ID: 1126815092

View in Genome Browser
Species Human (GRCh38)
Location 15:52446628-52446650
Sequence TTTTCTAGGCTGAAGGTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 232}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126815092_1126815099 19 Left 1126815092 15:52446628-52446650 CCTTGCACCTTCAGCCTAGAAAA 0: 1
1: 0
2: 3
3: 12
4: 232
Right 1126815099 15:52446670-52446692 AACCCATAAGAACAGCCCTAGGG 0: 1
1: 0
2: 0
3: 21
4: 135
1126815092_1126815098 18 Left 1126815092 15:52446628-52446650 CCTTGCACCTTCAGCCTAGAAAA 0: 1
1: 0
2: 3
3: 12
4: 232
Right 1126815098 15:52446669-52446691 CAACCCATAAGAACAGCCCTAGG 0: 1
1: 0
2: 3
3: 23
4: 236
1126815092_1126815100 20 Left 1126815092 15:52446628-52446650 CCTTGCACCTTCAGCCTAGAAAA 0: 1
1: 0
2: 3
3: 12
4: 232
Right 1126815100 15:52446671-52446693 ACCCATAAGAACAGCCCTAGGGG 0: 1
1: 0
2: 2
3: 10
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126815092 Original CRISPR TTTTCTAGGCTGAAGGTGCA AGG (reversed) Intronic
902579258 1:17398091-17398113 ATTTCTTGGCTGAGGTTGCATGG + Intronic
903027689 1:20441404-20441426 TTTTGTTGGCTGGAGGTACAAGG - Intergenic
903405434 1:23091567-23091589 TTGTCTCCGCTGGAGGTGCATGG + Exonic
904014770 1:27410901-27410923 TTTGCTCGGCTGCAGCTGCAAGG + Intronic
904794342 1:33047797-33047819 ATTTCTAGGCAGAAGGTTTAAGG - Intronic
904971776 1:34424759-34424781 TTGACTAGGCTGAATGTCCAAGG - Intergenic
909728938 1:78870951-78870973 TTTTCCAGGCTAAGAGTGCAAGG + Intergenic
910359830 1:86404531-86404553 ATTTCTAGGCTGAGGGTGGAGGG + Intergenic
910721142 1:90287412-90287434 TCTTCCAGGCTGAAAGTGGAAGG - Intergenic
911530284 1:99036221-99036243 TTTTACAGGCTCAAGGTGGAAGG - Intergenic
911728203 1:101264693-101264715 TTTTCTAGGCTCAAAATGGATGG - Intergenic
914672871 1:149885285-149885307 TGTGCCAGGCTGAAGATGCACGG + Exonic
915263160 1:154694200-154694222 TTAGCTAGGCTGAAGGTTCCAGG + Intergenic
915463815 1:156084373-156084395 TTTGCTAGGCAGAAGATCCAGGG + Intronic
915836757 1:159183002-159183024 TTTTCCAGGCTGAATGAGGAGGG - Intronic
916273342 1:162967739-162967761 AGGTCTGGGCTGAAGGTGCAAGG + Intergenic
921664050 1:217845367-217845389 CTTTCTAGGCTCCAGGTGGAAGG + Intronic
922686533 1:227642976-227642998 TTTTCTAGACTGAAAGTTCCCGG - Intronic
923246769 1:232139744-232139766 TTTTCTAGGCTTAAAGAGCCAGG - Intergenic
923548494 1:234942407-234942429 AGTTCTAGGCTGAATGTTCATGG - Intergenic
923918059 1:238530595-238530617 CTTTCAAGGCTGCAGGGGCAGGG + Intergenic
924748404 1:246860478-246860500 CTTTCTAAGCTGAAGGAGTAAGG + Intronic
1063447248 10:6127129-6127151 TTTTCCAGGCTGAAGGAGTTGGG - Intergenic
1066754814 10:38700571-38700593 CTTTCCAGGCTGAGGTTGCATGG + Intergenic
