ID: 1126804630

View in Genome Browser
Species Human (GRCh38)
Location 15:52334848-52334870
Sequence GCTCTCTGTGTACCACAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 113}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126804630_1126804634 7 Left 1126804630 15:52334848-52334870 CCAAATTGTGGTACACAGAGAGC 0: 1
1: 0
2: 1
3: 6
4: 113
Right 1126804634 15:52334878-52334900 TAACGTCTGTCTGGGTAATCAGG 0: 1
1: 0
2: 0
3: 3
4: 56
1126804630_1126804635 12 Left 1126804630 15:52334848-52334870 CCAAATTGTGGTACACAGAGAGC 0: 1
1: 0
2: 1
3: 6
4: 113
Right 1126804635 15:52334883-52334905 TCTGTCTGGGTAATCAGGAAAGG 0: 1
1: 0
2: 4
3: 16
4: 208
1126804630_1126804636 24 Left 1126804630 15:52334848-52334870 CCAAATTGTGGTACACAGAGAGC 0: 1
1: 0
2: 1
3: 6
4: 113
Right 1126804636 15:52334895-52334917 ATCAGGAAAGGCTACTCTTGAGG 0: 1
1: 0
2: 1
3: 7
4: 126
1126804630_1126804632 -1 Left 1126804630 15:52334848-52334870 CCAAATTGTGGTACACAGAGAGC 0: 1
1: 0
2: 1
3: 6
4: 113
Right 1126804632 15:52334870-52334892 CAGAACCATAACGTCTGTCTGGG 0: 1
1: 0
2: 0
3: 5
4: 65
1126804630_1126804631 -2 Left 1126804630 15:52334848-52334870 CCAAATTGTGGTACACAGAGAGC 0: 1
1: 0
2: 1
3: 6
4: 113
Right 1126804631 15:52334869-52334891 GCAGAACCATAACGTCTGTCTGG 0: 1
1: 0
2: 0
3: 3
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126804630 Original CRISPR GCTCTCTGTGTACCACAATT TGG (reversed) Intronic
900834810 1:4993359-4993381 TATCTCTGTGTACAACATTTAGG + Intergenic
905279706 1:36841323-36841345 TCTCTCTGTGTCCAAGAATTTGG + Intronic
908021283 1:59901221-59901243 GGAGACTGTGTACCACAATTGGG - Intronic
909362339 1:74777926-74777948 TCTCTCTGAGTACCACTGTTTGG - Intergenic
909735011 1:78947765-78947787 TCTCTCTGTGCTCCCCAATTAGG - Intronic
911360196 1:96866283-96866305 GCTCAGTGTGTAACAGAATTAGG - Intergenic
916276545 1:163000307-163000329 GCTCTCTGTGTTCTGCAAGTTGG + Intergenic
918529069 1:185497362-185497384 CCTCTCTGTGCCCCAAAATTGGG - Intergenic
919527578 1:198672858-198672880 CCACTCTGTGTTCCACAAATGGG + Intronic
921387844 1:214588777-214588799 CCTATCTGTGAACCACAATCAGG + Intergenic
1063180787 10:3597857-3597879 CCTGTCTATGTATCACAATTGGG + Intergenic
1064118545 10:12599591-12599613 GCTCTCTTTCTACCACGAATAGG - Intronic
1064603962 10:17019116-17019138 GCTCTCTAGGGACCACATTTTGG + Intronic
1065535934 10:26714720-26714742 GATCTCTGTACAGCACAATTTGG - Intronic
1066266862 10:33784304-33784326 GCTCTCTACATACCAAAATTAGG + Intergenic
1067795085 10:49315138-49315160 GCTCTGTGTCTACCACCATACGG - Intronic
1068062993 10:52092838-52092860 TCAGTTTGTGTACCACAATTTGG - Intronic
1068734163 10:60393073-60393095 GATCTCTCTGTACTACATTTTGG - Intronic
1070278567 10:75031301-75031323 CCTCTCTTTGGACTACAATTTGG + Exonic
1074201512 10:111240311-111240333 GCTGTCTGTGTGTCACATTTTGG - Intergenic
1075409017 10:122213847-122213869 GCACTCTGTGGGCCTCAATTTGG - Intronic
1079728832 11:23914530-23914552 GATCACTGTGGACAACAATTTGG - Intergenic
1079970768 11:27032282-27032304 GTTTTCTGTGTGCCACAAGTAGG - Intergenic
1086321921 11:85658708-85658730 GCTCTTAGTGTACTATAATTTGG - Intergenic
1086407995 11:86515745-86515767 GCTCTCTGTATTCCACAGCTGGG + Intronic
1091165954 11:133476303-133476325 TCTCTCTGTGCACCCCAATCAGG - Intronic
1091840000 12:3613977-3613999 CCTCTCTGTGTGCCCCACTTGGG + Intronic
