ID: 1126805342

View in Genome Browser
Species Human (GRCh38)
Location 15:52342611-52342633
Sequence AGGTTTTTAAAGAAGGTGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 417
Summary {0: 1, 1: 0, 2: 3, 3: 41, 4: 372}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126805338_1126805342 16 Left 1126805338 15:52342572-52342594 CCACCATTCAATTTTAGCTTTAA 0: 1
1: 0
2: 2
3: 21
4: 301
Right 1126805342 15:52342611-52342633 AGGTTTTTAAAGAAGGTGTTTGG 0: 1
1: 0
2: 3
3: 41
4: 372
1126805339_1126805342 13 Left 1126805339 15:52342575-52342597 CCATTCAATTTTAGCTTTAATAG 0: 1
1: 0
2: 3
3: 29
4: 366
Right 1126805342 15:52342611-52342633 AGGTTTTTAAAGAAGGTGTTTGG 0: 1
1: 0
2: 3
3: 41
4: 372

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126805342 Original CRISPR AGGTTTTTAAAGAAGGTGTT TGG Intronic
903635228 1:24809163-24809185 AGGTTCTTACAGAAGTTGATAGG + Intronic
905946934 1:41910010-41910032 AGCTTTTTAAGGTAAGTGTTTGG - Intronic
907328319 1:53655199-53655221 AGGTTTTTAAGTAAGGTGTCAGG - Intronic
907676061 1:56518991-56519013 AGGCTTCTAAAGAAGGTGGGTGG + Intronic
908947290 1:69514465-69514487 TGGTTTTTAAAGATGGTGTTTGG - Intergenic
909875943 1:80803266-80803288 GGGATTTTTAAAAAGGTGTTTGG + Intergenic
910421290 1:87066539-87066561 AATTTTTTAAAAAAGTTGTTGGG - Intronic
910456688 1:87405234-87405256 AGTTTATTAAAGAATGTGTTTGG + Intergenic
910704714 1:90116548-90116570 ATGTTTTTAATGAATGTTTTTGG + Intergenic
910880096 1:91915427-91915449 AGTTTTTTTGAGATGGTGTTTGG - Intergenic
911035413 1:93539938-93539960 ATGTTTTAAGAGAAGGTGTTGGG - Intronic
911554550 1:99327650-99327672 AGGTTTTTAGAGATGATGTTTGG - Intergenic
911558259 1:99372296-99372318 ACATTTTTAAAGACTGTGTTTGG - Intergenic
912142387 1:106747394-106747416 AGGTTTTTGAAGAATGCTTTTGG + Intergenic
912880341 1:113406114-113406136 ATTTTTTTAAAGATGGGGTTTGG - Intronic
913180884 1:116320131-116320153 ATGTTTTTTAAAAAGGTTTTTGG + Intergenic
913474583 1:119224916-119224938 AGGTTTTTAGAGAAAATTTTTGG - Intergenic
914812131 1:151036690-151036712 AGGTGTTTAAAGAAGGAGGCAGG + Exonic
914928841 1:151911500-151911522 AGGTCTTTTAAGAAGCTGATAGG - Intergenic
915057386 1:153147020-153147042 TGGTTTTCAATGAAGGTGTCAGG + Intergenic
915701962 1:157804742-157804764 AGGTTTGTAAAGAAGCTGTGTGG - Intronic
915996816 1:160572042-160572064 ATGTTATTAAAGACGGTGATAGG + Intronic
918016850 1:180643116-180643138 AGGATTTTAAAGAAGAGATTGGG + Intronic
918457483 1:184737902-184737924 AGTTTTTTAAAGAAATTTTTTGG - Intronic
918979268 1:191533866-191533888 ATGTTTTTAAAGAAGCTCATTGG + Intergenic
919287166 1:195578698-195578720 AGATATTTAATGTAGGTGTTTGG - Intergenic
920606064 1:207387336-207387358 AGTTTTTTAGTGAAGGTTTTAGG - Intergenic
920875348 1:209829307-209829329 GTGTTTTTAAAGAATTTGTTGGG + Intronic
921267952 1:213441211-213441233 ATGTTTTTAAACTGGGTGTTAGG - Intergenic
922970107 1:229729036-229729058 GGGTTGTTAAAGAAGGGGTTTGG - Intergenic
923277343 1:232408773-232408795 AGATTTCTAAAGAATGTGATAGG - Intronic
1063533215 10:6856470-6856492 ATATTTTTAAAAAAGGTGGTGGG + Intergenic
1064866298 10:19884306-19884328 ATATTTTTAAAGAAGTTCTTGGG - Intronic
1065031488 10:21590795-21590817 ACCTTTTTAAAGAAAGTTTTGGG + Intronic
1065069947 10:22013278-22013300 AAGATTTTAAACAAGTTGTTGGG - Intergenic
1065249805 10:23799203-23799225 GGGTCTTTACAGAAGTTGTTAGG - Intronic
1065593058 10:27285184-27285206 AGGTTTTTCAAGATGATGATGGG - Intergenic
1065657314 10:27965096-27965118 AGGTTTTTCAAGATGATGATGGG + Intronic
1067498130 10:46776841-46776863 TGTTTTTTAAAAAATGTGTTGGG + Intergenic
1067596515 10:47563574-47563596 TGTTTTTTAAAAAATGTGTTGGG - Intergenic
1068702986 10:60039703-60039725 ATTTTTTTAAAAAAGGGGTTGGG + Intronic