1068221585 10:54052255-54052277 TTTTCTAGGCACATGGTACAAGG - Intronic
1068938344 10:62657549-62657571 TTTCCTAGCCTGCAGGGGCAAGG - Intronic
1069403170 10:68070942-68070964 TGTCCTAGGCTCAAAGTGCATGG + Intronic
1069858766 10:71457138-71457160 TTTGATAGGCTGAAGCTGGAGGG + Intronic
1070671760 10:78382297-78382319 TTTTCTTGGCTGTAGCTTCAGGG + Intergenic
1071439719 10:85679588-85679610 TTTTCCAGGCAGAAGGAACAAGG + Intronic
1072276700 10:93830244-93830266 TTCCCCAGGCTAAAGGTGCATGG + Intergenic
1074619656 10:115106016-115106038 TTTTCCAGGCACATGGTGCAAGG - Intronic
1076246632 10:128951949-128951971 TTTTTTAGGATGAACATGCAAGG - Intergenic
1076405306 10:130208214-130208236 GTTTCTGGGCTGGGGGTGCACGG + Intergenic
1078320128 11:10327021-10327043 TGTTTTAGGCTGAAAGTGAAGGG + Intronic
1078531936 11:12143285-12143307 TTTTCTTAGCTGAGGGTGCAAGG + Intronic
1079170607 11:18091625-18091647 TTTTCTAGGCAAAGGGTTCATGG - Intronic
1081828839 11:46087998-46088020 TTTGGGAGGCTGAAGGTGGATGG - Intronic
1082108084 11:48242538-48242560 TTTCCAAGCCTGAGGGTGCAGGG + Intergenic
1082690159 11:56292367-56292389 TTTCCAAGGATAAAGGTGCAAGG + Intergenic
1082959241 11:58903160-58903182 ATTCCTAGGCTCAAGGAGCAGGG + Intronic
1082965883 11:58965828-58965850 ATTCCTAGGCTCAAGGAGCAGGG + Intronic
1084844596 11:71889083-71889105 CTTTCTAGGCTGAAGTGGCCTGG - Intronic
1085353409 11:75815311-75815333 GTTTCTAGGCTGCAGGGGCTTGG + Exonic
1086355347 11:85992322-85992344 TTGTCTAGGCTGAAGGGCAATGG + Intronic
1087225602 11:95595036-95595058 TTTTCACGGCTTAAGGTGTATGG + Intergenic
1087477310 11:98652257-98652279 TTTTCTAGGATTAAAGTGGAAGG + Intergenic
1088912714 11:114204191-114204213 TTTTCTAGGCTGGAGTGCCATGG + Intronic
1090365437 11:126201425-126201447 TTTACTAGGCTGAAGGTATCTGG - Intergenic
1090974095 11:131667299-131667321 CTTTCTAGGCAGAAGGAGTAAGG - Intronic
1091194827 11:133721713-133721735 GTTTCTAGGATAAAGGAGCATGG - Intergenic
1096648760 12:53051841-53051863 TTTCCTAGGCTGAAGGTGGAGGG - Exonic
1099214644 12:79838972-79838994 TTTTCTAGGCACACAGTGCAAGG - Intronic
1099254226 12:80295730-80295752 TTTTCTAGGAAGAAAGTACATGG - Intronic
1099643743 12:85324104-85324126 TTTTCCAGGTTTAAGGTCCAAGG - Intergenic
1099734178 12:86546694-86546716 TTTTCTAAGCTGTAAGTACATGG + Intronic
1100469621 12:94878683-94878705 TTTTGTGGCCTGAAGATGCAGGG + Intergenic
1100747391 12:97661196-97661218 TTTTGCAGGCTCAAGGTGTAAGG - Intergenic
1100971997 12:100080222-100080244 TTTTCCAGGCACATGGTGCAAGG - Intronic
1102607016 12:114075670-114075692 CTTAAAAGGCTGAAGGTGCAGGG - Intergenic
1105484757 13:20817102-20817124 CTTTCATGGGTGAAGGTGCAAGG + Intronic
