ID: 1126807776

View in Genome Browser
Species Human (GRCh38)
Location 15:52369613-52369635
Sequence CCTTGTTGAAGCCTGCATTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 101}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126807776_1126807778 -8 Left 1126807776 15:52369613-52369635 CCTTAATGCAGGCTTCAACAAGG 0: 1
1: 0
2: 0
3: 11
4: 101
Right 1126807778 15:52369628-52369650 CAACAAGGATCCCTACCATCAGG 0: 1
1: 0
2: 0
3: 11
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126807776 Original CRISPR CCTTGTTGAAGCCTGCATTA AGG (reversed) Intronic
905001137 1:34671128-34671150 CCCTGCTGCAGCCTGCATGATGG - Intergenic
907727950 1:57037636-57037658 CCTTGTTAAATCCTTCATTAGGG - Intronic
908828202 1:68153623-68153645 CCTTGGTGAAGCCTCCATTTTGG + Exonic
914916928 1:151824679-151824701 CCTTGGGGATGCCTGCCTTAGGG + Intronic
915567092 1:156721173-156721195 TCTTGTTGAGGCCTGCACTGTGG - Intergenic
918951232 1:191142222-191142244 CCTTGTTTATACCTGCAATATGG + Intergenic
922963434 1:229667455-229667477 CTTTCTGGAAGCCTGCACTAAGG - Intergenic
1063407490 10:5811445-5811467 GCTTGTGGAAGCCTGCATGATGG + Intronic
1072246561 10:93548864-93548886 CATTTTTGAAGTCTGCATTATGG - Intergenic
1072615746 10:97048018-97048040 CCTGGCTGATTCCTGCATTATGG - Intronic
1077282717 11:1752922-1752944 CCTTGTTGGAGCCTGCAGGGTGG - Exonic
1082974289 11:59057079-59057101 CCTTCTTGAAGCTTACATTCTGG + Intergenic
1082978699 11:59100874-59100896 CCTTCTTGAAGCTTACATTCTGG + Intergenic
1089057385 11:115597040-115597062 CCTTGTAGAAGGCTGAATAATGG + Intergenic
1091039786 11:132266212-132266234 CCTGGTTGAAGCCTACAGCAAGG + Intronic
1093471489 12:19506644-19506666 ACATGTTAAAGCCTGCATGAGGG - Intronic
1099900641 12:88707200-88707222 ATTTGTTGAAACCTGCTTTATGG + Intergenic
1107460506 13:40597532-40597554 CCTTGTTGAAGCCATGACTAAGG - Intronic
1109854888 13:68114029-68114051 TGTTAATGAAGCCTGCATTAGGG + Intergenic
1109909464 13:68890748-68890770 CCTTCTTTAAGCCAGCTTTATGG - Intergenic
1110867576 13:80413955-80413977 ACTTGTTGAAGCCTGTTTTATGG + Intergenic
1111776281 13:92666801-92666823 CCTTGTAAAAGTCTGCATTATGG - Intronic
1114351205 14:21853314-21853336 CCTTGATGTTGTCTGCATTAGGG + Intergenic
1115316625 14:32031891-32031913 CGTTTTTGAGGCTTGCATTAGGG - Intergenic
1117765432 14:59077118-59077140 CCTACTGGAAGCCTACATTAAGG - Intergenic
1121835387 14:97087792-97087814 CTTTGCTAAAACCTGCATTATGG - Intergenic
1124970103 15:34480214-34480236 CTTTGTAAAACCCTGCATTATGG - Intergenic
1126807776 15:52369613-52369635 CCTTGTTGAAGCCTGCATTAAGG - Intronic
1127218113 15:56846629-56846651 CCTTTTTGAAGCCTTCATAATGG + Intronic
1130695767 15:86129772-86129794 GCTTGAGAAAGCCTGCATTAGGG + Intergenic
1131900993 15:97087483-97087505 CTTTCTTGAAGCCTGTCTTATGG + Intergenic
1132826330 16:1907441-1907463 CCGGGGTGAAGCCTGGATTATGG - Intergenic
