ID: 1126802648

View in Genome Browser
Species Human (GRCh38)
Location 15:52313708-52313730
Sequence AATGAAGCCCAGGCCGAGGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 1, 1: 0, 2: 0, 3: 40, 4: 285}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126802643_1126802648 3 Left 1126802643 15:52313682-52313704 CCTGGACATCACTTTCAGACCCG 0: 1
1: 0
2: 0
3: 8
4: 157
Right 1126802648 15:52313708-52313730 AATGAAGCCCAGGCCGAGGCTGG 0: 1
1: 0
2: 0
3: 40
4: 285

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126802648 Original CRISPR AATGAAGCCCAGGCCGAGGC TGG Exonic
900013603 1:135164-135186 TGTGAGGCCGAGGCCGAGGCTGG + Intergenic
900043671 1:491147-491169 TGTGAGGCCGAGGCCGAGGCCGG + Intergenic
900065109 1:726150-726172 TGTGAGGCCGAGGCCGAGGCCGG + Intergenic
900347329 1:2215969-2215991 GGTGATGCCCAGGCCGCGGCTGG + Intergenic
901026697 1:6282170-6282192 GATGGAGCCCAGGCCGGGGAGGG - Intronic
901423001 1:9163410-9163432 AGTGAAGCCCTGGCCGAGCGCGG + Intergenic
901459268 1:9382092-9382114 AAGGAGGCCCAGGCCAAGGGAGG + Intergenic
901598219 1:10401723-10401745 AATGAAGCCCAGGCTGGGCGCGG + Intronic
902059098 1:13626824-13626846 AGTGATGCTCAGGCTGAGGCAGG + Intergenic
902871749 1:19317787-19317809 GATCAAGCCCAGGCCCACGCTGG - Exonic
903207461 1:21793396-21793418 AATGTCACCCAGGCTGAGGCAGG + Intergenic
904029168 1:27523304-27523326 ACTGGAGCCCAGGCCTAGGGCGG + Intergenic
904381334 1:30113131-30113153 AAAGGAGGCCAGGGCGAGGCAGG - Intergenic
904466730 1:30712485-30712507 AGGGCAGCCCAGGCCCAGGCTGG + Exonic
904481370 1:30795862-30795884 AAGGAAGCCAAGGCCTGGGCAGG + Intergenic
904620155 1:31770384-31770406 AAGGAGGACCAGGCCGAGGCAGG - Intergenic
904945118 1:34193549-34193571 AAGGAAGCCCAGGCTGGGGGTGG + Intronic
905212367 1:36383431-36383453 AGAGAAGCCCAGGCCAATGCAGG + Intronic
905225895 1:36479049-36479071 AAAGAAGCCCAGGCAGAGCTTGG - Intronic
905335423 1:37241365-37241387 ACTAAAGCCTAGGCTGAGGCAGG - Intergenic
906669845 1:47646403-47646425 CAGGAAGCCCAGGCCCAGGGAGG - Intergenic
906715473 1:47965441-47965463 GATGAAGCCCAGGCAGAGGGAGG + Intronic
908564507 1:65340745-65340767 AATGAAGGTCAGGCAGAGTCGGG - Intronic
912091334 1:106080649-106080671 AATAAAGACCAGGCGGAGGGAGG + Intergenic
912158606 1:106953070-106953092 AATGGAGGCCAGGACTAGGCTGG - Intergenic
912387926 1:109281795-109281817 AGTGAAGCCCAGTCCTCGGCGGG - Exonic
912712964 1:111962564-111962586 AGTGAAGCCCATGCAAAGGCAGG - Intronic
915939646 1:160110748-160110770 AATGCAGCACAGGCAGAGGCTGG + Intergenic
916063598 1:161118776-161118798 GATGAAGCCCAGCCTGAGGAAGG - Exonic
916343472 1:163761823-163761845 AAAGAAGCACAGGACCAGGCAGG + Intergenic
918984642 1:191608421-191608443 AATCAAGAACAGGCCGAGGCAGG + Intergenic
919565090 1:199174507-199174529 AATGAAGCATAGGCTGGGGCTGG - Intergenic
919831523 1:201544056-201544078 AATGAAGCCCGCGCTGAGGCTGG - Intergenic
919932642 1:202231269-202231291 AATGGAGCCCAGGCTCAGCCAGG - Intronic