1105801481 13:23906792-23906814 TATTCATGGCAGAAGGTGCAGGG + Intergenic
1106590552 13:31094936-31094958 TTTTGTAGCCAGAAGCTGCATGG + Intergenic
1109552894 13:63928531-63928553 TTTTCTAAGCTGAAGCTACTAGG + Intergenic
1112214170 13:97413002-97413024 TCTTCTAGGCAGAAGGAACATGG - Intergenic
1112826552 13:103398515-103398537 TTTTCCAGGCACATGGTGCAAGG + Intergenic
1115024064 14:28719303-28719325 TTGTCTCGGCTGAATGTACAAGG - Intergenic
1115896210 14:38090595-38090617 ATGTCTAGGCAGAAGCTGCAGGG - Intergenic
1116869717 14:50059782-50059804 TTTGCCAGGCTGCAGATGCATGG + Intergenic
1118825029 14:69372175-69372197 TTGTCTAGGCAGAAGGTGGCTGG + Intergenic
1119849099 14:77853917-77853939 GTTTCCAGGCTGAAGTGGCAGGG - Intronic
1119883082 14:78116931-78116953 TTCTCTTGGCTGAAGGTGGGTGG + Intergenic
1120876612 14:89381497-89381519 TTTTTTGGGCTGCAGGTGCAGGG - Intronic
1122713770 14:103680798-103680820 TTATCTAGGCTGTAGGAGCCAGG + Intronic
1122887882 14:104718599-104718621 TTATCTAGGTGGAAGGTGCCGGG - Intronic
1202865398 14_GL000225v1_random:114041-114063 TTCTCCCTGCTGAAGGTGCATGG - Intergenic
1126815092 15:52446628-52446650 TTTTCTAGGCTGAAGGTGCAAGG - Intronic
1126965459 15:54047871-54047893 TTTTTCAGGCTGAAGATTCAGGG + Intronic
1127134861 15:55909626-55909648 CTTTGTAGGCTGAAGGGGCTTGG - Intronic
1128308375 15:66614898-66614920 TTTACTAGGCTTAATGAGCAGGG + Intronic
1129547791 15:76416563-76416585 TTGTCTAGGTTGAGGGTACAAGG + Intronic
1133698438 16:8287098-8287120 TTTTCTGGGCTGAATATCCATGG - Intergenic
1135907895 16:26530202-26530224 TTGTCTAGTCTGAAAGTACATGG - Intergenic
1136727874 16:32376267-32376289 CTTTCCAGGCTGAGGTTGCATGG - Intergenic
1138481343 16:57305385-57305407 TTTTCTTGGCTGAGGGTGGAGGG + Intergenic
1139308750 16:66010577-66010599 TTATCTAGGAGGAAGGTGGAGGG - Intergenic
1202998561 16_KI270728v1_random:141487-141509 CTTTCCAGGCTGAGGTTGCATGG + Intergenic
1203130158 16_KI270728v1_random:1677891-1677913 CTTTCCAGGCTGAGGTTGCATGG + Intergenic
1145768080 17:27472949-27472971 TTTCCTAGGCTGGAGTTCCATGG + Intronic
1146464780 17:33077746-33077768 TTTTCAAGCCTGAAGGAGGAGGG + Intronic
1148538058 17:48457186-48457208 CTTTCTGGGTTGCAGGTGCAGGG + Intergenic
1151526240 17:74670899-74670921 TTTCCTAGGGAGAAGGTCCAGGG - Intronic
1151877828 17:76877382-76877404 GTCTGTAGGCTGAAGGTCCATGG + Intronic
1153938510 18:9954045-9954067 TTTTCTAGGATGAAGGTTTAAGG + Exonic
1155034978 18:22018548-22018570 TTTTCAAGTCTGAAGGTCAATGG - Intergenic
1156545718 18:37961811-37961833 CCTTCTAGGCTTAAGGTGAAGGG - Intergenic
1156937984 18:42734226-42734248 TTTTCCAGGCTGAAGTTCAATGG - Intergenic
1157339401 18:46765949-46765971 TTTTATAGGCTGAAAATCCAAGG - Intergenic
