ID: 1126800517

View in Genome Browser
Species Human (GRCh38)
Location 15:52293573-52293595
Sequence CTGTATGAGAGACAGCAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 351
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 322}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126800517_1126800522 7 Left 1126800517 15:52293573-52293595 CCACCCTGCTGTCTCTCATACAG 0: 1
1: 0
2: 0
3: 28
4: 322
Right 1126800522 15:52293603-52293625 CCTCAAATGTCATCCTTGGCTGG 0: 1
1: 0
2: 0
3: 12
4: 143
1126800517_1126800520 3 Left 1126800517 15:52293573-52293595 CCACCCTGCTGTCTCTCATACAG 0: 1
1: 0
2: 0
3: 28
4: 322
Right 1126800520 15:52293599-52293621 CTAACCTCAAATGTCATCCTTGG 0: 1
1: 0
2: 0
3: 17
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126800517 Original CRISPR CTGTATGAGAGACAGCAGGG TGG (reversed) Intronic
900372353 1:2337572-2337594 TTGTAAAAGAGACAGCAGGGTGG - Intronic
900434994 1:2625867-2625889 CTGGAGGAGAGAAGGCAGGGTGG - Intronic
900623838 1:3599237-3599259 CTGGATGAGACCCAGTAGGGTGG - Intronic
900811570 1:4805725-4805747 CAGAATGAGAGAGAGCATGGTGG + Intergenic
900947706 1:5840657-5840679 CTGCATGAGGGACAGCCGAGGGG + Intergenic
902209157 1:14892409-14892431 GAGAAAGAGAGACAGCAGGGGGG - Intronic
902800039 1:18823686-18823708 GTGTCTGAGAAACAGCAAGGAGG + Intergenic
903033117 1:20477408-20477430 CTGTAAGAGAGAGAGCTGGGTGG - Intergenic
903544646 1:24116378-24116400 CTGTCGGAGAAACAGCATGGAGG - Intergenic
904300262 1:29549532-29549554 CCATGGGAGAGACAGCAGGGAGG - Intergenic
904864326 1:33565131-33565153 CTGTATGAGAAAGAGAAGAGAGG + Intronic
905496138 1:38389206-38389228 GTGCAAGAGAGAGAGCAGGGAGG + Intergenic
905976744 1:42181036-42181058 CTGTGTGGCAGACAGCAGTGAGG - Intronic
906135813 1:43500092-43500114 CTGCATCACAGGCAGCAGGGAGG - Intergenic
907643214 1:56213680-56213702 CTCTATGAGATGCAGCAGTGTGG - Intergenic
908170684 1:61501583-61501605 CTGAAGGAGAGACAGCTGGAAGG + Intergenic
909547421 1:76863216-76863238 ATGTTGGAGAGACAGCAAGGGGG - Intergenic
910114625 1:83718329-83718351 CAGTATCAGAGACAGAAGTGTGG + Intergenic
910347672 1:86259032-86259054 CTTTATGAGGAGCAGCAGGGAGG + Intergenic
910371746 1:86523890-86523912 CTGCATGAGAGCCCACAGGGTGG + Intergenic
910854698 1:91683841-91683863 CTGCAGGGGAGACAGCAGGAAGG - Exonic
910963716 1:92786844-92786866 CTGGAGCACAGACAGCAGGGTGG - Intronic
911466810 1:98264835-98264857 CTGTTTGATTTACAGCAGGGTGG + Intergenic
912372634 1:109185731-109185753 CTGTATGAGAGGCTGGAGAGAGG + Intronic
912732886 1:112125293-112125315 CTGTTTGAGAAACAGCATGGTGG + Intergenic
913067295 1:115268003-115268025 CTCTATCAGATACAGGAGGGGGG + Intergenic
918054884 1:181012422-181012444 CTGTTTTGTAGACAGCAGGGAGG - Intronic
920550801 1:206859258-206859280 CTTCCTGGGAGACAGCAGGGTGG - Intergenic
922781014 1:228252290-228252312 CTGGAGGAGAGAAGGCAGGGTGG + Intronic
924037867 1:239954651-239954673 CTGCATGAGAGAGAAAAGGGTGG - Intergenic
1063583088 10:7327032-7327054 TCGTATGAAGGACAGCAGGGAGG - Intronic
1063905348 10:10775283-10775305 CTGTCTGAGGCACAGCAAGGAGG + Intergenic
1064903376 10:20317857-20317879 CTGTAAGTGGAACAGCAGGGAGG - Intergenic
1065729557 10:28698643-28698665 ATGTATGAGAGAGAGCAAGAGGG + Intergenic