920180847 1:204130961-204130983 CATGAAGCCCAGGTGGAGGGGGG + Intergenic
922100216 1:222472987-222473009 TGTGAGGCCGAGGCCGAGGCCGG + Intergenic
922779970 1:228244334-228244356 AATGAGGTGCAGGCTGAGGCGGG + Exonic
922780095 1:228245451-228245473 AATGAGGTGCAGGCTGAGGCGGG + Exonic
1063892480 10:10644752-10644774 AAGGAAGCCCAGGACGTGGGGGG - Intergenic
1064142543 10:12802808-12802830 AATGAAGAGCAGGCCGGGGGCGG - Intronic
1064258770 10:13767911-13767933 AGAGAAGCCCAGGGCGATGCTGG + Intronic
1066218884 10:33316074-33316096 CAAGAAGCACAGACCGAGGCAGG + Intronic
1066733275 10:38451740-38451762 TGTGAGGCCGAGGCCGAGGCCGG - Intergenic
1067142702 10:43669877-43669899 AACCAAGCCCAGGCCAAGGTGGG - Intergenic
1070449642 10:76545031-76545053 AATGAAGAGCAGGTGGAGGCTGG + Intronic
1071554817 10:86593784-86593806 TGGGAGGCCCAGGCCGAGGCGGG + Intergenic
1071815500 10:89228307-89228329 AATGAAGCCCAGGCTGCTGTTGG + Exonic
1073000295 10:100279630-100279652 AATACAGGCCAGGCCGAGGTGGG + Intronic
1074599455 10:114899073-114899095 AGTGAAGCCCAGCCCTAAGCTGG + Intronic
1075091976 10:119448900-119448922 GATGCAGACCAGGCAGAGGCTGG + Intronic
1075184694 10:120245225-120245247 AATGAAGGCCAGGCTGAGGAGGG + Intergenic
1075330801 10:121572692-121572714 AAGGAAGGCCAGGTCAAGGCAGG - Intronic
1075406692 10:122200189-122200211 GATGCAGTCCAGGCAGAGGCTGG + Intronic
1076489014 10:130844052-130844074 CATGAATCCCAGGCCGGGACTGG - Intergenic
1076969945 11:127378-127400 TGTGAGGCCGAGGCCGAGGCCGG + Intergenic
1077386816 11:2273152-2273174 AATGAAGGAGGGGCCGAGGCAGG - Intergenic
1077956703 11:7028407-7028429 AATGATGTCTAGGGCGAGGCCGG - Intronic
1078010739 11:7571224-7571246 AAAGAAACCCAGACCCAGGCTGG + Intronic
1078310432 11:10235819-10235841 AATGTAGTCCAGGATGAGGCAGG + Intronic
1078959648 11:16249424-16249446 AATGAAGTCCAGGCTGAAGTGGG - Intronic
1079625434 11:22611545-22611567 AATGAAATCCAGGCTGAGGTGGG - Intergenic
1081459305 11:43256854-43256876 GATGAAGAGCAGGCAGAGGCGGG + Intergenic
1081536645 11:44001714-44001736 CATGAACCCCAGGCAAAGGCTGG - Intergenic
1081665720 11:44916037-44916059 AAAGCAGCCCAGCCCGTGGCGGG - Intronic
1081727664 11:45342521-45342543 AATAAAGCCACGGCCAAGGCAGG + Intergenic
1083274099 11:61587286-61587308 CAGGGAGCCCAGGCCGAGTCTGG + Intergenic
1083592343 11:63903119-63903141 GATGGAGGCCTGGCCGAGGCTGG - Exonic
1083745601 11:64735046-64735068 ACTGAAGCCCAGGCAGAAGTGGG + Intronic
1083987896 11:66228906-66228928 CATAAAGACCAGGCAGAGGCAGG + Intronic
1084734067 11:71093173-71093195 AATGTTGACCAGGCCGAGGAAGG - Intronic
1084844507 11:71888577-71888599 TGTGGGGCCCAGGCCGAGGCTGG + Intronic
1085425939 11:76404676-76404698 GAGGAAGCCCAGGCCATGGCAGG + Exonic
1086389964 11:86353626-86353648 AAAGAAGATGAGGCCGAGGCAGG - Intergenic
1087012848 11:93529794-93529816 AAGGAACTCCAGGCGGAGGCTGG - Intronic
1088469915 11:110180360-110180382 AATGAATCCCAGCCCAAAGCTGG - Intronic
