ID: 1126795787

View in Genome Browser
Species Human (GRCh38)
Location 15:52259806-52259828
Sequence CTGTTGGACTTGCACCCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 138}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126795787_1126795795 12 Left 1126795787 15:52259806-52259828 CCACCTGGGTGCAAGTCCAACAG 0: 1
1: 0
2: 0
3: 9
4: 138
Right 1126795795 15:52259841-52259863 CTGTCCCCCTCCTCCCCAGGAGG 0: 1
1: 1
2: 6
3: 54
4: 473
1126795787_1126795792 9 Left 1126795787 15:52259806-52259828 CCACCTGGGTGCAAGTCCAACAG 0: 1
1: 0
2: 0
3: 9
4: 138
Right 1126795792 15:52259838-52259860 GCCCTGTCCCCCTCCTCCCCAGG 0: 1
1: 1
2: 12
3: 102
4: 859
1126795787_1126795802 23 Left 1126795787 15:52259806-52259828 CCACCTGGGTGCAAGTCCAACAG 0: 1
1: 0
2: 0
3: 9
4: 138
Right 1126795802 15:52259852-52259874 CTCCCCAGGAGGCAGCAGCAGGG 0: 1
1: 0
2: 5
3: 81
4: 762
1126795787_1126795801 22 Left 1126795787 15:52259806-52259828 CCACCTGGGTGCAAGTCCAACAG 0: 1
1: 0
2: 0
3: 9
4: 138
Right 1126795801 15:52259851-52259873 CCTCCCCAGGAGGCAGCAGCAGG 0: 1
1: 0
2: 8
3: 75
4: 994

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126795787 Original CRISPR CTGTTGGACTTGCACCCAGG TGG (reversed) Intronic
905307716 1:37030960-37030982 CTGCTGGACTTGGAGCCAGGAGG - Intronic
908395046 1:63717605-63717627 ATGTTGGATTTGGACTCAGGAGG + Intergenic
909715543 1:78702425-78702447 CTGTTGGACTTGAACACTGCAGG - Intergenic
910929387 1:92427855-92427877 CTGAGGCACTTGAACCCAGGAGG + Intergenic
911456671 1:98133122-98133144 CAGTTGGACTTGAACAGAGGTGG + Intergenic
919691510 1:200532179-200532201 TTGTTGGATTTGGCCCCAGGGGG + Intergenic
1073168617 10:101481710-101481732 GTGTTTCACTTGCTCCCAGGTGG + Intronic
1073350838 10:102818698-102818720 CTGGTGGGCTGGCACCCAGGGGG + Intergenic
1075033615 10:119043819-119043841 CTGAGGCACTTGAACCCAGGAGG + Intronic
1075042452 10:119119101-119119123 CTGAGGCACTTGAACCCAGGAGG - Intronic
1076679218 10:132163101-132163123 CTCTTGGCCCTGCTCCCAGGCGG + Intronic
1076734569 10:132452913-132452935 CTGGTGGACTGGCCCCTAGGTGG - Intergenic
1077325457 11:1962058-1962080 CTCTTGGGCTGGCCCCCAGGCGG + Intronic
1080609840 11:33894279-33894301 CTTTTGGATTTGCGCCCTGGAGG - Intergenic
1081487598 11:43543809-43543831 CTAGTGGACTTGAATCCAGGAGG + Intergenic
1085085416 11:73663450-73663472 TGGTTGGACTTGAACTCAGGAGG - Intergenic
1085769025 11:79308768-79308790 CTGTGGGTCTCGCACTCAGGAGG - Intronic
1087303299 11:96460176-96460198 CTCTGGGACTTGCACCTAGAGGG - Intronic
1087719933 11:101651374-101651396 CTCTGGAACTTGCACCCATGAGG - Intronic
1089783582 11:120892171-120892193 CTGTTGCACTTGAACGCGGGAGG + Intronic
1090019083 11:123111227-123111249 CTGAGGCACTTGAACCCAGGAGG - Intronic
1202808438 11_KI270721v1_random:17237-17259 CTCTTGGGCTGGCCCCCAGGCGG + Intergenic
1097078672 12:56413475-56413497 CTGCTGTAGCTGCACCCAGGAGG + Intergenic
1097898007 12:64845117-64845139 CTTTTGGGCTTGTACCCAGCAGG + Intronic