1097346794 12:58502226-58502248 TCCCTCTGTGGAACACAATTAGG - Intergenic
1100394891 12:94176442-94176464 CCCCTCTGTGTAGCACATTTGGG + Intronic
1102253698 12:111404723-111404745 GCTCTCTGTGTTAAACAAATCGG - Intergenic
1102507212 12:113391122-113391144 TCTGTCTGTATACCACAATATGG - Exonic
1110459246 13:75726912-75726934 GCTCTCTGTATAACACATTGAGG + Intronic
1111171150 13:84528183-84528205 GCTCTCTATGTGCCACAGGTAGG + Intergenic
1112219227 13:97471188-97471210 GCACTCTCTGGAGCACAATTTGG + Intergenic
1112921940 13:104624833-104624855 GCTCTTTGTATACCATATTTTGG + Intergenic
1113061535 13:106327514-106327536 GCTATCTCTGTATCATAATTGGG + Intergenic
1113132848 13:107057338-107057360 CCTCTCTTTGGAACACAATTTGG + Intergenic
1117954117 14:61109612-61109634 GCTTTCTATGTCCCACAACTTGG - Intergenic
1118844558 14:69537127-69537149 GGTTTCTGAGTGCCACAATTTGG + Intergenic
1120432994 14:84443663-84443685 TCTCTCTCTGGAACACAATTTGG - Intergenic
1120767436 14:88342320-88342342 GCCATCTGTGTCCCACAATTAGG + Intergenic
1123782441 15:23641908-23641930 GCTCTTTGTGGAACAAAATTTGG - Intergenic
1124077808 15:26462276-26462298 GTTCTCTGTGCACCACAGTCAGG - Intergenic
1126804630 15:52334848-52334870 GCTCTCTGTGTACCACAATTTGG - Intronic
1138925049 16:61580997-61581019 GCTCTTTCAGTACCACCATTCGG + Intergenic
1140026398 16:71294095-71294117 GCTTTCTGTCTTCAACAATTTGG + Intergenic
1140664413 16:77214485-77214507 CCTCTCTGTGTCACACAAATGGG + Intergenic
1140693756 16:77511103-77511125 GCTCTTTGTGGACCTCCATTAGG - Intergenic
1145223625 17:21109303-21109325 TCTATCTTTGTACCACAACTGGG + Intergenic
1148812185 17:50300514-50300536 GCTTTCTGTGTACCAGACCTGGG - Intergenic
1151354122 17:73548516-73548538 GGTTTCTGTGTCCCACAAATGGG - Intronic
1152528286 17:80902178-80902200 GCTCTCTGCAGACCACAACTGGG + Intronic
1153776483 18:8458684-8458706 CCTGTCTGTGGACCACACTTTGG + Intergenic
1157084423 18:44564451-44564473 GCTCTCTGTGTGCTTCAATCTGG + Intergenic
1158237288 18:55331267-55331289 GCTCTCTGTGATCCAGAATCAGG + Intronic
1159774227 18:72585269-72585291 GCTCTTTTAGTCCCACAATTTGG + Intronic
928637939 2:33266856-33266878 GCTCTTTCAGTACCACCATTTGG - Intronic
928669986 2:33593076-33593098 TCTCTCTGTGAACCACAAAGTGG + Intronic
931163102 2:59716030-59716052 GTTGTCTGTGAACCACATTTTGG + Intergenic
932462112 2:71889187-71889209 GGCCTCTGTTTACCACACTTGGG - Intergenic
933918811 2:87023779-87023801 GATCTCTGTGTACTACGATCAGG + Intergenic
934004183 2:87746137-87746159 GATCTCTGTGTACTACGATCAGG - Intergenic
935767138 2:106380149-106380171 GATCTCTGTGTACTACGATCAGG - Intergenic
937609237 2:123840355-123840377 GCTCTCTTTGTTCCACACTGAGG + Intergenic
946436441 2:219659356-219659378 ACTCTCAATGTCCCACAATTTGG - Intergenic
1173293846 20:41738320-41738342 GCACTGGGTGTACCACAATGAGG - Intergenic
1174625085 20:51907416-51907438 GCTCTGTGTGTACCACATTTTGG - Intergenic
1176049287 20:63108074-63108096 GCCCTCTGGGTCCCACCATTGGG - Intergenic
1178937483 21:36875759-36875781 GCTCTCTTAGTTCCACCATTGGG - Intronic
1183428381 22:37751550-37751572 GCTCTCTGAGTGCCACTATCAGG + Intronic
1184432778 22:44451218-44451240 GCTCTGTGTGCACCACAGTCCGG + Intergenic
949918256 3:8981674-8981696 CCTCTTTGTGTACCACAAACCGG + Exonic
950474940 3:13209233-13209255 TCTCTCTTTGTACCTGAATTGGG - Intergenic
950714441 3:14837694-14837716 GCTCACGGTGTTCCACAGTTGGG + Intronic
