ID: 1126816103

View in Genome Browser
Species Human (GRCh38)
Location 15:52455885-52455907
Sequence TGATCCGTATGTTAGATGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 127}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126816103_1126816105 20 Left 1126816103 15:52455885-52455907 CCTTTCATCTAACATACGGATCA 0: 1
1: 0
2: 0
3: 5
4: 127
Right 1126816105 15:52455928-52455950 ACTTTTATTCAACATAATATTGG 0: 5
1: 96
2: 894
3: 4902
4: 14399

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126816103 Original CRISPR TGATCCGTATGTTAGATGAA AGG (reversed) Intronic
909914442 1:81300119-81300141 TGATGCGTATGTTAAGAGAATGG - Intergenic
913319519 1:117578550-117578572 GGCTCAGTTTGTTAGATGAATGG + Intergenic
924192697 1:241571352-241571374 TGTTCCATATTTTAGAGGAAAGG + Intronic
1063397327 10:5702030-5702052 TGTTCCATATCTTAGAGGAAGGG + Intronic
1063806485 10:9649284-9649306 TTATGCTTAGGTTAGATGAAGGG - Intergenic
1065863042 10:29887503-29887525 TGATCCCTATGTTGGAGGTAGGG + Intergenic
1067966415 10:50918141-50918163 TGAACTGAATGTTAGAAGAATGG - Intergenic
1075937809 10:126358561-126358583 TGTTCCGGATCTTAGAGGAAGGG - Intronic
1076377031 10:129997053-129997075 TGTTCCATATCTTAGAGGAAAGG - Intergenic
1078674867 11:13400747-13400769 TGAACTGTAAGTTAGATTAAAGG - Intronic
1079113866 11:17627190-17627212 TGTTCCATATCTTAGAGGAAAGG + Intronic
1079251094 11:18788559-18788581 TGATTTGTACGTTAGAAGAAAGG - Intronic
1080989975 11:37520082-37520104 TGATCCAGATCTTAGATGAAAGG - Intergenic
1086990828 11:93302611-93302633 TGTTCCAAATGTTAGAGGAAAGG - Intergenic
1087080252 11:94163296-94163318 TGTTCCATATCTTAGAGGAAAGG + Intronic
1087154012 11:94883626-94883648 TTTTCATTATGTTAGATGAAGGG + Intergenic
1087159549 11:94935495-94935517 TGATCCCGATGTTGGAGGAAAGG + Intergenic
1087338338 11:96870693-96870715 TGTTTGGTATTTTAGATGAATGG - Intergenic
1093415168 12:18911512-18911534 TGTTCCGGATTTTAGAGGAAAGG - Intergenic
1096118960 12:49074202-49074224 TCATCCTAATGTTAGATAAATGG + Intergenic
1103221622 12:119251129-119251151 TGGTGGGTATGTTAGATGAGAGG - Intergenic
1109060590 13:57614173-57614195 TGATTGGTAGGTTAAATGAAGGG - Intergenic
1109362428 13:61313010-61313032 TGTTTCAGATGTTAGATGAAAGG + Intergenic
1114960344 14:27879721-27879743 TGTTCCGGATTTTAGAGGAAAGG + Intergenic
1114984817 14:28213136-28213158 TGTTCCATATCTTAGAGGAAAGG + Intergenic
1115279304 14:31643227-31643249 TGTTCCAGATCTTAGATGAAAGG + Intronic
1116242618 14:42365121-42365143 TGGGCCGCATGTTTGATGAAGGG - Intergenic
1116578875 14:46612298-46612320 TTATTTGTATGTTAGATGATGGG - Intergenic
1120428525 14:84382522-84382544 TGTTCCTTATCTTAGAAGAAAGG - Intergenic
1124074050 15:26425600-26425622 TGTTCTGTATCTTAGATTAAAGG + Intergenic
1124637603 15:31374936-31374958 TGTTCCGTCTGATAGATGGAAGG + Exonic
1126816103 15:52455885-52455907 TGATCCGTATGTTAGATGAAAGG - Intronic
1126817233 15:52466064-52466086 TGCTCCGCATGTTAGATCTAGGG - Intronic
1127133047 15:55888054-55888076 TGTTCCAGATGTTAGAGGAAAGG - Intronic
1128631127 15:69268667-69268689 TGACCCGTAAGTTAGGGGAAGGG + Exonic
1130761705 15:86827667-86827689 TGATGTGTATCTTAGCTGAAAGG - Intronic
1130789678 15:87140412-87140434 TGATTCGTTTGTTAGATTATGGG - Intergenic
1135140045 16:19913409-19913431 TGATCCGCATTTTACAGGAAAGG - Intergenic