1133313641 16:4868112-4868134 CCCTGTGGAAGTCTGCATCAGGG - Intronic
1133750755 16:8723429-8723451 CCTTGTGGCAGCCTGCATCTGGG + Intronic
1133924947 16:10184471-10184493 CCTTGTTGACCCCTTTATTAAGG - Intergenic
1137803140 16:51279249-51279271 CCTGGTTCAAGGCTGCTTTATGG - Intergenic
1146571044 17:33953700-33953722 CCTTGTTCAACCCTGCTTGAAGG - Intronic
1147170600 17:38616678-38616700 CCTCCTTGAAGCCTTGATTATGG - Intergenic
1152789499 17:82271379-82271401 CCTTTTTGATGCCTGCCTAAAGG + Intronic
1163883314 19:19945767-19945789 CCTTGTTTAGGCCTGCAATGAGG - Intergenic
925625128 2:5835018-5835040 CATTGATTAAGCCTCCATTATGG - Intergenic
936893597 2:117401192-117401214 CTTTGTTGAATCCTGGTTTATGG - Intergenic
939028718 2:137044925-137044947 CCTTGTTGAAGTCTTCCTTATGG + Intronic
939418978 2:141941495-141941517 CCTTGTTGAAGGCTGCCCTGGGG + Intronic
940492443 2:154380943-154380965 CCATGTTGTAGGCTGCCTTATGG - Intronic
940850950 2:158687839-158687861 TCTTGTTGAAGCCTCAATTTTGG - Intergenic
941372795 2:164687583-164687605 CCTGTTTGAAGCCTACATTGGGG + Intronic
943526148 2:189020340-189020362 CCTTGCTGCAGCCTGCATGATGG - Intergenic
944484712 2:200192809-200192831 CCTTGGTTTAGCCTGTATTATGG - Intergenic
944875152 2:203956711-203956733 CTTTGTTGTAGTCTGCATTTTGG + Exonic
1170977044 20:21174622-21174644 CTTTGTTCAAGCCTGAATAAAGG - Intronic
1171971093 20:31565768-31565790 ACTTGTTGCAGCCTGTATTAAGG - Intronic
1178924304 21:36762216-36762238 CCATGTTGAAGCCTCTTTTAGGG - Intronic
1184638647 22:45856748-45856770 AAGTGTTGAAGCCTGCATGACGG - Intergenic
950183518 3:10931320-10931342 ACTTGCTGAATGCTGCATTAAGG + Intronic
950594258 3:13965019-13965041 CCTTCTTGAAGCCGGTTTTATGG - Intronic
951506880 3:23456984-23457006 CCTTGCTGAATCCTCGATTATGG - Intronic
954687482 3:52378636-52378658 CCTTGTGGAAGCCACCATCATGG + Exonic
956033648 3:65066819-65066841 CCTTCTTGATGCTTGCCTTAGGG + Intergenic
957194359 3:77048484-77048506 GCTTGTGTAAGCCTGCATTTTGG + Intronic
960965833 3:123104170-123104192 CCTTGTTGATGCCTAAATCACGG - Intronic
962681348 3:137803226-137803248 CCTTGTGGAAACCTGAATAATGG + Intergenic
965504701 3:169501065-169501087 CTCTGTTAACGCCTGCATTAAGG + Intronic
969194037 4:5546820-5546842 CCTTGCTGCAGCCAGCATGATGG - Intronic
970288538 4:14546201-14546223 ACTTACTGATGCCTGCATTATGG - Intergenic
971147823 4:23997976-23997998 CCTTAATGAATCCTACATTATGG - Intergenic
971245387 4:24922483-24922505 CCTAGTTGAAGGCTGCAAGATGG + Intronic
976675615 4:87698398-87698420 CCCTGCTGCAGCCAGCATTATGG + Intergenic
979783450 4:124685180-124685202 CCCTCCTGAAGCCTACATTATGG - Intronic
981769021 4:148285205-148285227 CCTTGTTGCAGCCTTTATCATGG + Intronic
982338476 4:154267920-154267942 CCTTGCTGAAGCCTTCATAGAGG + Intronic
990195979 5:53316797-53316819 CCTAGTTCAGGCATGCATTAGGG + Intergenic
991389113 5:66123439-66123461 CCGTGTTAAATCCTGCAGTATGG + Intergenic