1090028262 11:123185691-123185713 AATGAAGTCCTGGGCCAGGCAGG - Intronic
1092486000 12:8902509-8902531 AATAAAATCCAGGCTGAGGCCGG - Intergenic
1092758685 12:11789454-11789476 GCTGAAGCCCAGACCGAAGCAGG - Intronic
1092980392 12:13788858-13788880 AATGATGCTCAGGCCAAGGCAGG - Intronic
1095957907 12:47817206-47817228 GAGGAGGCCCAGGCCAAGGCTGG - Intronic
1096908686 12:54960955-54960977 AATGATGCCCAGGCTTTGGCAGG - Intronic
1099495614 12:83342734-83342756 AATGAAGTCCAGGCTAAGGCCGG + Intergenic
1100086542 12:90917709-90917731 AAAGAAGCCCAGACCGAGGTAGG - Intronic
1102435755 12:112922000-112922022 AATGGAGCCCTGGCCAAGTCAGG - Intronic
1102993893 12:117333636-117333658 AACGCAGCCCAGGCTGAGCCCGG - Intronic
1104090115 12:125509286-125509308 CAGGAAGCCCCGGCCCAGGCAGG - Intronic
1104917471 12:132273353-132273375 CAGGAACCCCAGGCCGAGGCGGG - Intronic
1104929163 12:132329251-132329273 GCTGAAGCCCAGGCCCGGGCGGG - Intronic
1106457906 13:29943788-29943810 GATGAAGGAAAGGCCGAGGCTGG + Intergenic
1107729983 13:43338979-43339001 AATTAAACCCAACCCGAGGCCGG - Intronic
1109072191 13:57784171-57784193 AAAGAAGCCCAGGACCAGGCTGG - Intergenic
1109442817 13:62397622-62397644 GAGGAAGCCCAGGCTGTGGCTGG + Intergenic
1110848251 13:80214561-80214583 AATGAATCCCAAGCCAAGGAGGG + Intergenic
1111129513 13:83956191-83956213 ACTGAAGCCCAGGCCGGGTGCGG - Intergenic
1113078564 13:106492629-106492651 AATGCACCCCAGGCAGAAGCCGG + Exonic
1113489300 13:110678866-110678888 AAGGCAGCGCAGGCGGAGGCTGG + Intronic
1114510671 14:23257261-23257283 CAGGAAGCCAAGGCTGAGGCAGG - Intronic
1114947531 14:27703311-27703333 AATGAAGCCCCAGCCGAGCGCGG - Intergenic
1115811618 14:37115217-37115239 AATGAAGACCAGGCCCAGGAGGG + Intronic
1116276506 14:42839998-42840020 AATGAGACCCAGGCCAAGGCGGG - Intergenic
1120469303 14:84902800-84902822 AATGAAGTCCAGGCTGTGGTGGG + Intergenic
1122130091 14:99599957-99599979 AAGGCAGCCCTGGCTGAGGCTGG - Intronic
1123412910 15:20074064-20074086 CATGGAGGCCAGGCTGAGGCTGG + Intergenic
1123522252 15:21081177-21081199 CATGGAGGCCAGGCTGAGGCTGG + Intergenic
1123735711 15:23180472-23180494 ACTGAGGCCAAGGCAGAGGCGGG - Intergenic
1124286425 15:28403455-28403477 ACTGAGGCCAAGGCAGAGGCGGG - Intergenic
1124296278 15:28508181-28508203 ACTGAGGCCAAGGCAGAGGCGGG + Intergenic
1126113544 15:45188737-45188759 AATGAAGCCCGGGATGTGGCTGG - Intronic
1126248771 15:46541917-46541939 AATCAAGCCTAGGCAGTGGCAGG + Intergenic
1126802648 15:52313708-52313730 AATGAAGCCCAGGCCGAGGCTGG + Exonic
1129204757 15:74030314-74030336 AATGAAGAGCACGCCGGGGCAGG + Intronic
1129699022 15:77757030-77757052 AATGAAGCCCAAGCCTGGGAAGG + Intronic
1130107989 15:80943303-80943325 AATGTAGGTCAGGCGGAGGCAGG + Intronic
1130112216 15:80975133-80975155 AGTGAATCGGAGGCCGAGGCAGG + Intronic
1132894779 16:2223656-2223678 GCAGAAGCCCAGGCCGAAGCCGG + Exonic
1135800441 16:25489192-25489214 AATGAGTCCCAGGGAGAGGCCGG + Intergenic
1135906349 16:26515423-26515445 AATAAAGCCAAGGCCGTGGAGGG + Intergenic