1069871247 10:71534514-71534536 AGGTATTTCAAGAAAGTGTAGGG - Intronic
1070486104 10:76933170-76933192 AGGTTTTTAATACAGGTATTTGG + Intronic
1072493981 10:95936237-95936259 AGCTGTTTAGAGAAGTTGTTTGG + Intronic
1072509576 10:96106226-96106248 AGCTATTTACAGAAGATGTTTGG - Intergenic
1073089476 10:100922510-100922532 AGGTTTTTAAAGCAACTCTTGGG + Intronic
1074027239 10:109649381-109649403 AAGTTTTTCAAGAAAATGTTGGG + Intergenic
1074264938 10:111892359-111892381 AGGTTTTTAAAAATAGTTTTAGG - Intergenic
1074652263 10:115536912-115536934 AGTTTTTTAAACAATGTGTAAGG + Intronic
1074685775 10:115961189-115961211 AGGCTTTTAAAGAAGCTCTTTGG + Intergenic
1076128215 10:127992678-127992700 AGGTTTCTAGAGCAGGTGTCTGG - Intronic
1076178608 10:128387840-128387862 AGGGTTTTACAGAAGGTCTTTGG - Intergenic
1076564447 10:131388610-131388632 AGGTTTTTCTAGAAGCTGTGGGG + Intergenic
1076712165 10:132343474-132343496 AGCTTTTTAAAGAAGGAGTTTGG + Intronic
1077532714 11:3104674-3104696 AGGTTTCAACAGCAGGTGTTGGG - Intronic
1078226792 11:9399460-9399482 AGCATTTTAAAGAAGGATTTTGG + Intronic
1078409655 11:11103676-11103698 GGCTTTCTAAAGAAGGAGTTTGG + Intergenic
1079642856 11:22829249-22829271 ATCTTTTAAAAGAAGGTGCTCGG - Intronic
1080111285 11:28570778-28570800 AGGTTTTTAGATAAAGTGTGTGG - Intergenic
1081700635 11:45150434-45150456 AGGATTCAACAGAAGGTGTTTGG - Intronic
1085062931 11:73464659-73464681 AGTGTTTTGAAGAAAGTGTTGGG - Intronic
1085146263 11:74200689-74200711 TGTGTTTAAAAGAAGGTGTTAGG + Intronic
1085355881 11:75836465-75836487 AGGTTTTGAAACAGGGTGTCTGG - Intronic
1085923738 11:80990052-80990074 GGGTTTTTAAGGAAAGGGTTTGG - Intergenic
1086520124 11:87659795-87659817 AGCTTTTTATACAAGGTGGTCGG + Intergenic
1086670237 11:89537925-89537947 AGGTTATCAAAGTAGGTGGTTGG - Intergenic
1086853795 11:91842518-91842540 TGGTTTTTAAAGAAACTTTTTGG - Intergenic
1086968821 11:93058359-93058381 AGGGTTTTAAAGAAAAAGTTGGG + Intergenic
1087036057 11:93757836-93757858 AGGATTGTAAAGTATGTGTTGGG + Intronic
1087211744 11:95452040-95452062 AGGATTATAAGGAAGGTTTTGGG - Intergenic
1087767305 11:102169600-102169622 AAGTTTTTAAAAAAGGTATTTGG - Intronic
1088295380 11:108287757-108287779 AAGTTTTTAAAGAAGTTTATTGG + Intronic
1090054056 11:123406558-123406580 TGTTTTTTAAAGAAATTGTTAGG + Intergenic
1090299851 11:125626042-125626064 AGGTTTCTAAAGAAGGAGTTCGG + Intronic
1090319061 11:125825734-125825756 AGGTTGATAAAGGAGGTGGTTGG - Intergenic
1093750231 12:22790144-22790166 ATTTTTTTAAAGAAGGTTTGTGG + Intergenic
1093955022 12:25207050-25207072 AGTTTTGCAAAGAAGGGGTTTGG - Intronic
1095162307 12:38932860-38932882 AGGTTTTGGAAGAAGGCGTAGGG + Intergenic
1095919471 12:47514945-47514967 AGCCTTTGAAAGAAGGTGTTGGG + Intergenic
1096277897 12:50226335-50226357 AGGTATTTAAAGAAGAGGGTGGG - Intronic
1096912958 12:55002434-55002456 AGGTCTTAAAATAAGTTGTTTGG - Intergenic
1096999681 12:55866065-55866087 AGCTTTTTGAAAAAGGAGTTTGG + Intergenic
1097598682 12:61665869-61665891 AAATTTTTTAAGAAGGAGTTTGG + Intergenic
1097647836 12:62258521-62258543 AGCTATTGAAAAAAGGTGTTAGG - Intronic
1097815040 12:64064395-64064417 AGGTTTTGATAGAAGATATTTGG - Intronic
1098219991 12:68259256-68259278 AGGGTATAAAAGAAGGTCTTTGG - Intergenic
1099144455 12:79022388-79022410 ACGTTTTTAAAGAAGATTCTAGG + Intronic
1099222212 12:79928462-79928484 AGGTTTTTAAAAATGGATTTAGG + Intronic
1099938475 12:89156767-89156789 ATATTTTAAAAGAATGTGTTTGG + Intergenic
1100042815 12:90341523-90341545 AGTTTCTTTAAGAAGGTGTTTGG + Intergenic
1102845066 12:116171821-116171843 AGGTTTTTAAAAAAATTGGTTGG - Intronic
1102969674 12:117156080-117156102 AGGTGTTTATAAAAGGGGTTAGG - Intronic
1103313389 12:120031085-120031107 AGATTTTTTAATAAAGTGTTGGG - Intronic
1104179744 12:126367592-126367614 ATGTTTTTAAGTAAGTTGTTGGG + Intergenic