1066195511 10:33095287-33095309 CTGTCTGGGAGACAGCAAGCAGG + Intergenic
1067070654 10:43128745-43128767 CAGAATGAGAGACTGCGGGGGGG + Exonic
1067359055 10:45560218-45560240 CTGTAGGAGATCCATCAGGGTGG + Intronic
1068658505 10:59599038-59599060 TTGTAATACAGACAGCAGGGAGG + Intergenic
1069623500 10:69852590-69852612 CTGGCTGAGACTCAGCAGGGTGG + Intronic
1070339573 10:75484754-75484776 CTGTGTGAGACACAGCAAGAAGG + Intronic
1070469181 10:76760914-76760936 ATGTATGAGAGATTGCATGGTGG - Intergenic
1070489540 10:76963891-76963913 CTGTATCAGACACAGAAGGCTGG + Intronic
1070500139 10:77065055-77065077 CTGTATTACAGACAGCTGGGTGG - Intronic
1073123118 10:101133871-101133893 CTGGAGGAGAGGCGGCAGGGAGG + Intronic
1073282780 10:102366880-102366902 CTTTTTAAGAGACAGCAGGCTGG - Intronic
1075235085 10:120720487-120720509 CTGGGTGAGAAACAGCAGGTGGG + Intergenic
1078087601 11:8243537-8243559 CCGTGTGAGAGTCAGCAGGGTGG + Intronic
1079339428 11:19599774-19599796 CTGTTTGAGAAACAGCATGAGGG + Intronic
1080165502 11:29231521-29231543 ATGTGTGAGAAACAGCAAGGAGG + Intergenic
1080564898 11:33498940-33498962 CTCTTTGAGAGTCATCAGGGTGG - Intergenic
1081051323 11:38345087-38345109 CTTTATCAGGGAAAGCAGGGGGG - Intergenic
1082842301 11:57699362-57699384 CTGTCTCAGAGACACCAGGTTGG - Exonic
1083198099 11:61102871-61102893 GTGCAAGAGAGACTGCAGGGGGG + Intronic
1088575828 11:111270670-111270692 CTGTATGAGAGGCGGCTGGCAGG - Intronic
1089212302 11:116813836-116813858 CTGTCTGAGAGCGTGCAGGGTGG - Intergenic
1090437801 11:126701415-126701437 ATCTAAGAGGGACAGCAGGGAGG + Intronic
1090534081 11:127621317-127621339 CAGTATGAGAGAAAGCAGAGAGG - Intergenic
1091391846 12:130705-130727 CTGTATTCCAGACAGCAGGCTGG + Intronic
1091777266 12:3192605-3192627 CTGTCTGGGAGACAGCCAGGGGG + Intronic
1092682092 12:10994466-10994488 ATGTGAGAGAGACAGCATGGTGG - Intronic
1092786520 12:12031940-12031962 AGGTATGAGAGACAGCTGGAAGG + Intergenic
1093036369 12:14335949-14335971 CTGTGGGAGAGAAGGCAGGGTGG - Intergenic
1094490932 12:30960158-30960180 ATGTATGAGACTGAGCAGGGAGG + Intronic
1095199328 12:39364106-39364128 CAGTAGGAAAAACAGCAGGGTGG - Intronic
1095902655 12:47344423-47344445 GTGTATGGAAGACAGGAGGGTGG - Intergenic
1096445147 12:51683097-51683119 ATGTATGAGAGGCAGCAGGAGGG - Intronic
1096878141 12:54646241-54646263 CTTTATGTGAGAAGGCAGGGAGG + Intronic
1096906596 12:54942231-54942253 CTGCATGGGAAACACCAGGGAGG - Intergenic
1096997881 12:55850561-55850583 GTGTATTATAGACAGCAGGGAGG - Intergenic
1097247476 12:57614481-57614503 ATGTTTAAGAGAGAGCAGGGTGG - Intronic
1098997417 12:77136684-77136706 CTGTATGTGAGGAAGCATGGTGG + Intergenic
1099050556 12:77777493-77777515 CTGAGTTAGACACAGCAGGGTGG + Intergenic
1099526392 12:83723374-83723396 CTGGAGGAGAGAAGGCAGGGTGG - Intergenic
1099650440 12:85420726-85420748 CTGTATGGGAGAGAGCAGTTTGG + Intergenic
1100083335 12:90878478-90878500 CTGGGGGAGAGAAAGCAGGGTGG - Intergenic
1104012981 12:124945099-124945121 CTCTTTTAGAGACAGTAGGGAGG + Intergenic
1104310350 12:127649222-127649244 CAGCAGGAGAGACAGCAGGCTGG - Intergenic
1104357636 12:128101712-128101734 CTGCTAGAGAGACAGCTGGGTGG - Intergenic
1104830199 12:131745428-131745450 GTGAATGAGAGAAATCAGGGCGG - Intronic