1136008156 16:27345163-27345185 ACTGAGGCCCAGGCAGGGGCAGG - Intronic
1136153453 16:28366908-28366930 ATCCCAGCCCAGGCCGAGGCGGG + Intergenic
1136209633 16:28748359-28748381 ATCCCAGCCCAGGCCGAGGCGGG - Intergenic
1136478379 16:30526752-30526774 AGTGCAGCCCAGCCCGGGGCCGG - Intronic
1137728498 16:50673010-50673032 AATGAACCCCAGGCCAGGGGTGG + Exonic
1139754094 16:69129132-69129154 AGAAAAGCCCAGGCAGAGGCCGG + Intronic
1140476755 16:75242832-75242854 CATGGAGGCCAGGCTGAGGCTGG + Exonic
1140800154 16:78479816-78479838 AATGAAAGCCAGGCTGAGGCTGG + Intronic
1141424120 16:83934504-83934526 ATGGAAGCCGAGGCCGAGACAGG - Intronic
1141762599 16:86038642-86038664 AGGGAAGCCCAGGCCAATGCGGG - Intergenic
1142297546 16:89235866-89235888 AACCAAGCCCAGGCCGGGGGCGG + Exonic
1142426140 16:90003288-90003310 AAGGTAGCCCAGGCCGGGGGAGG - Intergenic
1142450735 16:90171754-90171776 TGTGAGGCCGAGGCCGAGGCCGG - Intergenic
1142456830 17:61937-61959 TGTGAGGCCGAGGCCGAGGCCGG + Intergenic
1142496751 17:310081-310103 AATGCATCCCAGGCTCAGGCGGG + Intronic
1142970649 17:3609400-3609422 AAAGGAGCCCAGGCTCAGGCAGG - Exonic
1144197461 17:12908441-12908463 CATGAGGCAGAGGCCGAGGCGGG - Intronic
1144623907 17:16834711-16834733 AGTGGAGCCCAGGCAGAGGCAGG - Intergenic
1144882522 17:18438005-18438027 AGTGGAGCCCAGGCAGAGGCAGG + Intergenic
1145149712 17:20506381-20506403 AGTGGAGCCCAGGCAGAGGCAGG - Intergenic
1146252850 17:31365006-31365028 AATGAAACCCAGGCTGAGTGCGG + Intronic
1148181253 17:45606556-45606578 AATAAAGCCCACGCTGAGGTAGG - Intergenic
1148267657 17:46239389-46239411 AATAAAGCCCACGCTGAGGTAGG + Intergenic
1148330876 17:46813275-46813297 AATGAAGCCCAGAAGGAGGCAGG + Intronic
1150230371 17:63546366-63546388 AATGGAGCCCTGGAGGAGGCTGG - Exonic
1151569656 17:74919891-74919913 CATGGTGCCCAGGCCGGGGCGGG + Exonic
1153225497 18:2896731-2896753 CCTGAATCCCAGGCTGAGGCAGG - Intronic
1157286728 18:46382061-46382083 ACAGATGCCCAGGCTGAGGCAGG - Intronic
1157628004 18:49067577-49067599 AAACAAGCACAGGCTGAGGCTGG + Intronic
1158198728 18:54916666-54916688 AATGAAGCCCCTGCCAAGGTTGG - Intronic
1160318347 18:77868353-77868375 AATGAAGCTCAGGCCAGGGCAGG + Intergenic
1160542925 18:79634884-79634906 AATGAAGCCCATGCAGAGGAAGG + Intergenic
1160646747 19:197296-197318 TGTGAGGCCGAGGCCGAGGCCGG + Intergenic
1161515922 19:4696422-4696444 CATGTTGCCCAGGCCCAGGCAGG - Intronic
1161647459 19:5462340-5462362 AATGTAGCCCAGAGAGAGGCGGG + Intergenic
1162056226 19:8065751-8065773 ACAGAGGCCCAGGCAGAGGCCGG + Exonic
1162111148 19:8400408-8400430 AATGGAGGCCAGGCCCAGGTGGG - Intronic
1164856360 19:31527652-31527674 AGGGAAGCCCAGGATGAGGCAGG + Intergenic
1166715097 19:44961873-44961895 CATGAAGGCCAGGCACAGGCTGG - Intronic
1167096633 19:47378005-47378027 ACTGAAGCTCAGGCAGGGGCGGG + Intronic
1168132824 19:54332050-54332072 ACTGAGGCCCAGGCAGAGGAGGG + Intergenic
1168306623 19:55439392-55439414 AAAGAGGCCCAGGAGGAGGCTGG - Intronic