1105520927 13:21130243-21130265 AGGTTTTTAATCAAGGGATTAGG + Intergenic
1105629744 13:22150489-22150511 AGATTTTCAAAGAAGGTAGTTGG - Intergenic
1105720268 13:23106840-23106862 AGTTTTTTAAAAAAGGAGTTTGG - Intergenic
1107010852 13:35669529-35669551 CTGTTTTTAAAGAAGGTTTAAGG + Intronic
1108173998 13:47773539-47773561 AGACTTTTAGGGAAGGTGTTGGG + Intergenic
1108221237 13:48234853-48234875 TGGTCTTTAAAGAAAATGTTTGG + Intronic
1108703800 13:52966822-52966844 AGATTTCTAAAGAAGGAATTTGG - Intergenic
1109215811 13:59588640-59588662 AGGTTTTTAAAGTAGCTGGAAGG - Intergenic
1109649637 13:65309534-65309556 AGCATTTTAAAGATGGTTTTAGG + Intergenic
1111867238 13:93784461-93784483 ATGTTTTTGAGGAAGGGGTTTGG - Intronic
1112008665 13:95276011-95276033 AGCTTTTTGAAGAATGTTTTAGG - Intronic
1115207019 14:30918835-30918857 TGATCTTTAGAGAAGGTGTTGGG - Intronic
1115484169 14:33893666-33893688 AGTTTTTTGATGAAGTTGTTAGG - Intergenic
1115648531 14:35386485-35386507 TGTTTTTTAAAGAAGGTGGGGGG + Intergenic
1116640857 14:47460906-47460928 AGGTTTATAATTAATGTGTTTGG - Intronic
1120155730 14:81090925-81090947 AGATATTTAGGGAAGGTGTTGGG + Intronic
1120878261 14:89394155-89394177 AGGGTCTAATAGAAGGTGTTTGG - Intronic
1120905511 14:89617847-89617869 CGATTTTAAAAGAAGGTTTTGGG + Intronic
1121277090 14:92675948-92675970 ACGTTTTAAAAGAAGGCCTTAGG + Intronic
1123887591 15:24742186-24742208 GGGGTTTTAAAGAAAGGGTTTGG - Intergenic
1124611307 15:31211130-31211152 ATGTTTTTAAAAAGGGTGTATGG + Intergenic
1125302437 15:38270236-38270258 TAGTTTTCAAAAAAGGTGTTGGG - Intronic
1126713757 15:51490761-51490783 AAGTTTTTAAGGCAGGTTTTTGG - Intronic
1126805342 15:52342611-52342633 AGGTTTTTAAAGAAGGTGTTTGG + Intronic
1127690566 15:61391965-61391987 ATGTTTTTAAAAAAGGTCTTTGG + Intergenic
1128121061 15:65146887-65146909 AAGTTTTTACAGAAGGTAGTGGG - Intergenic
1128422426 15:67506310-67506332 AGGTATTTTAAGAGGGTGCTAGG + Intergenic
1128986670 15:72227039-72227061 ACTTTGTTAAAGAAGCTGTTGGG - Intronic
1129645130 15:77422329-77422351 AGTTTTTTTAAAAAGCTGTTTGG + Intronic
1133547769 16:6824737-6824759 AAGTTTTTAAAGAAAGCTTTTGG - Intronic
1133850792 16:9501412-9501434 ATGTTTTGAAAGCAGGTGATTGG + Intergenic
1134010203 16:10846353-10846375 ATGTCTTCACAGAAGGTGTTAGG - Intergenic
1135252376 16:20911900-20911922 AAGTTTTTAAATAAGTTGTTGGG + Intronic
1136505517 16:30700414-30700436 TGGTTTTTAAGGTAGGTGTGAGG + Intronic
1136912309 16:34154316-34154338 AGGTTTTCAAGCAGGGTGTTGGG - Intergenic
1137450069 16:48564336-48564358 ACATTTTAAAAGAAGGTGTGAGG + Intronic
1138953949 16:61948609-61948631 GTATTTGTAAAGAAGGTGTTGGG - Intronic
1139689312 16:68629760-68629782 ATGTTTGTAGAAAAGGTGTTGGG + Intergenic
1140052841 16:71498075-71498097 TGTTTTCTAAAGATGGTGTTTGG + Intronic
1140972936 16:80030706-80030728 AGCTTTTTAAAAAGGATGTTAGG + Intergenic
1141511346 16:84514260-84514282 AGGGTTTTAAAGTAGGTGAGAGG - Intronic
1142425689 16:90001143-90001165 AGGGTTCTAAAGCAGCTGTTTGG + Intergenic
1144285146 17:13766957-13766979 AGCTTTGTAAAGAAGGTGGTTGG + Intergenic
1146151842 17:30479814-30479836 AGTTTTTTAAAGGCGGTTTTTGG + Intronic
1146459544 17:33034523-33034545 AGGTTTTTTAAGTTGGTTTTGGG - Intronic
1148016062 17:44523428-44523450 AGGGGTTTAAAGAAGCCGTTGGG + Intergenic
1151091108 17:71440999-71441021 AGCTTTTCAAAGTAGGTGTTCGG - Intergenic
1151132576 17:71912876-71912898 AGGTTTTTCTAGGAGCTGTTAGG - Intergenic
1151304014 17:73251323-73251345 AGGCTTTGAAAGAAGGTGGGAGG - Intronic
1151353671 17:73546065-73546087 AGGCTTTTCAGGAAAGTGTTGGG + Intronic
1151744230 17:76002998-76003020 ATTTTTTAAAAAAAGGTGTTTGG + Intronic
1152917709 17:83050744-83050766 AGGTTTTTAGGGCACGTGTTTGG + Intronic
1153582859 18:6592798-6592820 TGGTTTAAAAAGCAGGTGTTGGG + Intergenic