1135716607 16:24775490-24775512 AGATCAGTTTGTTAGGTGAAGGG + Intronic
1135785342 16:25343861-25343883 TGCTCAGTGTGTTAGAGGAAAGG - Intergenic
1140157724 16:72450607-72450629 TGATCCAAATCTTAGAGGAAGGG + Intergenic
1143431225 17:6886895-6886917 TGTTCCATATTTTAGAGGAAAGG + Intronic
1154198026 18:12280299-12280321 TGATCCGTAGGCTAGATTCAAGG + Intergenic
1154296379 18:13153474-13153496 TGTTCCATATGTTAGAGGAAGGG + Intergenic
1158948662 18:62470961-62470983 TGTTCCAGATGTTAGAGGAAAGG + Intergenic
1162842690 19:13367880-13367902 TGAACCATTTGTTAGATGAGAGG - Intronic
1164729762 19:30494590-30494612 TGAGCCATAGGTTAGATGGAAGG - Intronic
930228285 2:48816903-48816925 TTATCTGTATGTTAAATGCAAGG + Intergenic
932561295 2:72872939-72872961 TGTTCCTTATCTTAGAGGAAAGG - Intergenic
942962728 2:181852382-181852404 TGATCTGTATCATATATGAAAGG - Intergenic
944769885 2:202903354-202903376 TGTTCCAGATGTTAGAGGAAAGG - Intronic
947044840 2:225970022-225970044 TGATCAGTATATTAGAGAAAGGG + Intergenic
947789835 2:232858850-232858872 TGATCCACATGTTAGCAGAAAGG - Intronic
1172347190 20:34210758-34210780 TGTTCCAGATGTTAGATGAAAGG + Intronic
1173379653 20:42528435-42528457 TTATCCATTTATTAGATGAATGG - Intronic
1174831361 20:53815393-53815415 TGATCCAGATCTTAGAGGAAAGG + Intergenic
1177539842 21:22477871-22477893 TACTCCGTATGTTTGAGGAAAGG + Intergenic
1177964308 21:27708195-27708217 TGTTCCGGATCTTAGAAGAAAGG + Intergenic
1179042126 21:37812833-37812855 TGTTCCGGATCTTAGAGGAAAGG - Intronic
1181180160 22:21061984-21062006 TGAACCGTATGGTATGTGAACGG + Intronic
1182719743 22:32387445-32387467 TAATCAGGCTGTTAGATGAATGG - Intergenic
1182977207 22:34634641-34634663 TGATCTGTATGATAGAAAAAGGG + Intergenic
949149945 3:754392-754414 TGTTCCATTTGTTAGAGGAAAGG + Intergenic
949741919 3:7245082-7245104 TGATCAGTGAGTTAGAGGAAAGG + Intronic
951249202 3:20374510-20374532 TGATCCATAAGTGAGGTGAATGG + Intergenic
952978562 3:38717041-38717063 TGAACAGAATGTTAGATGATTGG + Intronic
953087680 3:39687315-39687337 TGTTCCATATCTTAGAGGAAAGG - Intergenic
956550752 3:70456288-70456310 TGTTCCATATCTTAGAGGAAAGG - Intergenic
959374290 3:105569156-105569178 TGATTCTTACTTTAGATGAAAGG + Intronic
963701753 3:148635265-148635287 TGTTCCGGATCTTAGAGGAAAGG - Intergenic
969148454 4:5144824-5144846 TCCTCCGTATGTTGGATGGATGG - Intronic
971542791 4:27842117-27842139 TGATCCGGCTGTTAGGGGAAAGG - Intergenic
971697629 4:29927005-29927027 TGTTCCATATTTTAGAGGAAAGG - Intergenic
974399228 4:61379907-61379929 TAATCAGTATGTTATTTGAAAGG + Intronic
979064791 4:116116522-116116544 TGATCCTGATGTTAGAGAAAAGG - Intergenic
979564638 4:122140777-122140799 TGTTCCAGATCTTAGATGAAAGG + Intergenic
983138848 4:164122850-164122872 TGTTCCAGATGTTAGAGGAAAGG - Intronic
986211291 5:5675360-5675382 TGATCTGTAAGTTGGATTAAAGG + Intergenic
986227114 5:5826287-5826309 TGACCAGTTTGTTAGATGAATGG + Intergenic
986502994 5:8420212-8420234 TGAGCCTAATGTTAGATGTAAGG - Intergenic
986558502 5:9036993-9037015 TATTCCAAATGTTAGATGAATGG - Exonic
986610410 5:9561491-9561513 TGTTCTTTATGTGAGATGAAAGG - Intergenic
988607944 5:32697049-32697071 TGTTCCATATCTTAGAGGAAAGG + Intronic
988955828 5:36317694-36317716 TGTTCCAGATGTTAGAGGAAAGG + Intergenic
989488876 5:42026633-42026655 TGCTCTGGATCTTAGATGAAAGG + Intergenic
989671343 5:43920390-43920412 TGTTCCAGATCTTAGATGAAAGG + Intergenic