925303707 2:2834920-2834942 AGTGAACCCCAGGCCGTGGAAGG + Intergenic
926431121 2:12786574-12786596 AATGAAATCCAGGCTGAGGTGGG - Intergenic
929200220 2:39227479-39227501 AAATATGCCCAGGCTGAGGCAGG + Intronic
929818722 2:45257007-45257029 ACTGCAGCTCAGGCCTAGGCTGG + Intergenic
929909326 2:46075543-46075565 TATGTTGCCCAGGCCCAGGCTGG - Intronic
929979189 2:46663103-46663125 AATGTAGCCCTTGCAGAGGCAGG + Intergenic
933386027 2:81611247-81611269 AATGAAGCACAAGCCAAGGCAGG + Intergenic
933751900 2:85608143-85608165 TCTGTAGCCCTGGCCGAGGCAGG + Exonic
934993950 2:98940082-98940104 CATGAGGCCCAGGGCTAGGCAGG - Intergenic
935285621 2:101561459-101561481 GATGAAGACGAGGCAGAGGCAGG - Intergenic
938011253 2:127830850-127830872 TATGTTGCCCAGGCTGAGGCTGG + Intergenic
939183314 2:138829052-138829074 AGTGATGTCGAGGCCGAGGCGGG + Intergenic
944491428 2:200262175-200262197 AATGAAGGCCAGGCTAAGGAGGG + Intergenic
948014879 2:234680317-234680339 AATGCAGCCAAGGCCTGGGCTGG - Intergenic
948250982 2:236528790-236528812 ACTGAAACCCAGGCCCATGCAGG - Intergenic
948473633 2:238203112-238203134 AAGGCAGCCCAGGCCGCGGGTGG + Intronic
948881531 2:240860102-240860124 AATGTGGCCCAGACAGAGGCAGG + Intergenic
948929726 2:241124282-241124304 AGAGCAGCCCAGGCAGAGGCAGG + Intronic
1168769641 20:407425-407447 AAGGAGGCCCAGGAGGAGGCTGG + Intergenic
1170155075 20:13261904-13261926 TATAAGGCCCAGGCCAAGGCTGG - Intronic
1170329940 20:15197941-15197963 AAAGGAGGCCAGGCCAAGGCAGG - Intronic
1170573143 20:17643702-17643724 GATGAAGCCCAGGCAGTGACAGG + Intronic
1170640590 20:18148898-18148920 AATGAATCCCAGGCCGGGCATGG - Intronic
1170980977 20:21212851-21212873 CTTGAAGGCCAGGCCAAGGCTGG - Intronic
1171045302 20:21805051-21805073 AATGTAGCCAGGGCCAAGGCAGG + Intergenic
1171425639 20:25046936-25046958 AAAGGAGCCCTGGCCGAGGCTGG + Intronic
1172672767 20:36645749-36645771 AATAAAGCCCAGTCCCAGTCGGG + Intronic
1173863607 20:46300075-46300097 ACTGAGGCCCAGGGAGAGGCTGG - Intronic
1174043755 20:47718503-47718525 AATTAAGGCCAGTCCGAGGCAGG + Intronic
1174947147 20:55000225-55000247 AATTAAGGCAAGGCCCAGGCAGG - Intergenic
1176082422 20:63280675-63280697 AATGAAGCCCACACACAGGCTGG - Intronic
1176111024 20:63410780-63410802 AATGAAGCCCAGGCCTGAGCTGG - Intronic
1178416799 21:32411641-32411663 AATGAGGCCCAGGGCGGGGCCGG - Intergenic
1178551510 21:33543284-33543306 AATGGATCCCAGGCCCAGGCGGG - Intronic
1178689168 21:34736949-34736971 AAGGGAGCCCAGGCCGATGGGGG - Intergenic
1179663578 21:42893610-42893632 CCCGAGGCCCAGGCCGAGGCTGG + Intronic
1180019063 21:45108899-45108921 ATTGCAGCCCAGGCCAAGCCAGG + Intronic
1180061571 21:45388077-45388099 CAAGCAGCCCAGGCCCAGGCTGG + Intergenic
1180143489 21:45907041-45907063 GCTGAAGGCCAGGCGGAGGCCGG + Intronic
1180943843 22:19678943-19678965 TATGAACCCCAGGCTGAGGCAGG + Intergenic
1182055806 22:27353738-27353760 TATGTTGCCCAGGCCCAGGCTGG + Intergenic
1182122544 22:27797220-27797242 CATGATGCCCAGGCCGAGGGCGG + Exonic