1101477983 12:105069219-105069241 ATGTAGGAATTGGACCCAGGTGG - Intronic
1102205991 12:111091237-111091259 GTCTTGGACTTGGCCCCAGGAGG + Intronic
1103406287 12:120677979-120678001 CAGTTCGAGTTGCACCCTGGGGG + Intergenic
1103979057 12:124724271-124724293 AGGTTGGAATTTCACCCAGGAGG - Intergenic
1105811845 13:24002309-24002331 ATGTTGGGCTTGCAGGCAGGAGG + Intronic
1119873604 14:78037601-78037623 ATGTTGAAACTGCACCCAGGTGG + Intergenic
1120651182 14:87134823-87134845 CTGATGGACTTGGATCCAAGGGG - Intergenic
1121169505 14:91841667-91841689 CTGCTGGAGTGGTACCCAGGAGG - Intronic
1122089666 14:99329998-99330020 CTGTGGGACGTGAGCCCAGGTGG + Intergenic
1123755966 15:23397954-23397976 CCCTTGGACTTGCTCCCAGCTGG - Intergenic
1123875758 15:24622216-24622238 CTGTTGGACTTGAACACAGCAGG - Intergenic
1125308868 15:38355957-38355979 CTGTTTGCCTAGCAGCCAGGTGG + Exonic
1126791755 15:52227811-52227833 CTTTTGGAATTGCATCCGGGTGG - Intronic
1126795787 15:52259806-52259828 CTGTTGGACTTGCACCCAGGTGG - Intronic
1128021960 15:64399583-64399605 CACTTGAACTTGAACCCAGGAGG - Intronic
1129057041 15:72827396-72827418 CTCTTGCACTTGCAGCCAGCTGG - Intergenic
1130551114 15:84890424-84890446 CTGCTGGTCTTGTTCCCAGGAGG + Exonic
1130728925 15:86469581-86469603 CTGTTGGATATGTACCCAGAAGG + Intronic
1131071277 15:89467698-89467720 CTGTTGGGATTGCACCCTGAGGG - Intergenic
1132097271 15:98997024-98997046 CTGTTGGAGCTAAACCCAGGAGG + Intronic
1133134858 16:3703577-3703599 CTAATGGACTTGCCACCAGGAGG + Intronic
1133758789 16:8781802-8781824 GAGATGGACTGGCACCCAGGAGG - Exonic
1134060946 16:11199136-11199158 CTTGGGGACTGGCACCCAGGGGG + Intergenic
1136019987 16:27434180-27434202 ATGTAGGCCTGGCACCCAGGGGG - Intronic
1137721188 16:50628408-50628430 CTGTGGGACTTACAGGCAGGAGG + Intronic
1138645553 16:58421784-58421806 CTGCTGGGCTTACAGCCAGGTGG - Intergenic
1139514164 16:67443598-67443620 CTGTTGGACTTGTCCTAAGGAGG - Intronic
1140779843 16:78285037-78285059 CTGGTGGACTTAAACCCAGAGGG + Intronic
1141137001 16:81472982-81473004 CTGTTCGCCTTGCATCCAGTGGG + Intronic
1144047134 17:11464335-11464357 GTGATGGACTGGGACCCAGGTGG - Intronic
1146593985 17:34154037-34154059 CAGTTGGACATGCAGTCAGGAGG + Intronic
1155120802 18:22816770-22816792 CTGCTGCAGCTGCACCCAGGAGG + Intronic
1156049358 18:32913421-32913443 CTGAGGGACTTGAACCCAGGAGG + Intergenic
1158401069 18:57121982-57122004 CTGTGGGTCTTTCACCCAGCTGG - Intergenic
1165292825 19:34902975-34902997 CTCATGTCCTTGCACCCAGGAGG + Intergenic
1166000511 19:39874967-39874989 CTGAGGCACTTGAACCCAGGAGG - Intronic
1166751218 19:45164799-45164821 CTCTTGGTCTTGCCCTCAGGAGG + Intronic
1168666171 19:58206888-58206910 CTGTTGGACCTGCTCACTGGGGG - Exonic
927207935 2:20621752-20621774 CAGCTGGATTTGCTCCCAGGTGG + Intronic
927613670 2:24566963-24566985 CAGTTGCAGCTGCACCCAGGAGG + Intronic
928490449 2:31778001-31778023 CTGTTGGACCTGAACCCTGCTGG + Intergenic