1153696718 18:7650838-7650860 TGGTTTTTGTAGAAGGTGTAAGG - Intronic
1155084048 18:22439079-22439101 AGCTTTTTAAAGAAAATGTAAGG - Intergenic
1155505037 18:26525114-26525136 AGATTTTTAAAGTTGCTGTTTGG - Intronic
1156180014 18:34592215-34592237 AGGCTTTTGAAGAAGTTGTGTGG + Intronic
1156728607 18:40161616-40161638 AGTTTGTTAAAGAAGGCATTCGG + Intergenic
1157952350 18:52053751-52053773 GGGCTTTTAATGAAGGGGTTGGG - Intergenic
1160348180 18:78151931-78151953 AGGTTTCCAAAGAAGGGATTCGG + Intergenic
1161787966 19:6339971-6339993 AGGTTTTTAAAAGAGGGGTTTGG + Intergenic
1162258694 19:9514701-9514723 CTGTTTTAAAAGAAGGGGTTGGG + Intergenic
1162684264 19:12368661-12368683 GGGTTTTTAAAGAAAGGGTTTGG - Intergenic
1164546682 19:29171231-29171253 AGGGTTTTAAAAAATGTATTTGG + Intergenic
1166096211 19:40541146-40541168 AGGTTTTAGAGGAAGGAGTTGGG + Intronic
1166418656 19:42615802-42615824 AGGTTTTACAAGAAGGAATTTGG - Intronic
1167211053 19:48134347-48134369 AGTTTTTAAAAAAAGGTTTTTGG + Intronic
1168540161 19:57203275-57203297 AGTTTGTTAAAGAAGTGGTTGGG + Intronic
924994621 2:347492-347514 AGTTTTTTAAAGAACATCTTAGG - Intergenic
925534161 2:4899041-4899063 ATGTTTTAAAAGAAGGTGCATGG + Intergenic
927624771 2:24703588-24703610 AGGTGTGTAAAGAATGTGGTTGG + Intronic
928160908 2:28923675-28923697 AGGTTTTAAAATCAAGTGTTTGG - Intronic
928632659 2:33209774-33209796 AGGTTTTTAAAGGAGGAGCCTGG + Intronic
928704126 2:33929420-33929442 AAGTTTTAAAAGAAGGTGGAAGG - Intergenic
929365874 2:41156104-41156126 AGCTTTTTAAAGTAGGTTTTAGG + Intergenic
929490919 2:42395398-42395420 AGGCTGTTTAAGAAGGAGTTGGG + Intronic
929869160 2:45743691-45743713 AGGTTTTGAAAGAAGCAGTCGGG - Intronic
930502939 2:52245767-52245789 AGATCTTTAAAGAACTTGTTAGG - Intergenic
930820314 2:55639873-55639895 TGCTTTTTAAAAAAGGTGGTAGG - Intronic
931692538 2:64847495-64847517 TGATTTTTAAAAAAGGAGTTGGG - Intergenic
932313790 2:70766903-70766925 AGTTTTTTAAAGAATTTGATAGG + Intronic
932718174 2:74118080-74118102 AGGTGTTTAAAGCAGGTACTTGG - Intergenic
934468996 2:94497994-94498016 TGGTTTTTGAATAAGGTGTAAGG - Intergenic
934730122 2:96651051-96651073 GGGCTTTTGAAGAAGGTGCTTGG - Intergenic
934764463 2:96872875-96872897 AGATTTTTAAATCAGGTCTTGGG + Intergenic
934971043 2:98764748-98764770 CGCTTTTTAAAGAATGTGATGGG + Intergenic
935404303 2:102692312-102692334 ATTTTTTTAAAGGAGGTGATTGG - Intronic
935936152 2:108185239-108185261 AGGTATTAAGAGAAGGGGTTAGG - Intergenic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
937652235 2:124333461-124333483 AGTTTTTCCAAGAAGGTGTTTGG + Intronic
938575040 2:132595828-132595850 AGGTTTCTAATGAAAGTGCTAGG + Intronic
938612425 2:132961696-132961718 AGGTCTTTAAAAAATGTATTTGG - Intronic
938751937 2:134340617-134340639 AGGTTTGTAAAGAAGGAGCCTGG - Intronic
938964215 2:136373724-136373746 AGGGGTTTTAAGAAGGTGATAGG - Intergenic
939065686 2:137480966-137480988 AGGTCTTTATAAAAGGTGTTGGG + Intronic
939166388 2:138645514-138645536 AGGATTTTAAATAAAGTGATAGG + Intergenic
939167110 2:138651947-138651969 AAGGTTTTAAATAAGGGGTTGGG + Intergenic
939385934 2:141498335-141498357 AGGATTTTAAAGATGTTGTCTGG - Intronic
940532271 2:154893495-154893517 AACTTTGTAAAGAAGGTTTTGGG - Intergenic
941764236 2:169278950-169278972 AGATTTTTAAAGATGGAGGTTGG - Intronic
943884742 2:193201933-193201955 AATTTTTTAAAGAAGCTGTGAGG + Intergenic
944025774 2:195165607-195165629 AGCTTATTAAAGAATGTTTTTGG + Intergenic
944592546 2:201231057-201231079 GATTTTTTAAAAAAGGTGTTAGG + Intergenic
944912001 2:204319726-204319748 AGCATTTAAAAGAAGGTGCTTGG - Intergenic
944935929 2:204568125-204568147 AGATTTTCAAAAAAGGTATTGGG + Intronic
945692822 2:213062872-213062894 AGCTGTTTAAATAATGTGTTAGG + Intronic