991632764 5:68673358-68673380 TTATCCGTGCGTAAGATGAAGGG + Intergenic
993185851 5:84618834-84618856 TGATCCAAAATTTAGATGAAAGG + Intergenic
993777806 5:92023219-92023241 TGATCCCTATGGTGGATTAAGGG + Intergenic
997964996 5:138349811-138349833 TGACCCACATCTTAGATGAAGGG - Intergenic
1005489690 6:26335990-26336012 TGATCCCGATGTTGGATGCAGGG - Intergenic
1008076760 6:47153735-47153757 TGAGCCGTCTGTTAGAGGAGGGG - Intergenic
1011236362 6:85222492-85222514 TGTTCCAGATGTTAGAGGAAAGG - Intergenic
1012600287 6:101088267-101088289 TGTTCCAGATGTTAGAGGAAAGG + Intergenic
1013766801 6:113584024-113584046 TGATCCGAATGGGAGAGGAATGG - Intergenic
1015192301 6:130484677-130484699 TTATGCGAATGTTAGATGGAAGG + Intergenic
1015578291 6:134696491-134696513 TGTTCCAAATGTTAGAGGAAAGG + Intergenic
1021648818 7:22812762-22812784 TAATCCATATGTTAGGTCAATGG + Exonic
1022905101 7:34848144-34848166 TGATCCCTGTGTTTGATGAGAGG + Intronic
1025288709 7:57691971-57691993 TGATCCTGATCTTAGAAGAAGGG + Intergenic
1028000867 7:85496524-85496546 TGATCTGTATTTAAGAAGAAAGG - Intergenic
1028243235 7:88446509-88446531 TGCTCCGTATGTTGCATCAAAGG + Intergenic
1030008943 7:105146550-105146572 TGATGCATATGTGAGAAGAATGG - Exonic
1030803274 7:113880785-113880807 TGAGCCTTATGTGAGAAGAAGGG - Intronic
1031746239 7:125501897-125501919 TGTTCCACATCTTAGATGAAAGG + Intergenic
1033963542 7:146945197-146945219 TGATACAGATGTTAGATAAAGGG - Intronic
1040066072 8:43145100-43145122 TTATCAGAATGTTAGAGGAATGG + Intronic
1041890500 8:62863357-62863379 TGATGCATATGTGAGAAGAACGG - Intronic
1042263221 8:66881931-66881953 TAATCCGTATGTTCCCTGAATGG + Intronic
1046076504 8:109318851-109318873 TGATCAGTATATTTGTTGAATGG - Intronic
1046113813 8:109760857-109760879 TGTTCCATATATTAGAGGAAAGG + Intergenic
1047429039 8:124774983-124775005 TGAGCTGTATGTTGGAAGAAGGG + Intergenic
1052586258 9:30431832-30431854 TGATCCAGATCTTAGACGAAAGG - Intergenic
1053570557 9:39301039-39301061 TGATCCTTATGTTACCAGAAAGG - Intergenic
1053836504 9:42141957-42141979 TGATCCTTATGTTACCAGAAAGG - Intergenic
1054092176 9:60860056-60860078 TGATCCTTATGTTACCAGAAAGG - Intergenic
1054113589 9:61135649-61135671 TGATCCTTATGTTACCAGAAAGG - Intergenic
1054126591 9:61317973-61317995 TGATCCTTATGTTACCAGAAAGG + Intergenic
1054594106 9:67046538-67046560 TGATCCTTATGTTACCAGAAAGG + Intergenic
1186983307 X:14982558-14982580 TGTTCCGCATCTTAGAGGAAAGG - Intergenic
1187214164 X:17259399-17259421 TGTTCCGGATCTTAGAGGAAAGG - Intergenic
1188080110 X:25828528-25828550 TGAACTGTATGTCAGATGATAGG - Intergenic
1188700532 X:33255388-33255410 TCATCCGTATTTTATAGGAAAGG + Intronic
1188741739 X:33791936-33791958 TGTTCCATATCTTAGAAGAAAGG + Intergenic
1188747773 X:33867920-33867942 TTACAAGTATGTTAGATGAAAGG + Intergenic
1189885258 X:45537287-45537309 TGTTCCATATCTTAGAGGAAAGG - Intergenic
1193111263 X:77732839-77732861 TGATCTGGATCTTAGAGGAAAGG - Intronic
1193153633 X:78149625-78149647 TGTTCCATATCTTAGATGAAGGG + Intergenic
1194285287 X:92002962-92002984 TGTTCCAGATGTTAGAGGAAAGG + Intronic
1194352485 X:92837909-92837931 TGGTCCATATCTTAGAGGAAAGG - Intergenic
1195824648 X:108985409-108985431 TGATCCAGATCTTAGAGGAAAGG + Intergenic
1199367990 X:147010039-147010061 TGTTCCAGATGTTAGAGGAAGGG + Intergenic
1200602855 Y:5227504-5227526 TGTTCCAGATGTTAGAGGAAAGG + Intronic