1157427781 18:47598792-47598814 TTTTCCAGAGTGAAGGTGCCTGG + Intergenic
1160145493 18:76360360-76360382 TTTTCTTGGCTGAAAGTGAATGG - Exonic
1160820800 19:1056862-1056884 TGTTGTAGGGTGAGGGTGCATGG - Intronic
1160841499 19:1148697-1148719 TTTTCTGGGGTGAAGGAGGATGG - Intronic
1161483889 19:4524591-4524613 GTTTCTAGGCTATAGGTTCAGGG + Intronic
1164975008 19:32566406-32566428 CTTTCTGGGCTCAAGGAGCATGG - Intergenic
1165664322 19:37614043-37614065 TTTTGGAGGCTGAAAGTCCAAGG - Exonic
1165974741 19:39665874-39665896 TTTTCCAGGCTCATGGTGCAAGG + Intergenic
1168167977 19:54566682-54566704 TTTTCAAGGCTTAGGGAGCAGGG - Intergenic
929170849 2:38931980-38932002 TTTTCTATGCTTAAGATGAATGG + Intronic
930480685 2:51944430-51944452 TTTTGCAGGCTGTAGGTGGAAGG + Intergenic
930484886 2:51999142-51999164 TTTTCTAGGCACATGGTGCAAGG - Intergenic
931860245 2:66346838-66346860 TTTTCTACACTGAAGATGGAAGG + Intergenic
932353422 2:71049603-71049625 TTTTCTGGGCTGAAGTGGCCTGG - Intergenic
932521324 2:72416546-72416568 TTTGCTGGGCAGAAGATGCAGGG + Intronic
934318101 2:91944806-91944828 CTTTCCAGGCTGAGGTTGCATGG + Intergenic
936694319 2:114928587-114928609 TTTTCCAGCCTGAGGGTACACGG + Intronic
937068184 2:119036142-119036164 ATATATAGGCTGAAGGTGAAGGG + Intergenic
939835612 2:147125824-147125846 TTTTCCAGGCTCACGGTACAAGG - Intergenic
940698490 2:157011249-157011271 TATTGTTGGCTGTAGGTGCAAGG - Intergenic
940724774 2:157324455-157324477 TGTTCAAGGCTGAGGCTGCATGG - Intronic
941888428 2:170553245-170553267 TTTTCTAGGCACATAGTGCAAGG - Intronic
941889306 2:170561502-170561524 TTTTCTAGAGTTAGGGTGCATGG - Intronic
943148307 2:184074893-184074915 TTTTTTAGGCTAAATGTGTAAGG + Intergenic
943247158 2:185470460-185470482 TTTTCTAGGTTAAAAGTGAAGGG - Intergenic
946315608 2:218909365-218909387 ATTTCTCGGGTGAAGGAGCACGG - Intergenic
1169479111 20:5961565-5961587 TTGTCTTGGCTTAAGGTTCAAGG + Intronic
1169574274 20:6941008-6941030 CTTTCAAGGTTGAATGTGCATGG + Intergenic
1170422960 20:16210696-16210718 TGTTCTAGGCAGAAAGAGCAGGG - Intergenic
1170453028 20:16505452-16505474 TTTTCTTTGCTTAAAGTGCAAGG - Intronic
1170759036 20:19233347-19233369 TTTCCTTGGCTCAAGATGCAAGG - Intronic
1174519451 20:51118478-51118500 TTTGCTAAGCTGAAGGGACAGGG - Intergenic
1174886871 20:54345338-54345360 TTTGCCAGGCTGAAGGATCAGGG + Intergenic
1175088397 20:56481031-56481053 TATTTTAGACTGAAGGTTCACGG - Intronic
1175167526 20:57055294-57055316 TGTTCTTGGCACAAGGTGCAAGG + Intergenic
1175411079 20:58769578-58769600 TTTTCTAGGCTGACTGAGAAGGG + Intergenic
1176728532 21:10465763-10465785 TTTTCTAGGGAGGAGGTGGAGGG + Intergenic