945842487 2:214904773-214904795 GGGTTTTTAAAGAAAGGGTTTGG + Intergenic
947679671 2:232018950-232018972 AGGTTGTTATAGGAGATGTTGGG + Intronic
947855104 2:233318679-233318701 CAGTTTTTAAAGTAGGTGTCTGG + Intronic
1168730603 20:76405-76427 ATCTTTTTAAAAAAGGTTTTAGG + Intergenic
1169838968 20:9912861-9912883 ATGTTTTTCTAGAAGATGTTAGG + Intergenic
1171355207 20:24539262-24539284 TGGTTTTTGAATATGGTGTTAGG + Intronic
1172789985 20:37496421-37496443 AGGTACTTAAAGACTGTGTTAGG - Intronic
1173087942 20:39942377-39942399 AGGTTTAGAAAGCAGGAGTTAGG - Intergenic
1173322846 20:42004645-42004667 AGGTTTTTAGAGAATGGGATGGG + Intergenic
1175757695 20:61539891-61539913 AGGATTTGAAAGAGAGTGTTTGG + Intronic
1179014639 21:37585360-37585382 AGTATTTTAAAAAAGATGTTTGG + Intergenic
1180718925 22:17892313-17892335 GGATTTTTAAAGAGGCTGTTCGG - Intronic
1184363298 22:44031591-44031613 AGGTTTGTAACCAAGGTGCTAGG - Intronic
1185018296 22:48358441-48358463 AGGGTTTTCAAGTAGGAGTTTGG - Intergenic
949133081 3:529698-529720 AGATTTTTAAAGAAAGATTTTGG + Intergenic
949720045 3:6978332-6978354 AAGTTTATAATCAAGGTGTTGGG - Intronic
949857859 3:8478336-8478358 AGAATTTTAAAGAAGCTATTAGG + Intergenic
950134092 3:10568349-10568371 AGGTTTTCAAAGCAGCTTTTAGG + Intronic
950177076 3:10882356-10882378 AAGATTTTAAATAAGGTGGTTGG - Intronic
951282699 3:20772197-20772219 AGGTTTTTGGAAAAGGTATTAGG - Intergenic
951636568 3:24785008-24785030 AATTTTTTAAAGAAGGTCTTGGG + Intergenic
951842247 3:27046968-27046990 AGGTTTTTAAAGAGAGGGTTTGG - Intergenic
952462358 3:33541314-33541336 AGTTTTTTTAAGAAGGAGTTGGG - Intronic
952548187 3:34445845-34445867 AAGTTGCTAAAGAAGGTTTTGGG + Intergenic
953241872 3:41156740-41156762 TGGTTTTTAGAGAATATGTTAGG + Intergenic
955242897 3:57195208-57195230 AGATTTTTAAAAAAGATTTTAGG + Intergenic
955246819 3:57232519-57232541 AGGTGTCAAAAGAAGGTTTTCGG - Intronic
955248856 3:57257068-57257090 AGTTATTTAAAGAAGGAGATGGG + Intronic
955278361 3:57569654-57569676 TAGTTTTTAAAGAAAGTATTAGG - Intergenic
955298820 3:57757442-57757464 AGCGTTTTAAAGGAGGTGATGGG + Exonic
955753763 3:62207674-62207696 AGGGATTTAAACAAGCTGTTTGG - Intronic
956626921 3:71275662-71275684 AGGCCTTTAAAAAAGGTGGTGGG - Intronic
956872789 3:73434887-73434909 AAGTTTTTAGAAAAGGTGTCAGG - Intronic
957258490 3:77869903-77869925 AGGTATTTAATGCAGGTGTATGG + Intergenic
958690117 3:97454696-97454718 AGGTTTTTAAAAAAGAGTTTAGG - Intronic
960201505 3:114842406-114842428 AAGTTTTTAAAGAAGGGGTAAGG - Intronic
960251108 3:115454573-115454595 AGGTTTTGAAAGAGAGTGTCTGG + Intergenic
961235044 3:125358984-125359006 AGTATCTTAAAGAAGGTGATGGG - Intronic
961855343 3:129864888-129864910 ATGGTTTTAAAGAATATGTTTGG + Intronic
962109926 3:132433900-132433922 AGGTTTTTAAAGACGGGGACTGG - Intronic
962279783 3:134041124-134041146 AGTTTTCTCAAGAAGGAGTTTGG - Intronic
963483957 3:145912561-145912583 AGATTTTTAAAAAATGTGTTTGG - Intergenic
964489399 3:157219047-157219069 ATGTTCATAAAGAAGGTGATGGG - Intergenic
964540750 3:157776674-157776696 AAGTTTTTAAAAAATGTGTGTGG + Intergenic
967312432 3:188118606-188118628 AGGATTATAAAGTAGGTGCTTGG - Intergenic
967800470 3:193652910-193652932 AGGATTTTAAAAAGGGTGTCAGG + Intronic
969390045 4:6885952-6885974 AGGACTTTAAAAATGGTGTTGGG - Intergenic
969555649 4:7907447-7907469 CGGTTGTCAAAGAAGGGGTTGGG - Intronic
970264805 4:14270148-14270170 ATGTATTTAAAACAGGTGTTAGG + Intergenic
970274485 4:14383376-14383398 AGGTTTGTAAAGCAGGAGTCGGG - Intergenic
970774885 4:19661889-19661911 ATGCTTTTAAAGAAGGGGCTGGG + Intergenic
971081786 4:23221139-23221161 TTGATCTTAAAGAAGGTGTTAGG - Intergenic
972264549 4:37446546-37446568 AGATTTTTCAAGAAGTTGTTTGG - Exonic
973088380 4:46098787-46098809 AGGTTTTTATAGCTGATGTTTGG - Intronic