933384294 2:81590102-81590124 CTAAGGGACTTGCACCCAGGGGG - Intergenic
936013578 2:108941568-108941590 CTGTTGGCCATGCCCCCAGCTGG - Intronic
939212016 2:139187770-139187792 CTTTTGGACTTATACCCAGAAGG + Intergenic
940376711 2:152966133-152966155 CTGTTGAACTTACACCCTGAGGG + Intergenic
947082674 2:226416276-226416298 ATTTTTGACTTACACCCAGGGGG - Intergenic
947653027 2:231803287-231803309 CTGTTGTTCATGCACCCCGGGGG - Intronic
948975306 2:241460115-241460137 CTGTTGGCCTTGGGCCCTGGGGG - Intronic
1181918364 22:26299037-26299059 GTGATGGACCTGCACTCAGGTGG + Exonic
949888605 3:8715240-8715262 CTCTTGGAGCTGCAGCCAGGAGG - Intronic
951364454 3:21763814-21763836 GTGTTGGACTTGAAAGCAGGTGG - Intronic
951637842 3:24798988-24799010 CTGTTGGACATCCTGCCAGGGGG + Intergenic
952223292 3:31346847-31346869 CTCTTGGACTTTCAACCAGGTGG + Intergenic
958062255 3:88498433-88498455 CTCCTGCAGTTGCACCCAGGTGG + Intergenic
958771263 3:98428656-98428678 CTGTGGTACTGCCACCCAGGAGG - Intergenic
961059681 3:123817848-123817870 CTGTTGGACATGCACAGAGATGG - Intronic
962659182 3:137584288-137584310 CTCCTGGATTTGCAACCAGGTGG - Intergenic
965297563 3:166969277-166969299 CTGGTGGACTTACACCTAGCAGG - Intergenic
965956756 3:174379484-174379506 CTGTTGGACCAGCTCACAGGGGG - Intergenic
967300402 3:188006889-188006911 CTTCTGGGCCTGCACCCAGGCGG - Intergenic
971118979 4:23682344-23682366 GGGTTGGACTGGCAGCCAGGAGG - Intergenic
971362389 4:25950149-25950171 CACTTGGATTTGTACCCAGGTGG - Intergenic
971555709 4:28011687-28011709 CTGTAGGCCTTCCCCCCAGGGGG + Intergenic
973842823 4:54879814-54879836 CTGCTGGCCCTGCACCCTGGGGG - Intergenic
976160714 4:82195777-82195799 CTGTGGCACTTGAACCCAGGAGG - Intergenic
976511192 4:85911119-85911141 CAGCTGCACCTGCACCCAGGAGG + Intronic
976587262 4:86812656-86812678 CCCTTGGACTTCCACACAGGTGG - Intronic
981693624 4:147536787-147536809 CTGTTCTAATTTCACCCAGGAGG - Intronic
982840203 4:160174882-160174904 CTGTTGGACCTGCACAGAGCAGG + Intergenic
984702274 4:182825965-182825987 CTGCCAGACTTGCACCCAGCTGG + Intergenic
985267466 4:188163379-188163401 CTGTTGGCCTAGAACTCAGGAGG + Intergenic
989531611 5:42514207-42514229 CCTGTGGACTTGCACCCAGAAGG - Exonic
989796379 5:45479035-45479057 CTCTTGAACCTGGACCCAGGAGG + Intronic
990818967 5:59816216-59816238 TTGTTGGACTTACATTCAGGTGG + Intronic
991028116 5:62052488-62052510 CTGTTGGACTTGAACAGAGCAGG - Intergenic
992853357 5:80834216-80834238 CTGTGGGACTCACACCCTGGAGG - Intronic
995297871 5:110541008-110541030 CTGTTGGGATTGCACCCTGAAGG - Intronic
996343522 5:122464993-122465015 CTGCTGGACTCGCACACAGGAGG + Intergenic
999102865 5:149041378-149041400 CTCTGGGACTTGCTCCCAGGAGG + Intronic
999372652 5:151065124-151065146 CTGTTGTCCTTACAGCCAGGCGG - Exonic
1002072495 5:176688458-176688480 CGGTTGCAGCTGCACCCAGGAGG + Intergenic
1005118119 6:22360857-22360879 CTGTTGCACTTGCAGTGAGGTGG + Intergenic
1006770122 6:36546490-36546512 CTGTTTGAAATGCACCGAGGAGG - Intronic