950882358 3:16333230-16333252 GCACTATGTGTACCACAAAAAGG + Intronic
952272072 3:31843077-31843099 GCTGTCTGTGTACCAATAGTTGG - Intronic
953103885 3:39856401-39856423 TCTGGCTGTGTTCCACAATTGGG - Intronic
964689197 3:159431032-159431054 GCTCACTGTGTACCTCAAACTGG - Intronic
965020631 3:163225662-163225684 GCACTCTGCTTACCACCATTGGG - Intergenic
966183812 3:177210591-177210613 GCTTTCTGTGGAACACAGTTTGG + Intergenic
970418791 4:15885007-15885029 CCTCTCTGGGTACCACCCTTTGG - Intergenic
973029120 4:45312817-45312839 ACTCTCAGTGCACCACAGTTGGG - Intergenic
974179236 4:58362572-58362594 CCCCTCTGTGGAACACAATTTGG + Intergenic
974603709 4:64122398-64122420 CTTCTCTGTGTACCACAAGCAGG + Intergenic
978048405 4:104164066-104164088 GTTCTCTGTGTATCTCAATTAGG + Intergenic
979600757 4:122584364-122584386 TCTCTCTGTGTAAAATAATTAGG + Intergenic
979687738 4:123529026-123529048 GCTCTTGGTGCACAACAATTTGG - Intergenic
980257604 4:130402566-130402588 GCTCTCTGTGCACCACAGGCAGG + Intergenic
981902596 4:149884310-149884332 GTTCTCTGTGTACCACTTATAGG - Intergenic
982688045 4:158515406-158515428 GCTGTCTGTGGACCATGATTTGG - Intronic
986772103 5:10983748-10983770 GCTGTCTTTGTAACACAAGTTGG + Intronic
992794049 5:80239624-80239646 GCTCATAGGGTACCACAATTTGG - Intronic
993217810 5:85048366-85048388 GCTCTCTCTGTTCCACAAGTAGG + Intergenic
1004560848 6:16748804-16748826 GCTCTCTGTGTAGCCCAAAAGGG - Intronic
1007601344 6:43083582-43083604 GCTGTCTGTGTAACATTATTGGG - Intronic
1008688104 6:53946239-53946261 ACTCTCTGTGAACCACATTCAGG - Intronic
1011857831 6:91716926-91716948 ACTATCTGTGAACCACATTTTGG - Intergenic
1014108110 6:117590198-117590220 ACTCACTGTGTACCACAATCTGG + Intronic
1015962482 6:138664439-138664461 GCTCTGTGTGTACCTCTCTTAGG - Intronic
1018014517 6:159699888-159699910 GTTCTCAGTGGACCACAATCTGG - Intronic
1024457274 7:49623654-49623676 ACTATCTGTGGACCAGAATTAGG + Intergenic
1027698523 7:81439310-81439332 GTTCTCTTTGTACCCCAAATAGG - Intergenic
1036579856 8:10063709-10063731 GCTGTCCGTGAACCAGAATTTGG + Intronic
1037110468 8:15159228-15159250 GCTCTCCGTGGACCACCCTTCGG - Intronic
1038516299 8:28190456-28190478 GCTCTCTGGGGACCACACTTGGG - Exonic
1039922235 8:41901555-41901577 GCTCTCTGGGGACCACAGTGGGG - Intergenic
1042672604 8:71281321-71281343 GCTCCCTCTGTCCCACCATTCGG + Intronic
1042716324 8:71777011-71777033 CTTCTCTGTGTTCCAAAATTAGG - Intergenic
1043758989 8:84041569-84041591 GCTCTCTGACTAACACAATAGGG - Intergenic
1044814713 8:96099795-96099817 GCTCCCTGTGTACCGTGATTTGG - Intergenic
1050252311 9:3757834-3757856 GCTTTTTCTGTACCACAATGAGG + Intergenic
1051713698 9:19959259-19959281 TCTCTCTGCATGCCACAATTGGG - Intergenic
1057138525 9:92712506-92712528 TTTCTAAGTGTACCACAATTTGG + Exonic
1187697535 X:21937101-21937123 GCTCACTGTGTAGGACAATGTGG + Intergenic
1190781774 X:53603367-53603389 TCTCTCTGTGTACCCCAAACAGG - Exonic
1194896891 X:99453586-99453608 GTTTTCTGTGTAGCACAATTTGG + Intergenic
1195090275 X:101451691-101451713 GCTCTCTGGGAAGCACATTTTGG - Intronic
1195270807 X:103228826-103228848 GCTCTCTGTTTGCCATGATTAGG + Intergenic
1197648809 X:129043226-129043248 GCTCTCTCTGTTCCACCATCCGG + Intergenic
1197658643 X:129145826-129145848 GCACTCTGCCTGCCACAATTAGG + Intergenic
1199864661 X:151831932-151831954 GCACTCTCTGGACCACACTTAGG + Intergenic