973166201 4:47080417-47080439 CAGTTTTTAATGTAGGTGTTAGG + Intronic
974964500 4:68744648-68744670 CTGTTTTAAAAGAAGGTGTCAGG + Intergenic
975126173 4:70784595-70784617 AGGATTTTAAATAAAGTGTCAGG + Intronic
975217573 4:71773590-71773612 AGTTTATTAAAGTAGGTATTTGG + Intronic
975468852 4:74740832-74740854 GGGCTTTTAAGGAAGGAGTTGGG + Intergenic
976371811 4:84298649-84298671 AGTTTTTTAAAGAAGTCTTTAGG - Intergenic
976670931 4:87652965-87652987 AACTTTTTAAAAAATGTGTTAGG - Intronic
976714935 4:88113642-88113664 AGCTTTAGAATGAAGGTGTTAGG - Intronic
976865313 4:89718402-89718424 ATGTTTTTAAAAGAGTTGTTTGG + Intergenic
977159989 4:93622015-93622037 AGGTTTGTAAAGAAGCTGCCAGG + Intronic
977725959 4:100297241-100297263 AGGTTTTTAGGAAAGGTGTCAGG - Intergenic
977997826 4:103516017-103516039 ATGTTTCTAAACAATGTGTTTGG + Intergenic
978065182 4:104389839-104389861 AGGTTTTTAGAGAAAGGATTGGG + Intergenic
978338082 4:107691069-107691091 TGGTTTTTACAGAATGTTTTAGG + Intronic
979574441 4:122271333-122271355 TGGTTTTGAAGGTAGGTGTTGGG - Exonic
979815302 4:125094791-125094813 ATGTTCTTAAAGAGGGTTTTTGG - Intergenic
979918670 4:126472217-126472239 AACTTTTTAACGAAGGAGTTTGG + Intergenic
980096442 4:128496073-128496095 ATGTTTTTGAAGAAGGTAGTAGG + Intergenic
980480510 4:133380947-133380969 AGGTTTTTTAAGAAGCTTGTTGG - Intergenic
980504401 4:133696244-133696266 CAGTTTTTAATGAGGGTGTTCGG - Intergenic
981744856 4:148042873-148042895 AGGTTTTGTAAGAATATGTTGGG + Intronic
981885582 4:149668723-149668745 AGGACTTCAAAGAAAGTGTTTGG + Intergenic
982595034 4:157371476-157371498 ACCTTTTTAAAAAAGGTTTTAGG - Intergenic
984769664 4:183426447-183426469 AAGTTTTTAAAGAAAGAATTTGG - Intergenic
984974593 4:185219256-185219278 ATGTTTTTAAAAAATGTTTTTGG + Intronic
985197998 4:187452563-187452585 AGATGATTAGAGAAGGTGTTTGG - Intergenic
986649290 5:9947877-9947899 AGGTTTTTCACGAAGTTGCTTGG - Intergenic
987038593 5:14041099-14041121 GGGTTTTGAATGCAGGTGTTTGG - Intergenic
987969089 5:24918932-24918954 AGCTTTTTTAAAAAAGTGTTAGG - Intergenic
988818202 5:34854985-34855007 AGGGTTGTAAAGAAGGAGTAGGG + Intronic
988970331 5:36460574-36460596 AGATTTTTAAACAGGGTTTTGGG + Intergenic
990031658 5:51267842-51267864 AGGATTTTAGAGAAGCTATTTGG - Intergenic
991026214 5:62032837-62032859 AGATTTTTATATAAGGTGTAAGG + Intergenic
991163399 5:63532403-63532425 AGGTTTTAAAAGCAGGTTATAGG - Intergenic
992217943 5:74543936-74543958 AGCTTTCTAAAGAAGGGATTTGG + Intergenic
992843172 5:80716558-80716580 AGTTTCTCAAAAAAGGTGTTAGG - Intronic
992895629 5:81242737-81242759 GGGTTTTTAAAGCAGGAGTGAGG + Intronic
993895963 5:93534769-93534791 AGGTTTTTAAATCAGATTTTTGG - Intergenic
995448576 5:112274560-112274582 ACTTTTTTAAAGGAGGTATTAGG + Intronic
995553927 5:113308475-113308497 AGGTTTTTAGAGATGGGGATGGG - Intronic
995857915 5:116613301-116613323 AGGTTTTTAAAAATTTTGTTTGG - Intergenic
996203701 5:120704143-120704165 AGCTTTTTAAAAAAGGGGTATGG + Intergenic
996388111 5:122930282-122930304 AGTTTTTCAAAAAAGATGTTTGG + Intronic
996710653 5:126540006-126540028 AGGTTTTTAAAAAATTTCTTTGG - Intergenic
997453594 5:134002445-134002467 GGGATTCTACAGAAGGTGTTGGG - Intronic
997695434 5:135857462-135857484 TGGATATTAAAGAAGGTGATGGG - Intronic
997830278 5:137143931-137143953 AGCTTTTTAAAGAAGATAGTAGG - Intronic
998066613 5:139164435-139164457 AGGTTCTTGGAGAAGGTATTTGG - Intronic
999461699 5:151762350-151762372 AAGTTTTTAAAAAGGGTGATGGG + Intronic
999870236 5:155742151-155742173 AGGGTTTTAAGAAGGGTGTTAGG + Intergenic
1000645331 5:163754615-163754637 GGGTTTTTAAAGAAAGGGTTTGG - Intergenic
1003146502 6:3514642-3514664 AGGCTCTAAAAGAAGGAGTTAGG + Intergenic
1003621213 6:7702151-7702173 AAGTTTTAAAAAAAGATGTTGGG + Intergenic