1105567278 13:21562674-21562696 CGGTATAAGGGACAGGAGGGAGG - Intronic
1107246753 13:38306035-38306057 CAGCATGAGAGAGAGCAGGGAGG + Intergenic
1107349019 13:39494501-39494523 CTGTATGGGAGTGAGCGGGGTGG - Intronic
1108558715 13:51622004-51622026 GTGTGTGAGAGAGAGAAGGGAGG + Intronic
1110081692 13:71321672-71321694 CTGTGTGTGAGACAACAGGAGGG - Intergenic
1112719545 13:102227504-102227526 CTTTGTGATAGACATCAGGGTGG - Intronic
1113712707 13:112479510-112479532 ATCTATGACAGAAAGCAGGGCGG + Intergenic
1113865606 13:113520688-113520710 CTGTATGAGAGTCGGCATGACGG - Exonic
1115612389 14:35061319-35061341 CTGAGTGAGAGGCAGAAGGGCGG - Intronic
1116415106 14:44669576-44669598 CTGGAAGAGAGAAAGCAGGGTGG - Intergenic
1116455227 14:45112752-45112774 CTGAATGAGAGAAGGCAGGAAGG + Intronic
1116531422 14:45977962-45977984 CTGGGGGAGAGAAAGCAGGGTGG + Intergenic
1116654974 14:47640836-47640858 GTGTATGAGAGAAAGCAGAAAGG - Intronic
1118182861 14:63510647-63510669 GTGTTTGAGAAACAGCAAGGAGG + Intronic
1118476695 14:66124105-66124127 CTGGAGCAGAGACAGCAGTGAGG - Intergenic
1119657260 14:76425951-76425973 TGCTATGAGAAACAGCAGGGAGG - Intronic
1120970802 14:90205354-90205376 AAGTATGAGAAAAAGCAGGGAGG + Intergenic
1121495670 14:94390092-94390114 CTGAATGAGAGACTGCCTGGAGG - Intronic
1121626031 14:95385961-95385983 TTGTGTCAGAGCCAGCAGGGAGG - Intergenic
1123108068 14:105852264-105852286 CTGCAGGAGACACAGCACGGGGG + Intergenic
1123170287 14:106366832-106366854 CTGTGTGAGAGAGAGAAGGAGGG + Intergenic
1123221818 14:106864732-106864754 CTGTGTGAGAGAGAGAAGGCAGG + Intergenic
1125592396 15:40862999-40863021 ATGTGGGAGAGACAACAGGGAGG + Intergenic
1126441481 15:48694333-48694355 TTGTTTGAGAAACAGCAAGGAGG - Intergenic
1126800517 15:52293573-52293595 CTGTATGAGAGACAGCAGGGTGG - Intronic
1127292139 15:57580433-57580455 CTGTATGACATACAGCGTGGTGG - Intergenic
1127839692 15:62820335-62820357 CTTTATGAGAGACGGAAGGAAGG + Intronic
1128496126 15:68199639-68199661 CTGTATGACAAGCAGCAGAGGGG - Exonic
1130407041 15:83611598-83611620 CTGAATGTGAGAGAGCAAGGAGG + Intronic
1130910458 15:88267036-88267058 TTGGAGGAGAGAGAGCAGGGAGG + Intergenic
1132642446 16:983995-984017 CTGTATGGGAGGCAGCTGTGGGG + Intronic
1133263168 16:4565396-4565418 CTACATGTGAGACAGCAGGTGGG + Intronic
1134113766 16:11532776-11532798 GTGGATGCGAGAGAGCAGGGAGG + Intergenic
1136067162 16:27766998-27767020 CTGAGTGAGAAGCAGCAGGGGGG + Intronic
1137468031 16:48729037-48729059 ATGTTTGAGAAGCAGCAGGGAGG - Intergenic
1137509521 16:49086724-49086746 CTGTAGGAGATACATCAGCGAGG - Intergenic
1138100254 16:54246574-54246596 CAGCCTGAGAGACAGCAAGGTGG - Intronic
1139268013 16:65657688-65657710 CATTATGAGAGACAGCAGTGCGG + Intergenic
1139966809 16:70750348-70750370 TTGTGTGAGAGAAAGAAGGGAGG + Intronic
1140520932 16:75581160-75581182 CTGAATATGAGACAGCATGGCGG + Intergenic
1141550090 16:84801058-84801080 CTGTAGAACAGACAGCAGAGTGG + Intergenic
1141585320 16:85029640-85029662 CTTTATGAGAGAAAGGAGGGAGG - Intronic
1142184398 16:88687489-88687511 CTGAGGGACAGACAGCAGGGAGG + Intergenic
1142191232 16:88719090-88719112 CTGTAAGAGACCCAGGAGGGAGG - Intronic
1142362040 16:89631963-89631985 CTGTATGCTGGCCAGCAGGGAGG + Intronic