992611768 5:78514139-78514161 CTTTGTGGAAGCAGGCATTATGG - Intronic
996061428 5:119037895-119037917 CCTTGTTGAATCCAGCAAAATGG + Intronic
996816866 5:127583832-127583854 CCTTGTGGAAGGCAGCATAATGG + Intergenic
998578878 5:143349188-143349210 CCTTGGGGAAACCTGCATTTTGG - Intronic
1001307225 5:170584314-170584336 CCTTCTCTAAGCCTACATTAAGG - Intronic
1007204360 6:40136534-40136556 CCTTAATGGAGCCAGCATTAAGG - Intergenic
1009610330 6:65931769-65931791 CCTTGTTGAAGCTGGCATGATGG + Intergenic
1010640510 6:78320630-78320652 CCATGTTGCACGCTGCATTATGG - Intergenic
1012802680 6:103852109-103852131 ACTTGCTGAAGTCTGTATTAGGG - Intergenic
1014256270 6:119162368-119162390 CCTTGTTTATGCTGGCATTAAGG + Intergenic
1018921750 6:168180240-168180262 CGCTGCTGAAGCCTGCATTTTGG + Intergenic
1020761018 7:12268916-12268938 CCCTGCTGAAGCCAGCATGATGG - Intergenic
1027347525 7:77276608-77276630 TCTTGCTGCAGCCTTCATTATGG - Intronic
1029955372 7:104633415-104633437 ACTTGTTTAATCCTGAATTATGG - Intronic
1031846662 7:126813277-126813299 CCTTGGTGAAGCCTGCTTATTGG - Intronic
1033850834 7:145492725-145492747 CCTCTTTGAACTCTGCATTAAGG + Intergenic
1034860474 7:154590898-154590920 CCTTGTCGAGGCCATCATTATGG - Intronic
1039135088 8:34312976-34312998 TCTTGCTGAGTCCTGCATTAAGG - Intergenic
1040579841 8:48688925-48688947 CCTGGTTGAAGGCAGCATTGTGG + Intergenic
1042738557 8:72016978-72017000 CCTTGCTGAAGACTGCAGTCTGG + Intronic
1043741691 8:83821730-83821752 TCTTGTTGAAGCATGCATCTTGG + Intergenic
1044288275 8:90436785-90436807 CCCTGTTGAAGGATGCATTTGGG + Intergenic
1044497273 8:92901881-92901903 CCTTGTTGAAAGATGTATTATGG + Intronic
1046105530 8:109661445-109661467 CCCTGTCTAAGCCTGCATAAGGG - Intronic
1050806553 9:9687357-9687379 CTTTGTGGAAGCCTTCATAAGGG + Intronic
1053110704 9:35457384-35457406 CCTTGTTTAAGCCAGTTTTATGG - Intergenic
1053875409 9:42540536-42540558 CCCTGCTGTAGCCTGCATGATGG - Intergenic
1054236291 9:62561188-62561210 CCCTGCTGTAGCCTGCATGATGG + Intergenic
1054792093 9:69265908-69265930 CCTTGTGGGAGCCTGGCTTATGG + Intergenic
1056703218 9:88927886-88927908 CCATGTTGTAGCATGTATTATGG + Intergenic
1058335678 9:103825452-103825474 CCTCTTTAAAGCCTGCATCAGGG + Intergenic
1059878519 9:118663271-118663293 CCTTATTAAAGGCTGCATTTAGG + Intergenic
1061849069 9:133403909-133403931 CCTTGATGCAGCCTGCAGAAAGG - Exonic
1188411311 X:29875289-29875311 CCTTGTAAAAGCCTACATTGAGG + Intronic
1189988353 X:46573560-46573582 CATTGATGAAGACTTCATTACGG + Intergenic
1194490908 X:94548024-94548046 CCTTCATGAAGACTGCCTTATGG - Intergenic
1196221784 X:113119602-113119624 GCTTGTGGTAGCTTGCATTATGG + Intergenic
1197115965 X:122834132-122834154 CATGGATGAAGGCTGCATTATGG + Intergenic
1198132583 X:133712590-133712612 CCCTGTAGAGGCCTGCATGATGG + Intronic
1200849933 Y:7872699-7872721 CATTGTTGAACCCAGCATTCAGG - Intergenic