1004463739 6:15863497-15863519 AAATTTTTAAAGAAGGTGATAGG + Intergenic
1005661785 6:28005545-28005567 GGGATTTTAAAGAAAGGGTTTGG - Intergenic
1006392744 6:33768383-33768405 TGGTTTCTAAAGAAAGTGATGGG - Intergenic
1007340016 6:41185470-41185492 AGGCTTTTAGGGAAGGTGTCTGG + Intergenic
1007469504 6:42079372-42079394 AAGTTTTTAAGGAAGATGCTGGG + Exonic
1007798418 6:44370246-44370268 CAGTTTGTAAGGAAGGTGTTTGG + Intronic
1008568997 6:52796839-52796861 AGCTTTTTAAAAATGTTGTTTGG - Intronic
1008754184 6:54773879-54773901 AGTTTTGCAAAGAAGGGGTTTGG + Intergenic
1008928819 6:56915935-56915957 AAATTCTCAAAGAAGGTGTTAGG - Intronic
1009516901 6:64631442-64631464 AGGATTTTCAGGAAGGTCTTGGG - Intronic
1009729792 6:67586055-67586077 AACTTTTTGAAGTAGGTGTTTGG + Intergenic
1010866384 6:80981126-80981148 ATGTTTTTGAAGAAAGTGTCAGG + Intergenic
1011001765 6:82597712-82597734 AGGTTTTTAAAAATGGAGTAGGG + Intergenic
1011593988 6:88998346-88998368 AGGGTTTTCAACAAGGAGTTTGG - Intergenic
1012181198 6:96155370-96155392 AGGTCTTTAAAGAAGTGATTAGG + Intronic
1012637693 6:101565334-101565356 ACCTTTGTAAAGAAAGTGTTTGG + Intronic
1012797959 6:103787611-103787633 AGGTTTTTAAAGTGTCTGTTGGG + Intergenic
1013645679 6:112137994-112138016 TGGTTTTTAAAAAATATGTTTGG + Intronic
1014404920 6:121039523-121039545 AAGTTTTTAAAGATGGTGTCTGG + Intergenic
1017055501 6:150432254-150432276 ATGTTTGTAAAGAAAGTGTGGGG + Intergenic
1018910613 6:168099237-168099259 AAGCTTTTAAAGTCGGTGTTGGG - Intergenic
1018962198 6:168456964-168456986 AGGGTTTTGAAGAAGCTGCTCGG + Intronic
1019208263 6:170381337-170381359 AGTTCTTTAAAGAACCTGTTTGG - Intronic
1021416187 7:20387932-20387954 AGGTTTTTATTTAAGTTGTTTGG + Intronic
1022815859 7:33913535-33913557 AGGAATGGAAAGAAGGTGTTGGG + Intronic
1023526769 7:41112260-41112282 CTGTTTTTAAAGAAAGTGTGTGG + Intergenic
1023612554 7:41985930-41985952 AGGTTTTTAAATAATCTGTTAGG - Intronic
1023656871 7:42432113-42432135 AGGTTCTTAAATAGGGTGTGGGG + Intergenic
1024361833 7:48476473-48476495 GGTTTTTTAAAGAAAGGGTTTGG + Intronic
1024633370 7:51267239-51267261 AGTTTTTTACAGCAGGGGTTTGG - Intronic
1024999464 7:55302903-55302925 GGGTTTTTAAAGAAAGGGTTTGG + Intergenic
1028093259 7:86729486-86729508 ATGTTAGTAAAGAATGTGTTTGG - Intronic
1028261474 7:88672153-88672175 GGATTTTTAAAAAAGGTGTAAGG + Intergenic
1028832667 7:95344105-95344127 AGGCTTTCAAAGAAGTTGTTGGG - Intergenic
1028960646 7:96746166-96746188 AGATTTTTAAAAATTGTGTTAGG + Intergenic
1029572894 7:101382690-101382712 AGGTTTATAAAAATGCTGTTGGG + Intronic
1029781483 7:102738732-102738754 AGATTTTTTAAAAAAGTGTTTGG - Intergenic
1030649588 7:112102851-112102873 AGGCATTTAAAAAAAGTGTTTGG - Intronic
1030814771 7:114022601-114022623 AGATTTTTAAGGAAGTTCTTTGG - Intronic
1031150205 7:118045438-118045460 AGGATGTTAAAGATGGTGTTTGG + Intergenic
1032431145 7:131862718-131862740 AGCTTTTTGAAGAAGGTTTGAGG - Intergenic
1032676551 7:134134938-134134960 AAATATTAAAAGAAGGTGTTGGG + Intronic
1033384185 7:140855089-140855111 GGAATTTTAAAGAATGTGTTTGG + Intronic
1034748950 7:153550671-153550693 TGGTTTTTGAAGTAGGTGTTTGG - Intergenic
1034876736 7:154731172-154731194 ACTTTTTTAAAGGAAGTGTTTGG - Intronic
1035409387 7:158626814-158626836 AGGGTTTTACAGAAAGGGTTTGG - Intergenic
1036002087 8:4617726-4617748 AGGAAATTAAACAAGGTGTTGGG - Intronic
1036523370 8:9512858-9512880 AGGTATTAAAAGATGGTTTTAGG - Intergenic
1036937927 8:13022689-13022711 AGGTTTTTAAAGGCACTGTTAGG + Exonic
1037001802 8:13728949-13728971 AGGGATTTACAGAAGGTTTTGGG + Intergenic
1038468205 8:27786239-27786261 ATCTTTTTAAAGAAGGGGTCGGG + Intronic
1039517182 8:38143956-38143978 AGCATTTTAAAGATGGTTTTAGG + Exonic
1040938466 8:52807010-52807032 AGCTTTTTATAAAAGGTATTTGG + Intergenic
1041322218 8:56625035-56625057 AGGTTTTTAAAGATAGTTTGGGG + Intergenic