1143015979 17:3891558-3891580 CAGTATGAAGAACAGCAGGGAGG + Intronic
1143325058 17:6093284-6093306 CTGAATGAGATAAAGCAGGAAGG - Intronic
1145070413 17:19800817-19800839 CTGTATGAGAGGCAGCACTGAGG - Intronic
1146507850 17:33421099-33421121 CTTTCTCAGAGAGAGCAGGGTGG + Intronic
1146632275 17:34479450-34479472 CTCTCTCAGAGACCGCAGGGAGG - Intergenic
1146643097 17:34555841-34555863 AGGTATGGGAGACAGGAGGGTGG - Intergenic
1149389369 17:56173986-56174008 CTGTATCAGAGAAAGGAGGCAGG - Intronic
1151833414 17:76569011-76569033 GTGTAGGAGAGAGAGGAGGGGGG + Intronic
1151946826 17:77324150-77324172 CCGTATGAGAGACAGACAGGGGG - Intronic
1152260452 17:79263930-79263952 CTTTATAAGAGAAAGGAGGGAGG + Intronic
1153799254 18:8655199-8655221 CTGTCAGTGACACAGCAGGGAGG + Intergenic
1154252640 18:12757013-12757035 CTGTAGGAGAGAAGACAGGGTGG + Intergenic
1155101024 18:22609860-22609882 ACGGATGAGAGGCAGCAGGGAGG + Intergenic
1156291808 18:35754429-35754451 CTGTGTGGGACACAGCCGGGTGG + Intergenic
1156606400 18:38672026-38672048 CTGAAGGAGAGAAGGCAGGGTGG - Intergenic
1158558817 18:58496880-58496902 CAGTATGAGAGACCACAGAGGGG - Intronic
1158777810 18:60607271-60607293 CTGTATGAAACACAGAAAGGGGG + Intergenic
1158828519 18:61251891-61251913 CTCACTGGGAGACAGCAGGGAGG - Intergenic
1158838436 18:61357118-61357140 GTGTAAATGAGACAGCAGGGAGG - Intronic
1160158340 18:76451041-76451063 CTGACTGGGAGACACCAGGGAGG + Intronic
1163099728 19:15087520-15087542 GTGTATGAGAGACTGGAGGTTGG - Exonic
1163501750 19:17680305-17680327 CTGTATCAGGGTCAGCGGGGCGG + Intronic
1165394357 19:35556241-35556263 CTGTCGGAGGAACAGCAGGGAGG + Intronic
1165495125 19:36148158-36148180 AGGTATGTGAGATAGCAGGGAGG + Intronic
1165857676 19:38889746-38889768 CTGTAGGAGAGACAGCCAGAGGG + Intronic
1166206695 19:41274529-41274551 CTGGAGGACAGACAGCAGGGCGG - Intronic
1166374935 19:42322448-42322470 CTGGCTGAGATACAGCAGGAAGG - Intronic
1166397876 19:42455761-42455783 CTGTCAGTGAGACAGCAGTGAGG + Intergenic
1167030238 19:46954102-46954124 CTGTATGTAAGCCAGCAGGAGGG + Intronic
1167158673 19:47754439-47754461 CTGGATGAGGGACAGATGGGAGG + Intronic
1168130885 19:54317843-54317865 CAGTCGGAGAGACAGCGGGGCGG + Intergenic
925160610 2:1681091-1681113 CTGGATGTGAGACAGCCAGGTGG + Intronic
925213662 2:2073351-2073373 CAGTAAGAGATACAGCAGGCTGG - Intronic
925901980 2:8515436-8515458 CAGAAAGAGAGACAGCAGAGAGG + Intergenic
929555609 2:42923866-42923888 CTGGAGGAGAAACAACAGGGAGG + Intergenic
929996469 2:46829210-46829232 CTGTAGGAGAGGCAGCAGCCTGG + Intronic
930026869 2:47034392-47034414 GGGTATGAGAGGCAGCTGGGAGG + Intronic
931756750 2:65381625-65381647 GTACATGACAGACAGCAGGGTGG + Intronic
931807279 2:65819424-65819446 CTGTAGGAGACACTGCTGGGAGG + Intergenic
933504744 2:83162496-83162518 CTGAGTGAGAGAAGGCAGGGTGG + Intergenic
934166539 2:89299181-89299203 CTGGATGTGAGACAGGAGGCTGG - Intergenic
934200738 2:89883275-89883297 CTGGATGTGAGACAGGAGGCTGG + Intergenic
936674854 2:114702984-114703006 CTGTATTAGGGTGAGCAGGGTGG + Intronic
937878812 2:126849893-126849915 CTGTATGAAAGGCACCAGGGAGG - Intergenic
937979429 2:127606012-127606034 CTGAATGAGAGACCTCAGGCAGG + Intronic
