTGG - Intronic
1060970518 9:127735003-127735025 GAAGCTGAGGACCCAGAGGGTGG - Intronic
1061150143 9:128823699-128823721 GATCCCAAGGCCCCAGTGGCTGG + Intronic
1061233421 9:129328195-129328217 GGACCCAAGGTCTCAGAGAGGGG - Intergenic
1061284487 9:129614254-129614276 GAAACCAAGGCCCCAGAAGCAGG - Intronic
1062287117 9:135778221-135778243 GAAACCAAGGCCCGGGAGGGTGG - Intronic
1062430532 9:136525139-136525161 GAAACCAAGGTGCCAGGAGGAGG + Intronic
1203730928 Un_GL000216v2:88784-88806 GAACACCAAGTCCCAGAGGCAGG - Intergenic
1187393331 X:18900200-18900222 GACTCCAGTGTCCCAGAGGGGGG + Intronic
1187455490 X:19437699-19437721 GAATGCAAGCTCCGAGAGGGTGG + Intronic
1189557035 X:42155784-42155806 GAAGCACAGGTCCCAGAGAGGGG - Intergenic
1189619288 X:42818554-42818576 GACCCCAAAGCCCCAGAGGGGGG + Intergenic
1193091835 X:77502163-77502185 GAAGACAAAGTCCCAGAGAGGGG - Intergenic
1193718949 X:84965549-84965571 GAACCCATGGACACAGAGAGGGG - Intergenic
1194411343 X:93562378-93562400 GAACCCATGGACATAGAGGGTGG + Intergenic
1194497139 X:94630554-94630576 GAACCTAAAGTCCAAAAGGGAGG - Intergenic
1194635535 X:96342069-96342091 GATGCAAAGCTCCCAGAGGGAGG - Intergenic
1195598957 X:106724541-106724563 GAACCTAAAGTAACAGAGGGAGG - Intronic
1196003006 X:110806666-110806688 GTACCCAAGGGTCCACAGGGAGG - Intergenic
1196701599 X:118675531-118675553 GAACCCATGGACACAGAGAGGGG + Intronic
1197147568 X:123186009-123186031 GTCCCCAACGTCCCAAAGGGAGG - Intronic
1197225096 X:123949122-123949144 GAACCCATGGATACAGAGGGAGG - Intergenic
1199248939 X:145637674-145637696 GGCACCAAGCTCCCAGAGGGAGG + Intergenic