1041454602 8:58044521-58044543 AGGTAAATAAAGAAGCTGTTAGG + Intronic
1041591722 8:59594395-59594417 AGGTTTCAACAGAAGGGGTTGGG - Intergenic
1044713015 8:95074904-95074926 AGGTTGTAAAAGAAGGAATTTGG - Intronic
1044914549 8:97098504-97098526 GGGTGTTCAAAGAAGGTTTTTGG - Intronic
1045801682 8:106109564-106109586 AGCTTTTTCAAGAAGGAATTTGG + Intergenic
1046120217 8:109836949-109836971 AATTTGTTAAAGAAGGTGTAAGG + Intergenic
1046325511 8:112639549-112639571 AGTTTTATAAAGAAGGCGCTGGG - Intronic
1046525601 8:115378539-115378561 AGGATTTAAAAAAAGGTGTCTGG + Intergenic
1046589822 8:116192797-116192819 ACTTTTTTAAAGAAGTTTTTAGG + Intergenic
1046827638 8:118709115-118709137 AGGTTGTTAAAGAAGATAGTCGG - Intergenic
1047471532 8:125178564-125178586 AGGTATTTAAAGAAGTCATTAGG + Intronic
1047731278 8:127730838-127730860 AGATGTTCAAAGAAGGTGTTGGG + Intergenic
1048365073 8:133731325-133731347 GGGTTTTTAAAGAAAGAGTTTGG + Intergenic
1048526908 8:135211590-135211612 AGGTTTTAAAAGAACTTGTGAGG + Intergenic
1050035183 9:1427859-1427881 AGCTTTTTTAAGAAGATGTTGGG - Intergenic
1050666249 9:7939844-7939866 AGATTTTTAAAAAATGTGTCAGG - Intergenic
1051099922 9:13509234-13509256 AGGTTTTTAATTATGGTCTTTGG - Intergenic
1051401422 9:16687601-16687623 AGGTTTTATAATAAGGTTTTGGG - Intronic
1051569767 9:18542530-18542552 TGGTCTTTAAAGAAGATATTAGG + Intronic
1051759560 9:20446778-20446800 ATTTTATTAAAGAAGTTGTTTGG - Intronic
1052080991 9:24204947-24204969 ATGTTTTCAAAGAAGAAGTTGGG + Intergenic
1052621017 9:30910480-30910502 GGGTCTTCAAAGAAGGTTTTTGG + Intergenic
1052630429 9:31030983-31031005 AGGTATTTCAAGAATGTTTTAGG + Intergenic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054355486 9:64057342-64057364 AGTTTTTTAGAGAGGGTATTAGG + Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054740651 9:68802885-68802907 AGGATTTTAAAGAAGGAGAGTGG + Intronic
1055008229 9:71534013-71534035 AGCTTTATAAAGAAGGTAATGGG + Intergenic
1055037844 9:71837253-71837275 ACGTTTTTAAAAAATGTGTTTGG - Intergenic
1055046927 9:71936079-71936101 AGATTTTTAAAGATGAGGTTTGG + Intronic
1055200444 9:73652728-73652750 AGTCTTTTAAAACAGGTGTTTGG - Intergenic
1055886125 9:81064966-81064988 AGTTTTTTAATGAAGTCGTTAGG + Intergenic
1056178983 9:84063100-84063122 AGGTTTTTAAAATATGTGTAGGG + Intergenic
1056335622 9:85565826-85565848 AAATTCTTAAGGAAGGTGTTTGG - Intronic
1056387848 9:86113830-86113852 AAATTTTTAAAGAAAGTGTTGGG - Intergenic
1058384809 9:104422683-104422705 ATGTTTTTAAAGATGATCTTTGG + Intergenic
1059249157 9:112872645-112872667 AGGTCCTTAAAGTAGGTGTCTGG - Exonic
1059301635 9:113318409-113318431 GGAGTTTTAAAGAAGGTTTTAGG + Intronic
1187479433 X:19641702-19641724 GGGCTCTTAAAGTAGGTGTTTGG + Intronic
1188025137 X:25200462-25200484 AGGCTTTGAAAGTAGGTGTGGGG + Intergenic
1189677508 X:43476921-43476943 AGCTTTTTAAACAAGTTTTTTGG - Intergenic
1190338680 X:49279266-49279288 ATTTTTTTAAAGAAGTTTTTGGG - Intronic
1190501363 X:51081815-51081837 AACTTTTTAAAGAAGTTGTCAGG - Intergenic
1191675843 X:63791559-63791581 AGGTCATGAAAAAAGGTGTTGGG + Intergenic
1191890988 X:65940632-65940654 AGTTTCTTATAGAAGATGTTTGG + Intergenic
1192736326 X:73852500-73852522 ATTTTTTTAAAGAAAGTATTTGG - Intergenic
1193460291 X:81783271-81783293 AGGCTTTTAAAGCTGGGGTTTGG + Intergenic
1194713427 X:97262879-97262901 AGAATTTTAACGAAGGTGTAGGG + Intronic
1195674995 X:107501303-107501325 AGGTTTTTAAAGAAAGCTCTTGG + Intergenic
1195948905 X:110246459-110246481 AGATAATTAAAGAAAGTGTTAGG - Intronic
1198191226 X:134308492-134308514 AGCATTTTTAAAAAGGTGTTAGG + Intergenic
1198853195 X:140987594-140987616 AAGGTTTTAAAGAAGATGATAGG + Intergenic
1199718801 X:150527011-150527033 AGGTTTCTAAACCAGGTGCTCGG - Intergenic