939152577 2:138490544-138490566 CTAAATCAGAGATAGCAGGGAGG + Intergenic
939291691 2:140204045-140204067 CTGGAAGAGAGCCATCAGGGAGG - Intergenic
940896919 2:159089685-159089707 CTGGAAGAGAAACAGAAGGGTGG + Intronic
941607642 2:167620205-167620227 GTGTGTGAGAGACTGCAGGTAGG + Intergenic
942602047 2:177651638-177651660 CAGAAAGAGAGACAGCAGGAGGG - Intronic
944593891 2:201244381-201244403 CTGTAGGAGAGAGAGAAGGAAGG + Intronic
945048874 2:205805141-205805163 CAGAATGAAAGACAGCTGGGAGG + Intergenic
945224845 2:207523107-207523129 GTGTTTGAGAAACAGCAAGGAGG + Intergenic
946816647 2:223585126-223585148 CTATATGGGAGAAAACAGGGAGG + Intergenic
947342088 2:229151015-229151037 CTGGATGAAAGAGAGCAGGATGG + Intronic
947664049 2:231891955-231891977 ATGTAGGAGACACAGGAGGGTGG + Intergenic
947927649 2:233935735-233935757 TGGTCAGAGAGACAGCAGGGAGG + Intronic
948585703 2:239018316-239018338 GTGTGTGAGAGAGAGCAGGTGGG + Intergenic
1168831599 20:848176-848198 CTGTTGGGGAGAGAGCAGGGAGG + Intronic
1169923459 20:10758957-10758979 CAGGATGAGAGAGAGAAGGGAGG - Intergenic
1170205218 20:13790747-13790769 CTGTTTGAGAGACTGCAAGGAGG - Intronic
1170500053 20:16966059-16966081 CAATATGAGTGACTGCAGGGTGG - Intergenic
1172035948 20:32010791-32010813 CTGTCTGAGAGGCTGCAGGAGGG - Intronic
1172978260 20:38922333-38922355 CTCTAGGAGAGAGAGCAGGTAGG - Exonic
1173080935 20:39866776-39866798 CAGTGTGAGAAACAGCAAGGAGG + Intergenic
1174082810 20:47983064-47983086 CTGGGTGAGGAACAGCAGGGGGG + Intergenic
1174128304 20:48324950-48324972 CTCTCTGAGTGACAGCATGGTGG + Intergenic
1174133147 20:48359918-48359940 CTGGGTGAGGAACAGCAGGGAGG - Intergenic
1174471845 20:50767368-50767390 GTGTGTGAGAGACAGAGGGGAGG - Intergenic
1175051682 20:56161279-56161301 GTGGATGTGAGACAGCAGGCTGG - Intergenic
1177592614 21:23191000-23191022 AAGGAAGAGAGACAGCAGGGAGG - Intergenic
1177917751 21:27111675-27111697 CTGTATCAGATATACCAGGGAGG - Intergenic
1179308132 21:40173407-40173429 GTGTATGAGGGACAGCAAGAAGG + Intronic
1179537776 21:42063403-42063425 CTGTTTGGGGGACACCAGGGGGG - Intronic
1180590452 22:16932754-16932776 CAGCTTCAGAGACAGCAGGGAGG + Intergenic
1181420682 22:22796093-22796115 CTGGGGGAGAGAAAGCAGGGGGG - Intronic
1181772496 22:25136242-25136264 CTGTATGAGAGAGAGAGAGGAGG - Intronic
1181953433 22:26571204-26571226 GTGTTTGAGTGACAGCAAGGGGG - Intronic
1182154417 22:28055812-28055834 CGGTATGAGTGACAGATGGGTGG - Intronic
1182757417 22:32691087-32691109 CTGTAGGAGAGAAAAAAGGGAGG - Intronic
1183315828 22:37136367-37136389 CTGCTTGAGAGTCAGCAGGGGGG + Exonic
1183334335 22:37237989-37238011 CTGAATGACAGGAAGCAGGGAGG + Intronic
1183430487 22:37762778-37762800 CTGGAGGAGTGACAGCTGGGAGG + Intronic
1183533725 22:38381613-38381635 GTGTATGAGACACACCAGAGTGG - Intronic
1183668711 22:39259594-39259616 CTCAAAGAGAGACATCAGGGTGG + Intergenic
1185013856 22:48332190-48332212 GTGTGTGTGAGACAGGAGGGAGG - Intergenic
1185167071 22:49268053-49268075 AGGGATCAGAGACAGCAGGGAGG - Intergenic
950896333 3:16454993-16455015 CTTCATGGGAGACAGCATGGTGG - Intronic
958487650 3:94732211-94732233 CTGTGGGAGAGAAGGCAGGGTGG + Intergenic
958565900 3:95809717-95809739 CTGGTAGAGAGACAGCAGTGTGG - Intergenic
959107132 3:102077372-102077394 CTGGATGTGAGAGAGTAGGGGGG + Intergenic