1183483739 22:38078405-38078427 AATAGAGGCGAGGCCGAGGCTGG - Exonic
1184769086 22:46587579-46587601 CAGGCAGCCCAGGCCGGGGCGGG + Intronic
1185010379 22:48309489-48309511 ACCGACGCCCAGGCCGAGGGTGG + Intergenic
952624960 3:35392794-35392816 AATGAAGTCCAGGCTGAGATGGG - Intergenic
953504459 3:43470575-43470597 AATAATTACCAGGCCGAGGCAGG - Intronic
954615020 3:51965047-51965069 AGTCAAGCCCGGGCCCAGGCTGG + Intronic
955522729 3:59791027-59791049 AATGGAGCCCAGGCAAAGTCAGG - Intronic
959531078 3:107434107-107434129 AAGGAAGGCCAGGCAGAGGATGG - Intergenic
959733282 3:109628573-109628595 AAGGAAGCCCAGGCAGAAGATGG - Intergenic
960812459 3:121637644-121637666 AGTGAAGCTCAGGCCGAGCACGG + Intronic
961451943 3:127006202-127006224 CAAGTAGCCCAGGCCCAGGCGGG - Intronic
961542690 3:127610791-127610813 AATGCATCCCTGGCAGAGGCTGG + Intronic
966219291 3:177534666-177534688 AATGCATTTCAGGCCGAGGCGGG - Intergenic
968181676 3:196599528-196599550 GTGGAAGCCCAGGCAGAGGCGGG + Intergenic
968370934 3:198222226-198222248 TGTGAGGCCGAGGCCGAGGCCGG - Intergenic
968382340 4:107592-107614 CATGGAGCCCGGGCCGAGCCCGG - Intergenic
968655551 4:1777087-1777109 AATGAAGTCCTGGCGGAGGAAGG + Intergenic
968755940 4:2416820-2416842 AATCAAGCCAAGGCCGAGCAAGG + Intronic
968905769 4:3449903-3449925 AGTGCAGCCCAGGCTCAGGCAGG - Intergenic
969729382 4:8944918-8944940 TATGCGGCCCTGGCCGAGGCCGG + Intergenic
969785552 4:9454452-9454474 AGTGGGGCCCAGGCCGAGGCAGG + Intergenic
969788964 4:9478858-9478880 TGTGGGGCCCAGGCCGAGGCCGG + Intergenic
971483976 4:27140868-27140890 AATGATGACCCGGCTGAGGCGGG + Intergenic
972045949 4:34664467-34664489 AGTAAAGCCCAGGACCAGGCAGG - Intergenic
972565461 4:40265284-40265306 CAAGGAGCCCAGGCCCAGGCTGG - Intergenic
972733461 4:41817482-41817504 ACTGAAGACCAGGCAGAGGCAGG - Intergenic
973340266 4:48996118-48996140 AAGCAAGCCCAGGCAGAGGGGGG - Intronic
973672278 4:53233047-53233069 AAAGAAGCCTATGCCTAGGCTGG - Intronic
973924351 4:55722431-55722453 AATGAAACCAAGCCCTAGGCAGG + Intergenic
974436532 4:61863525-61863547 AATGATGCCCAGGCCGGGCACGG - Intronic
974843310 4:67322792-67322814 AATAAAGTCCAGGCTGAGGTGGG + Intergenic
975284938 4:72606477-72606499 AATGAAGTCCAGGCTGAGGGTGG + Intergenic
976539493 4:86256994-86257016 AATGGAGTATAGGCCGAGGCGGG - Intronic
977855740 4:101889350-101889372 AAAGAATCACAGGCCGAGGCGGG + Intronic
979092244 4:116499479-116499501 AATAAAACTAAGGCCGAGGCGGG + Intergenic
979259620 4:118634714-118634736 TGTGAGGCCGAGGCCGAGGCCGG - Intergenic
979328753 4:119405910-119405932 TGTGAGGCCGAGGCCGAGGCCGG + Intergenic
984545592 4:181098365-181098387 AATGAAGCTGAGGCCTAGGAAGG + Intergenic
984587759 4:181582406-181582428 AATGAACCAGAGGCCCAGGCAGG + Intergenic
985907536 5:2852669-2852691 ACTGACACCCAGGCTGAGGCTGG - Intergenic
985963117 5:3318710-3318732 AGAGAAGCTCAGGCCTAGGCTGG - Intergenic
986194547 5:5526222-5526244 AGTGAAGCCCTGGCTGAGGTGGG + Intergenic