1007343205 6:41206927-41206949 CTTTAGGACTTATACCCAGGTGG - Intergenic
1011719399 6:90139729-90139751 CAGTTGTACTTCCACACAGGTGG + Intronic
1015920014 6:138257271-138257293 CTGTTCAACTTGCATCCTGGAGG + Intronic
1019308832 7:349082-349104 CTGTGGGACAAGCACCCAGCGGG - Intergenic
1020378707 7:7517701-7517723 CTTTTGCACTTGCACTAAGGGGG + Intronic
1024615513 7:51108461-51108483 CTGTTGGAGGTGCACACAGTTGG + Intronic
1028347425 7:89799395-89799417 CTGTAGGACTTGCAGACAAGAGG - Intergenic
1033434158 7:141317390-141317412 CTGATGCACCTGCAGCCAGGTGG - Intronic
1034563379 7:151895449-151895471 CTGTAGGACCTGCACCCGTGAGG - Intergenic
1035149000 7:156850848-156850870 CTGTTGGAGGTGAACCCTGGTGG + Intronic
1036651087 8:10644457-10644479 CTGGGGGACTTACACCCATGTGG - Intronic
1038279786 8:26153484-26153506 CTTTTGAACTTGAACCCATGTGG - Intergenic
1038318413 8:26507635-26507657 CTGTGGGTCCTGCCCCCAGGTGG + Exonic
1043592615 8:81847904-81847926 CTGTTGGGATTGCACCCTGAGGG - Intergenic
1043709644 8:83400205-83400227 CTGGAGTACTTGCACCCTGGAGG + Intergenic
1049028694 8:140015958-140015980 CTGTGGAACATGCAGCCAGGTGG - Intronic
1050013762 9:1211467-1211489 TTGTTGGAGTTGCCACCAGGTGG + Intergenic
1052707556 9:32011120-32011142 CTGTGGGACTGGCAGCCAGCTGG - Intergenic
1053173209 9:35905419-35905441 CTGTTGAACTGGGAACCAGGAGG + Intergenic
1053273394 9:36765684-36765706 CTGTGGGACAAGCATCCAGGAGG + Intergenic
1056897598 9:90565487-90565509 CTGGCTGACTTGCACCCAGTAGG + Intergenic
1058056680 9:100455848-100455870 CTGTTGGACTGGTTCCCAGAGGG + Intronic
1059553724 9:115256683-115256705 CTGTTGGAGGTGCAGCCTGGTGG - Intronic
1059646482 9:116273093-116273115 CTGTTTGACTTGCACTAATGTGG + Intronic
1060415644 9:123427897-123427919 CTGTTGGTCTTGCACCTGGAAGG + Intronic
1060775761 9:126373006-126373028 CTGTTGGCCTTGCACCCCTCTGG - Intronic
1060884001 9:127137776-127137798 CTGCTGGACCTGCAGCCTGGTGG + Intronic
1061121302 9:128644251-128644273 GTGATCGACTTGAACCCAGGCGG + Intronic
1061815631 9:133193025-133193047 CTGAGGCACTTGAACCCAGGAGG - Intergenic
1062267339 9:135693230-135693252 CTGTGGGACCTGCTCCCTGGAGG - Intergenic
1187440413 X:19312955-19312977 CTGCTGCACTTGCTTCCAGGAGG - Intergenic
1188000175 X:24973273-24973295 ATCTTGAACTTGAACCCAGGAGG + Intronic
1189023789 X:37370579-37370601 CAGTTGCAGCTGCACCCAGGAGG - Intronic
1189794672 X:44634827-44634849 CTGTTGGATTTGAGCCCTGGAGG - Intergenic
1190332117 X:49242436-49242458 ATGTTTGAGTAGCACCCAGGAGG - Intronic
1197794583 X:130285653-130285675 CTGTTGGGATTGCACCCTGAGGG - Intergenic
1201050189 Y:9924996-9925018 CTGTTGGAGTTTCACACAGTGGG + Intergenic
1201320089 Y:12688872-12688894 CTGTTGTCCAAGCACCCAGGAGG - Intergenic
1201764891 Y:17567052-17567074 GTCCTTGACTTGCACCCAGGGGG - Intergenic
1201836661 Y:18338937-18338959 GTCCTTGACTTGCACCCAGGGGG + Intergenic
1202047638 Y:20750527-20750549 CTGTGGGACTAGCCCCCAGAAGG - Intergenic