959908833 3:111740045-111740067 CTGTATGAGAGAAGGCAGCCCGG + Intronic
960493146 3:118342092-118342114 CTGCAAGAGACAAAGCAGGGTGG - Intergenic
961162196 3:124737711-124737733 CTGTTGGACAGAGAGCAGGGAGG + Exonic
961685092 3:128624582-128624604 ATGTTTGTGAGACAGCAGGGAGG - Intronic
962373627 3:134841398-134841420 CTGTATGTGGGACAGGTGGGAGG + Intronic
964813941 3:160696198-160696220 CTGGATGAGAGAGAGGATGGGGG - Intergenic
965251308 3:166348009-166348031 CTGGAGGAGAGAAGGCAGGGTGG + Intergenic
965847511 3:172981492-172981514 CTTTGTGAGGGACAGCAGGATGG - Intronic
966440279 3:179937332-179937354 CAGTAGGAGAGACAGCATGCGGG + Intronic
966445720 3:179998822-179998844 CTGGAAGAGAGAAGGCAGGGTGG - Intronic
967803672 3:193693202-193693224 ATGTATTTGAGAAAGCAGGGTGG + Intronic
968140563 3:196252729-196252751 ATCTATGAGAGAAAGCAGGCTGG + Intronic
968226468 3:196975511-196975533 GTGTCTGAGGGCCAGCAGGGAGG + Intergenic
968759804 4:2436851-2436873 CTGGAAGAGAGACAGCCGGTGGG - Intronic
969109049 4:4829906-4829928 ATGAAAGAGAGTCAGCAGGGAGG + Intergenic
969174185 4:5386164-5386186 CTGTGTGAGAGACAGACGGCTGG - Intronic
969950789 4:10832953-10832975 CTGTAGGGGACACAGCAGTGTGG - Intergenic
973775281 4:54236025-54236047 CTGCCTGAGAGTCAACAGGGCGG + Intronic
976029307 4:80731605-80731627 CTGAATGAGAGAGAGAAGAGGGG - Intronic
976958471 4:90935319-90935341 AAGCAGGAGAGACAGCAGGGAGG - Intronic
977255896 4:94739689-94739711 ATGTATTAGAGACAGCAAAGTGG - Intergenic
977930381 4:102743556-102743578 CTGGGGGAGAGACGGCAGGGTGG + Intronic
977967305 4:103168105-103168127 CTGTGTGGGTGAGAGCAGGGAGG - Intronic
978153827 4:105467361-105467383 ATGTCTGAGAAACAGCAAGGAGG + Intronic
978733310 4:112056684-112056706 CTTTAGGAGACAGAGCAGGGAGG + Intergenic
980001137 4:127489386-127489408 CTGCATGAGAGACAGGATGCTGG - Intergenic
981947576 4:150366518-150366540 CTGTTTGAGAGACTGCATGGAGG + Intronic
982623306 4:157732621-157732643 CTGAAGGAGAGAAGGCAGGGTGG + Intergenic
984429631 4:179631969-179631991 CTTTATGAAAAACAACAGGGAGG - Intergenic
984759467 4:183351237-183351259 GAGTATGAGAGACAAGAGGGAGG + Intergenic
985028041 4:185758748-185758770 CAGTATGAGGCACAGCAAGGAGG - Intronic
985200928 4:187484539-187484561 ATGTATAAGGGAGAGCAGGGGGG + Intergenic
985626884 5:993634-993656 CTCTTAGAGAAACAGCAGGGAGG + Intergenic
986416343 5:7531708-7531730 CCTTATGAGAGACAGAAGAGAGG - Intronic
986742951 5:10719769-10719791 CTGTGGGAGAGAAGGCAGGGTGG - Intronic
986839633 5:11680965-11680987 CTGTCTGGGATACAGGAGGGTGG + Intronic
986959865 5:13199457-13199479 CTGGAGGAGAGAAGGCAGGGTGG - Intergenic
987657110 5:20821388-20821410 CTGGAGGAGAGAAGGCAGGGTGG + Intergenic
988160797 5:27516607-27516629 CTGTGGGAGAGAAGGCAGGGTGG + Intergenic
988727625 5:33939786-33939808 CTCTATGAAAGCCAGCAGAGGGG - Intergenic
988766441 5:34382560-34382582 CTGGAGGAGAGAAGGCAGGGTGG - Intergenic
989522690 5:42420433-42420455 CTGCTTAAGAAACAGCAGGGAGG + Intergenic
989594389 5:43142659-43142681 ATGTCTGAGAGACAGAATGGGGG - Intronic
989780771 5:45262401-45262423 TTGCATGAGTGACAGCTGGGAGG + Exonic
994054593 5:95401063-95401085 CTGTATCAGTGAGGGCAGGGTGG - Intronic
996307918 5:122071394-122071416 CTGTATGAGAGAGAGTATAGTGG - Intronic