1177087408 21:16723928-16723950 TTTTCTTAGCTGAATATGCAAGG + Intergenic
1177473874 21:21593813-21593835 TTTTCCAGGCACAAGGTACAAGG + Intergenic
1177606072 21:23379187-23379209 TTTTCTAGGCACACAGTGCAAGG - Intergenic
1179634091 21:42696385-42696407 TTTTCTAGGGACAAGGGGCAGGG + Intronic
1179936723 21:44610705-44610727 TTTTCCAGGCACATGGTGCAAGG - Intronic
1180306273 22:11128490-11128512 CTTTCCAGGCTGAGGTTGCATGG + Intergenic
1180544792 22:16490673-16490695 CTTTCCAGGCTGAGGTTGCATGG + Intergenic
1182008419 22:26980485-26980507 CTTTTTGGGCTGAAGGGGCATGG + Intergenic
1183281138 22:36933366-36933388 ATTTCTAGACTGAAGGTGTGGGG - Intronic
949347619 3:3091137-3091159 TCTGCTAGGCTGAAGGCTCAGGG + Intronic
949391252 3:3564970-3564992 CTTTCTAGACTGAAGATTCATGG - Intergenic
949599300 3:5580962-5580984 CTCTCTAGGCTGCAGGGGCAAGG - Intergenic
951473921 3:23084274-23084296 TTTTATAGGCTATAGGTGCTGGG - Intergenic
954597847 3:51842078-51842100 TTTTCTAGGATTTGGGTGCATGG + Intergenic
955322289 3:57982933-57982955 TGGTGTAGGCTGAAGGGGCATGG - Intergenic
956327487 3:68069991-68070013 TTTTCCAGGCGCATGGTGCAAGG + Intronic
956937246 3:74117085-74117107 CATTCTAGGCAGAAGGAGCAGGG - Intergenic
958153534 3:89723168-89723190 TTTTATTGGTTGAAGGTGAAAGG + Intergenic
959685890 3:109145903-109145925 TATTCTAGGCTGAAGGAGACTGG - Intergenic
959958982 3:112274167-112274189 TTTTCTAGGAGGAAGATACAGGG + Intronic
960903662 3:122576879-122576901 CCATCTAGGCTGAAGGGGCAAGG - Intergenic
960916676 3:122702164-122702186 TCTTGTAGGCTGCAGGGGCATGG + Intronic
961372738 3:126441296-126441318 CTTTCTATGCTGAAGGTGGTGGG - Intronic
963018594 3:140849643-140849665 TTTTCTAGGGTGAGGGCTCAAGG - Intergenic
963316691 3:143766538-143766560 TTTTCTTAGCTGTAGGTGGAGGG + Intronic
963806101 3:149724557-149724579 TTTTCTAGGGTTATGGTCCATGG - Intronic
963878726 3:150504200-150504222 TTTTCTCAGGTGGAGGTGCATGG - Intergenic
964003450 3:151805006-151805028 TGTTCAAGGCTCAAGGTCCAGGG + Intergenic
964644687 3:158946699-158946721 TTTTCTGGGCTGAAGACCCAGGG + Intergenic
965253304 3:166369580-166369602 ATTCCTCAGCTGAAGGTGCAGGG + Intergenic
965345693 3:167546729-167546751 TTTTCTAGGATGAATGAGCTAGG + Intronic
969241939 4:5904712-5904734 TTTCCTAGGGAGAAGGAGCATGG - Intronic
969349569 4:6590670-6590692 GGTTCCAGGCTGCAGGTGCAGGG + Intronic
970291153 4:14573704-14573726 GTTTCCAGGCTCAAGGTGAAAGG - Intergenic
974601017 4:64079476-64079498 TTTTTTATACTCAAGGTGCAGGG + Intergenic
977950585 4:102966093-102966115 TTTTCCAGGCTGAGGTTGTATGG + Intronic
979624744 4:122831700-122831722 TTTTCTAGGCTGAAGTCACTTGG - Intronic
983310089 4:166048351-166048373 TTTTCAAGGCTGGAAGTTCAAGG - Intronic