986427926 5:7653266-7653288 AGTGAAACCCACGCCCAGGCTGG - Intronic
987326094 5:16812647-16812669 AATGGAGCCAAGTTCGAGGCAGG + Intronic
987560326 5:19511526-19511548 AATGAAGTCCAGGCTGAGGACGG + Intronic
989534464 5:42548094-42548116 ACTGAAGGCCAGGCCTAGGCTGG - Intronic
990045498 5:51425770-51425792 CATGAAACCAAGGCCAAGGCAGG + Intergenic
990846369 5:60144557-60144579 AATGAAGACCAGAGCCAGGCTGG - Intronic
991691631 5:69231078-69231100 AAGAAAGCCCAGGGCCAGGCCGG + Intergenic
997091641 5:130865164-130865186 AATGAAGTCCAGGTTGAGGTGGG - Intergenic
998757014 5:145391926-145391948 AATGAAATCCAGGCTGAGGTGGG - Intergenic
999370350 5:151051493-151051515 ACTGAGGCCCAGGGAGAGGCAGG - Intronic
1001058804 5:168470989-168471011 AGTGAAACCCAGGCAGAGACAGG + Intronic
1001365503 5:171134671-171134693 AAATAAGCCCAGGTCGAGGCAGG + Intronic
1002441830 5:179268329-179268351 AATGAAAGCCAGGCCAAGGGTGG + Intronic
1002562315 5:180090650-180090672 AAAGAAGCCGAGGCCGTCGCCGG - Intergenic
1002730172 5:181327782-181327804 TGTGAGGCCGAGGCCGAGGCCGG - Intergenic
1002994770 6:2272455-2272477 TATGATGCCCTGGCTGAGGCGGG - Intergenic
1003081647 6:3025990-3026012 AATGCAGCCCAGGCAGAGGACGG + Intergenic
1005609357 6:27508867-27508889 CATAAATCTCAGGCCGAGGCGGG - Intergenic
1006753884 6:36397762-36397784 AATGACTCCTAGGCCAAGGCAGG + Intronic
1007521222 6:42452817-42452839 AAAGATGCCGAGGTCGAGGCGGG + Intergenic
1008116336 6:47554745-47554767 CATGAAGCCCAGGACGATTCAGG + Exonic
1008255880 6:49298797-49298819 AAAGAAGCCCAGGACAAGTCTGG - Intergenic
1008848279 6:55994372-55994394 AATGAAGTCAAGGCAGAGGGAGG - Intergenic
1011745269 6:90402507-90402529 AATGAAGCCAACGCCGTGCCAGG - Intergenic
1015684290 6:135842028-135842050 CCTGAATTCCAGGCCGAGGCAGG - Intergenic
1017017876 6:150116276-150116298 AGAGAAGTCCAGGCCCAGGCAGG - Intergenic
1017058585 6:150459759-150459781 ATTGAAGCCCAAGCAGAGGAAGG - Intergenic
1017544605 6:155437615-155437637 AATGATGCCCAGACATAGGCAGG + Intronic
1018973299 6:168544424-168544446 AACACAGACCAGGCCGAGGCAGG + Intronic
1019045933 6:169146092-169146114 CATGAAGCACAGGCCGTTGCTGG - Intergenic
1019406565 7:887139-887161 ACGGACGCCCTGGCCGAGGCGGG - Intronic
1019447595 7:1079539-1079561 AATAAAACCCAGGAAGAGGCCGG + Intronic
1019557927 7:1641808-1641830 AATGGAACCCAGGCTCAGGCAGG - Intergenic
1020465379 7:8472674-8472696 AATAAATCCCAGGCCAAGTCAGG + Intronic
1022040359 7:26575541-26575563 GAAAAAGACCAGGCCGAGGCAGG - Intergenic
1022468678 7:30668329-30668351 GATGAAGGCCAAGCAGAGGCAGG - Intronic
1024513891 7:50226897-50226919 AATGAAGCCCAGGATGAGTGGGG + Intergenic
1025117523 7:56270931-56270953 AATGAAACCAAAGCAGAGGCCGG - Intergenic
1029416675 7:100447462-100447484 ACTGAAGACTAGGCTGAGGCTGG + Intergenic
1030038857 7:105432121-105432143 GATGAAGCCCAGGCTGAGTTTGG + Intergenic
1030971079 7:116056267-116056289 AAGCAAACCCAGGCAGAGGCTGG + Intronic