999115345 5:149158035-149158057 GTGAATGAGAGGTAGCAGGGTGG - Intronic
999249090 5:150171186-150171208 CTGAAGGTGAGACAGCAGGTTGG - Intronic
1000525854 5:162356613-162356635 CAGTATGAGAAACAGCATGGAGG - Intergenic
1002405214 5:179024977-179024999 CTCCAAGAGAGGCAGCAGGGAGG + Exonic
1002814620 6:668270-668292 CTGTAGGAGAGACATGATGGAGG - Intronic
1004729322 6:18342438-18342460 CTGAATCAGAGACTTCAGGGAGG + Intergenic
1004739750 6:18447320-18447342 CTGTTTGAGAAACAGCAAGGAGG + Intronic
1004902433 6:20206583-20206605 GTGCATGACAGACAGCAGGCCGG + Intronic
1005940198 6:30555157-30555179 TTTTGAGAGAGACAGCAGGGAGG - Exonic
1006206466 6:32347774-32347796 ATGTATGAGAGATTGCAGGAAGG - Intronic
1006364880 6:33609560-33609582 CTGGATGAGGGTCAGAAGGGAGG + Intergenic
1009390085 6:63134813-63134835 CTGGGTGAGAGAAGGCAGGGTGG + Intergenic
1009450641 6:63796131-63796153 CAGTAGGAGAAACAGCAGGACGG - Intronic
1013192064 6:107812044-107812066 CTGTGTGGGAGCCAGCAGGGAGG + Intronic
1013459256 6:110359039-110359061 ATTTCTGCGAGACAGCAGGGAGG - Intergenic
1014363369 6:120508090-120508112 CTGGAGGAGAGAAGGCAGGGTGG + Intergenic
1014692548 6:124578867-124578889 CAGAAAGAGAGATAGCAGGGTGG + Intronic
1015119103 6:129681927-129681949 CTTGATGAGATACAGCAGAGAGG - Intronic
1017324409 6:153130213-153130235 CTCGATGAGGGACAGCAGGGAGG + Intronic
1017511825 6:155121491-155121513 CTGTTTGAGAGACAGAAGCAGGG + Intronic
1017910403 6:158787498-158787520 CTGCATGAAACTCAGCAGGGCGG + Intronic
1018079684 6:160248042-160248064 GTGTAATAGAGACAGCAGGAAGG + Intronic
1019064670 6:169287210-169287232 CTGCAGGAGGGACAGCAGAGGGG + Intergenic
1023301927 7:38782356-38782378 CTGTGTGAGAGAAAGCAGAGGGG - Intronic
1023370619 7:39508970-39508992 CTGTGAGAGAGACGGCAAGGGGG - Intergenic
1024124458 7:46278288-46278310 ATGTATCAGAGAAAACAGGGTGG + Intergenic
1024213556 7:47227698-47227720 CCGTAGGAGAAACAGCAGTGGGG - Intergenic
1024799444 7:53059237-53059259 GTGGAAGAGAGAGAGCAGGGAGG + Intergenic
1026428373 7:70319218-70319240 CTGTTTGGGAGACAGCAGCAGGG - Intronic
1027429022 7:78090473-78090495 GTGTATGGGAGACTGGAGGGGGG + Intronic
1027743834 7:82047877-82047899 CTGTCTGAGAGACAGTAGTCAGG + Intronic
1028070915 7:86449433-86449455 CTGTATTAGAGAATGCAGGATGG + Intergenic
1029172628 7:98641678-98641700 CTGAAAGAGAAAGAGCAGGGAGG - Intergenic
1029298875 7:99562810-99562832 TTGTAGGAGAGACCCCAGGGTGG + Intronic
1029493515 7:100884900-100884922 CTGTGTGAGCCACAGCAGAGGGG - Intronic
1030277487 7:107736378-107736400 CTGGAGGAGAGAAGGCAGGGTGG - Intergenic
1030598652 7:111568701-111568723 ATGAATGAGAGACAGAAGGCAGG - Intergenic
1030691598 7:112540831-112540853 CTGTTGGAGAGTCAGCAGGAGGG - Intergenic
1030816443 7:114044921-114044943 CTGTATGAGACACCAAAGGGAGG + Intronic
1031833030 7:126650276-126650298 CTGGGTGAGAGAAGGCAGGGTGG - Intronic
1032102071 7:128988560-128988582 CTGAATGAGATACTGCAAGGTGG + Intronic
1032334073 7:131008181-131008203 CTGACTGAGAGGCAGCAGCGGGG - Intergenic
1032418931 7:131762192-131762214 GTGTTTGAGAAACAGCAAGGAGG + Intergenic
1032613808 7:133444213-133444235 CTGAATGAGAGCCAGCAGAATGG + Intronic
1034596632 7:152201265-152201287 CTGTATGTGTGACATGAGGGAGG - Intronic