984337388 4:178410430-178410452 TTCTCCAGGCTGAAAGTCCAAGG + Intergenic
984555469 4:181208893-181208915 TTTTCTACGATGAATGTCCATGG + Intergenic
986869190 5:12027725-12027747 TTTTCCAGGCACAAGGTCCAAGG + Intergenic
987411962 5:17623903-17623925 TATTCTATCCTGAAGGTGCTGGG - Intergenic
989160598 5:38387106-38387128 TTTTCTGGGCTGAGTGTGGAGGG + Intronic
989543773 5:42648366-42648388 TTTTCTAGGGTGAGGGGACATGG + Intronic
990020750 5:51124427-51124449 ATTTCTAGCTTGAAGGTGGATGG + Intergenic
995755636 5:115500963-115500985 TTTTCTTGGCTGTAGATGCATGG + Intergenic
996286383 5:121797914-121797936 TTTTCTTGTCTGAAGGTGTGGGG - Intergenic
997173176 5:131745914-131745936 TTTTCTAGGAGTAAGGTGGAGGG + Intronic
997366409 5:133328035-133328057 TTTTCTAGGTTGAAGGTACAAGG + Intronic
1001349104 5:170939284-170939306 TTTTCGAGGAAGAAGGGGCATGG + Intronic
1003547173 6:7069279-7069301 TTTTCTAGGGTATAGGTGGAAGG + Intergenic
1005525221 6:26640833-26640855 TTTTCTGGGGAGAAGGTACACGG + Intronic
1008875942 6:56327899-56327921 TTTTCTCAGCTGCAGGTGCTGGG - Intronic
1011564073 6:88656632-88656654 TTTTCTAGGGAGAGGGTTCATGG + Intronic
1011869061 6:91869806-91869828 TTTTCTAGGATTTAAGTGCATGG - Intergenic
1012676514 6:102119799-102119821 TTTCCTAGGCAGACGGGGCAGGG - Intergenic
1013390998 6:109686374-109686396 TTTTAGAGGTTGAAGGTACAAGG - Intronic
1015788479 6:136942679-136942701 ATTTCTAGTCTGGAGGAGCATGG - Intergenic
1021123096 7:16819019-16819041 TTCTATAGGCTGAACGTGAAAGG - Intronic
1022682433 7:32562193-32562215 TTTTCTAAGCTGAAGGTTTATGG - Intronic
1022907557 7:34871568-34871590 TTTTACAGGCTGATGGTGGAAGG - Intronic
1024412692 7:49064092-49064114 TTTCCCAGGCTAAAGGTCCAAGG + Intergenic
1027772071 7:82419232-82419254 TTTTCTTGGCTGAAAGTGCTTGG - Intronic
1029866900 7:103641815-103641837 TTTTCCAGGCTGAAGAAGAATGG - Intronic
1029991047 7:104962774-104962796 TTCTCTAGGCTGAGGGAGGAGGG - Intergenic
1030159085 7:106489068-106489090 TTTTGAAGACTGAAGATGCAGGG + Intergenic
1031201030 7:118685649-118685671 TTTTCAAGGGTTAAGGGGCATGG + Intergenic
1032492390 7:132333373-132333395 TCTTCCTGGCTGAAGATGCACGG - Intronic
1035478181 7:159158558-159158580 TTTTCTAGGGTGAAGCTTGATGG + Intergenic
1037392443 8:18407949-18407971 TTCTGTAGGCTGAACGAGCATGG - Intergenic
1037677581 8:21065010-21065032 TTTTGGAGGCTGAAAGTCCAAGG - Intergenic
1038674151 8:29608256-29608278 TTTTCTAGCCTGAAAGTTCCTGG + Intergenic
1041187468 8:55315717-55315739 TTTTCTAGACTGACGAGGCATGG - Intronic
1042375871 8:68051367-68051389 TCTTTTAAGCTGCAGGTGCAAGG + Intronic
1042554024 8:70019216-70019238 TCTTCAAGGCTGAAGGCACAGGG + Intergenic
1043246579 8:78010782-78010804 TGTTCTAGTCTTAAGGTACATGG - Intergenic