1032320262 7:130880016-130880038 AGTGAGGCTGAGGCCGAGGCAGG + Intergenic
1034298587 7:149995586-149995608 AATTAAGCACAGGATGAGGCTGG + Intergenic
1038154150 8:24971640-24971662 CATGAAGCCCAGTCCAAGGCAGG + Intergenic
1038350652 8:26773479-26773501 CATTAAGCACAGGCCCAGGCAGG - Intronic
1038477834 8:27880648-27880670 CATGCTGCCCAGGCTGAGGCTGG - Intronic
1041710044 8:60886179-60886201 AAGGAAGTGTAGGCCGAGGCAGG - Intergenic
1044558479 8:93589936-93589958 AATGAAGCCCAGGCTGGGCATGG + Intergenic
1044628318 8:94255996-94256018 ACGGAAGCCCAGGGAGAGGCCGG - Intronic
1047880350 8:129186110-129186132 AATGAAGCCCTGGATGAGGAGGG + Intergenic
1048957457 8:139548784-139548806 TATGGGGCCCTGGCCGAGGCTGG - Intergenic
1049643290 8:143725127-143725149 AGTGAAGCCCAGGCGGGGGAGGG + Exonic
1049997094 9:1044324-1044346 AAGGAAGCCCAGGCCCAGGAAGG + Intergenic
1051224553 9:14885168-14885190 AATGATGGGGAGGCCGAGGCGGG - Intronic
1051659718 9:19414563-19414585 ACTTGAGCCCAGGCTGAGGCTGG + Intronic
1052173900 9:25433529-25433551 AATGAAATCCAGGCTGAGGTGGG - Intergenic
1052991528 9:34521743-34521765 GGTGAGGCCCATGCCGAGGCAGG + Exonic
1053461713 9:38276661-38276683 AATGAAGCCCAGGACAGGGAAGG + Intergenic
1055148680 9:72967700-72967722 AAAGAAATCCAGGCTGAGGCAGG - Intronic
1056207594 9:84335250-84335272 AATAAAGCCTTGCCCGAGGCTGG + Intronic
1056208161 9:84340068-84340090 AATGCTGCTCAGCCCGAGGCTGG - Intronic
1056507402 9:87270286-87270308 ACAGAAGCCCAGGCCGGCGCTGG + Intergenic
1057708303 9:97413237-97413259 AAGGCAGCCCAGGACGAGACAGG - Intronic
1058834590 9:108849692-108849714 AATAAAATCCAGGCTGAGGCAGG - Intergenic
1059191387 9:112330148-112330170 AATGTAGCCTAGGCTTAGGCCGG - Intronic
1059887386 9:118761548-118761570 AATGAAGCGCAGCCAGTGGCTGG - Intergenic
1062542604 9:137048299-137048321 AGTGATGCCCAGGCTGAAGCGGG + Exonic
1062754583 9:138280296-138280318 TGTGAGGCCGAGGCCGAGGCCGG - Intergenic
1203578489 Un_KI270745v1:24456-24478 TGTGAGGCCGAGGCCGAGGCCGG - Intergenic
1186781447 X:12916125-12916147 AGTGGAACCTAGGCCGAGGCGGG - Intronic
1187243332 X:17532667-17532689 AAGAAAGCCCAGACCAAGGCAGG + Intronic
1187349504 X:18499607-18499629 TAGGAGGCCGAGGCCGAGGCGGG - Intronic
1192234087 X:69285260-69285282 ACTGAAGCCCAGGGAGAGGATGG + Intergenic
1192577968 X:72258055-72258077 AATGAAGCCAATGGCCAGGCAGG + Intronic
1194850136 X:98859302-98859324 AATGAAGTCCAGGCTGAGGTGGG + Intergenic
1197648590 X:129042056-129042078 AGTGAGGCCTAGGCTGAGGCAGG + Intergenic
1198450514 X:136762951-136762973 AATCAAACCCAGACCAAGGCAGG + Intronic
1199112732 X:143954624-143954646 AATGAAGTCCAGGCTAAGGTTGG + Intergenic
1199164098 X:144649386-144649408 AATAACACACAGGCCGAGGCAGG + Intergenic
1199729698 X:150619710-150619732 AAAGGAGGCAAGGCCGAGGCAGG - Intronic
1199858702 X:151780705-151780727 AAAGAGGCCCAGGCAGAGGCTGG - Intergenic
1200243290 X:154508721-154508743 GATGTGGCTCAGGCCGAGGCTGG + Intronic
1200556243 Y:4639792-4639814 AATAAAGTCCAGGCTGAGGTGGG + Intergenic