1036081443 8:5560958-5560980 CTGATTGAATGACAGCAGGGTGG + Intergenic
1036957837 8:13209725-13209747 CAGCAAGAGAGACAGGAGGGAGG - Intronic
1039148288 8:34474742-34474764 CTGTGTGAGGAACAGCAAGGAGG + Intergenic
1039232171 8:35460323-35460345 CAGCTTGAGAGACAGCAGAGTGG + Intronic
1039375456 8:37028182-37028204 CTGGATGAGAGAAAGCATGAGGG + Intergenic
1039609373 8:38906936-38906958 CTGTATGAAATACAGCAGACAGG - Intronic
1040305676 8:46210577-46210599 CCGCAAGAGAGACAACAGGGTGG + Intergenic
1040884119 8:52240952-52240974 TTGAATGAGAGACAACCGGGTGG - Intronic
1041403814 8:57473910-57473932 CTGTTTGAGCCACAGCTGGGTGG + Intergenic
1042466734 8:69136545-69136567 CATTGTGGGAGACAGCAGGGTGG + Intergenic
1043185631 8:77145289-77145311 CTGTATGAAACACAGGAGAGTGG + Intergenic
1043251881 8:78085248-78085270 GTGTATGAGAGACTGCATAGAGG + Intergenic
1043571681 8:81610875-81610897 CTTTGTGAGGGAGAGCAGGGAGG + Intergenic
1047262066 8:123273092-123273114 GTCAATGAGAGACAGCAGGCGGG - Intronic
1047894798 8:129354582-129354604 CTATATAAGAGGCAGCAGTGTGG - Intergenic
1048334825 8:133494721-133494743 CTGCTTGAGGGACAGCATGGAGG - Intronic
1048618855 8:136109386-136109408 GAGTAAGAGAGAGAGCAGGGAGG - Intergenic
1049256984 8:141619418-141619440 CTGTATGAGAAGCAGCTGGGAGG - Intergenic
1049333442 8:142068504-142068526 CTGAGTGATTGACAGCAGGGTGG - Intergenic
1049360470 8:142210397-142210419 CAGTCTGAGAGCCAGCAGGAGGG - Intergenic
1051053182 9:12954626-12954648 ATGCAAGAGAGAGAGCAGGGAGG + Intergenic
1053216528 9:36275271-36275293 CTGAATGTGAGACAGAAAGGAGG - Intronic
1055593577 9:77843304-77843326 CTGTCCTAGAGACAGCAAGGAGG + Intronic
1056156694 9:83845466-83845488 CTGGAGGAGAGAAGGCAGGGTGG - Intronic
1056353844 9:85778061-85778083 CTGGAGGAGAGAAGGCAGGGTGG + Intergenic
1057495278 9:95555515-95555537 GTGTCTGAGGGACAGGAGGGAGG - Intergenic
1060520800 9:124292862-124292884 ATGAATTAGAGACAGCACGGGGG + Exonic
1185447667 X:268053-268075 GTGGTTGAGAGCCAGCAGGGAGG - Intergenic
1186831701 X:13396739-13396761 CAGTAGGAGAGACAGAAGGTGGG + Intergenic
1191674723 X:63783090-63783112 GTGTATGAGAGAGAAAAGGGTGG - Intronic
1191941229 X:66483604-66483626 CTGGGGGAGAGAAAGCAGGGTGG + Intergenic
1192130114 X:68541876-68541898 ATTTCAGAGAGACAGCAGGGAGG - Intergenic
1192600519 X:72458934-72458956 GTATATGAGAGACAGTAGGAAGG - Intronic
1193168630 X:78310700-78310722 CTTTATGAAAGAGAGAAGGGTGG + Intronic
1194980539 X:100435723-100435745 CTATTTGAGACCCAGCAGGGTGG - Intergenic
1195345833 X:103950323-103950345 TTGTTTGAGGAACAGCAGGGAGG + Intronic
1195361765 X:104089114-104089136 TTGTTTGAGGAACAGCAGGGAGG - Intergenic
1195669523 X:107457879-107457901 CTGGAAGAGAAAGAGCAGGGAGG - Intergenic
1195700397 X:107701214-107701236 CTGAATGTGAGACTGCAGGGTGG + Intergenic
1199061965 X:143367056-143367078 TATTATGAGAGACAGCAGGGAGG + Intergenic
1199309734 X:146308663-146308685 CTGTATGACAAATAGCAGTGTGG + Intergenic
1199533038 X:148871102-148871124 CTGCATGAGAAAAAGCAGTGTGG + Intronic
1200842061 Y:7792462-7792484 CTTTATGGGAGACAGCATGGTGG - Intergenic
1201470478 Y:14328829-14328851 GTGTATGAGAGACAGTACTGAGG + Intergenic
1201491698 Y:14548904-14548926 CAGTAAGAGAGACAGTAGGAAGG - Intronic