1043530550 8:81145291-81145313 TTTTCTAAGCCAAAGGTCCAAGG - Intergenic
1044418255 8:91961018-91961040 TTGTCTAGTCTGAAGGAGCAGGG - Intronic
1047070476 8:121337409-121337431 TTTGATAGGCTGAGGGAGCAAGG - Intergenic
1048437063 8:134428012-134428034 TTCTGGAGGCTGAAGGTTCAGGG + Intergenic
1049342744 8:142121988-142122010 TGTGCTTGGCTGAAGGTGCCAGG - Intergenic
1050646070 9:7720890-7720912 TTTTCAGACCTGAAGGTGCATGG - Intergenic
1050747205 9:8890307-8890329 TTTTCCAGGCTTAATGTGCTAGG + Intronic
1051816597 9:21114686-21114708 ATAACTAGGCTGAAAGTGCAAGG + Intergenic
1052985624 9:34485134-34485156 TTGTCTAGGATGAAGATTCAGGG + Exonic
1055395096 9:75865722-75865744 TTTTCCAGGCTGAGGGTGGTTGG - Intergenic
1056361692 9:85864038-85864060 TTTCTAAGGCTGAAGATGCAGGG + Intergenic
1056717124 9:89041117-89041139 TTTTATAGGCTGAAGAGGGAGGG - Intronic
1056774344 9:89499910-89499932 TTTTCTAGGCTGAAGACTCCCGG - Intergenic
1057306553 9:93915794-93915816 GTCTCTAGGCTGAAAGAGCATGG - Intergenic
1057518107 9:95738472-95738494 ATTTCCAGGCTGAAAGGGCAGGG + Intergenic
1057561392 9:96130670-96130692 TTTTCCAGGCAGAAGGGGAATGG + Intergenic
1058512459 9:105734921-105734943 TTTTCTAGGATGAATGTAAATGG - Intronic
1059107451 9:111524038-111524060 CATTCTAGACTGAAGGAGCAAGG - Intergenic
1059258726 9:112955348-112955370 AATTCTAGGCTGCAGATGCATGG + Intergenic
1203738945 Un_GL000216v2:162123-162145 TTCTCCCTGCTGAAGGTGCATGG + Intergenic
1186517765 X:10179272-10179294 TGTACTGGGCTGAAGGGGCAGGG + Intronic
1187537111 X:20151924-20151946 TTTCCTGGGCTGAAGGTGCAGGG + Exonic
1187552646 X:20321638-20321660 CATTCTAGGCAGAAGGTACATGG + Intergenic
1188196693 X:27243200-27243222 TTATCTAGGCTGAGGGTGGGTGG - Intergenic
1188986853 X:36775711-36775733 TAGTCTAGGCAGATGGTGCATGG - Intergenic
1190145650 X:47889517-47889539 TTTTCAGGGCTGAGGGGGCAGGG + Intronic
1190552024 X:51593772-51593794 ATTTTTAGACTGAAGGAGCATGG - Intergenic
1192790617 X:74378904-74378926 TTTCCTAGGCTGGAGGGACAGGG + Intergenic
1192867524 X:75151079-75151101 TTTTCTAGGGAGAAGGTCTATGG + Intronic
1193237948 X:79131650-79131672 TTTTAGAGGCAGAGGGTGCAAGG - Intergenic
1194106318 X:89771504-89771526 TTTTCTAGGGAAAAGATGCAGGG + Intergenic
1194615046 X:96089967-96089989 TCTTATAGGCTCAAGGTACAGGG + Intergenic
1195800903 X:108708758-108708780 TTTTCAAGGTGGAAGGTGGAAGG + Intergenic
1199310055 X:146311493-146311515 GTTTTAAGGCTGCAGGTGCATGG - Intergenic
1199806450 X:151305391-151305413 TTTTCTAGGCTCACAGTGAAAGG + Intergenic
1200458279 Y:3419363-3419385 TTTTCTAGGGAAAAGATGCAGGG + Intergenic
1201185656 Y:11399888-11399910 CTTTCCAGGCTGAGGTTGCATGG + Intergenic