ID: 1126816182

View in Genome Browser
Species Human (GRCh38)
Location 15:52457152-52457174
Sequence GGCAAAGGGGCTTGGTGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1278
Summary {0: 1, 1: 2, 2: 16, 3: 144, 4: 1115}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126816182 Original CRISPR GGCAAAGGGGCTTGGTGTGG TGG Intronic
900171567 1:1271685-1271707 CACAAAGGGGCTGGGCGTGGTGG + Intronic
900274880 1:1818573-1818595 GGAAAATAGGCTGGGTGTGGTGG + Intronic
900314007 1:2048175-2048197 GGCCATGGGGCCTGGAGTGGGGG + Intergenic
900509664 1:3052580-3052602 GGCAGAGGGGCATGGGGTGTGGG + Intergenic
900774767 1:4574283-4574305 GGCAGAGAGGCCAGGTGTGGTGG - Intergenic
900794761 1:4701185-4701207 GGGAAAGGGGATGGGAGTGGAGG + Intronic
900911346 1:5599037-5599059 GGCAAAGGGGCTGTTAGTGGAGG - Intergenic
901022721 1:6263127-6263149 GGCCAAGGGGCATGGTGGCGTGG + Intergenic
901138600 1:7013498-7013520 GACAAAGGGGCCAGGTGTGGTGG - Intronic
901165630 1:7219746-7219768 GGAAGAGGGGCCTGGTGTGGTGG + Intronic
901315652 1:8306095-8306117 AGAAAAGAGGCTGGGTGTGGAGG + Intergenic
901342632 1:8509232-8509254 GGTATAGGGGCCAGGTGTGGTGG - Intronic
901417940 1:9129672-9129694 GGCTTAGGGGCGTGGTGTGAGGG - Intergenic
901704126 1:11060378-11060400 GGGACTCGGGCTTGGTGTGGAGG + Intergenic
901911924 1:12465847-12465869 TGCAAAGAGGCCGGGTGTGGTGG + Intronic
902114720 1:14112023-14112045 GGCAAAGGGGCTGAGCGTGGTGG - Intergenic
902519722 1:17009344-17009366 GGCAAAGGTGCTGGGAGTTGGGG + Intronic
902633634 1:17720459-17720481 GGCCAAGAGGATTGGTGAGGAGG - Intergenic
903510473 1:23870863-23870885 GACATAGGGGCTGGGAGTGGTGG + Exonic
903618773 1:24682401-24682423 GGCAGAGGGGCTGGGTGCAGTGG - Intergenic
903877405 1:26484818-26484840 GGTTAATGGGCTGGGTGTGGTGG - Intergenic
904074576 1:27830570-27830592 GGAAAAGGGGCTTTGTAGGGAGG - Intergenic
904113005 1:28141412-28141434 GGGAACGGGGCTTGGTGCAGTGG + Intergenic
904154391 1:28470734-28470756 AGAAAAGAGGCTGGGTGTGGTGG + Intronic
904321872 1:29703122-29703144 TGCAAAGGAGCATGGTCTGGAGG + Intergenic
904441019 1:30530864-30530886 GGCAAGGGGGTTTGGTTTGGAGG - Intergenic
904475906 1:30764389-30764411 GGCCAAGGGGCTTGGAGGGCTGG + Intergenic
905106727 1:35567611-35567633 GACATAGAGGCTAGGTGTGGTGG + Intergenic
905119986 1:35674421-35674443 TGCATGGGGGCTTGGTGCGGTGG + Intergenic
905456611 1:38092504-38092526 GACTAAGGGGCTGGGTGTCGAGG - Intergenic
905544797 1:38789129-38789151 GGCAAGGGGGCGTGGTGTGGAGG - Intergenic
905590269 1:39157255-39157277 TGGAAAGGGGCTGGGTGTGGTGG - Intronic
905741724 1:40376996-40377018 GGAATAGAGGCTGGGTGTGGTGG + Intronic
905756869 1:40517890-40517912 GGAAAAAGGGCTGGGCGTGGTGG + Intergenic
906044316 1:42816703-42816725 GGCAAGGGCGCTGGATGTGGGGG + Intronic
906380427 1:45328940-45328962 GGCAGATGGGGTTGGAGTGGGGG - Intergenic
906402637 1:45516712-45516734 GTCAAACAGGCTGGGTGTGGTGG + Intronic
906562954 1:46772819-46772841 GGCCAAGGGTTTTTGTGTGGTGG - Intronic
906614401 1:47224884-47224906 AGCAGAGGGGCTGGGAGTGGAGG + Intronic
906620545 1:47274602-47274624 GAGAAAGAGGCTGGGTGTGGTGG - Intronic
906633559 1:47392385-47392407 GTTAAATGGGCTGGGTGTGGTGG + Intergenic
907105203 1:51876900-51876922 GGCAAACGGGCTGGGCGGGGTGG + Intronic
907128591 1:52074647-52074669 GGGTATGGGGCTGGGTGTGGTGG - Intronic
907442691 1:54488690-54488712 GGGAAAGGGGGTTGGGGCGGGGG + Intergenic
907658845 1:56373086-56373108 TGTAAAAGTGCTTGGTGTGGGGG + Intergenic
908071014 1:60460221-60460243 GGCAAGGGGGCCAGGCGTGGTGG + Intergenic
908208424 1:61874482-61874504 GCCCAAGGGGCTGGGTGTGGTGG - Intronic
908268937 1:62404260-62404282 GGCAGAGGGAGGTGGTGTGGGGG + Intergenic
908383502 1:63618730-63618752 GGCCAAGGGTCTGGATGTGGAGG + Intronic
908398934 1:63752045-63752067 GACAAAGGAGCTGGGTATGGTGG - Intergenic
908894934 1:68888127-68888149 AGCAAGGGGGCTGGGTGTGGTGG + Intergenic
909137251 1:71817019-71817041 GGCAAGTTGGCTTGCTGTGGAGG - Intronic
909389596 1:75104876-75104898 ATAAAAGGGGCTTGGTGCGGTGG + Intergenic
910338446 1:86158261-86158283 GACAATTGGGCTGGGTGTGGTGG + Intergenic
910921824 1:92356720-92356742 GGAAAATGGGCCAGGTGTGGTGG - Intronic
911060113 1:93740311-93740333 GTCAAAGGGGCATGCTGTGGAGG + Intronic
911138607 1:94471268-94471290 GAATAAGGGGCTGGGTGTGGTGG + Intronic
911151083 1:94597227-94597249 GCCAAGAGGGCCTGGTGTGGTGG - Intergenic
911173370 1:94794310-94794332 AGAAAATGGGCTGGGTGTGGTGG - Intergenic
911180607 1:94857016-94857038 GGCAAGTAGGCTGGGTGTGGTGG - Intronic
911336427 1:96585989-96586011 TGTAAAGGGGCTGGGTGCGGTGG - Intergenic
911706268 1:101016732-101016754 AGCCAAGAGGCTGGGTGTGGTGG - Intronic
912047413 1:105476461-105476483 GCAAAAGGGGCTGGGTGTGGTGG - Intergenic
912182322 1:107234408-107234430 TGAAAAGGGGCTGGGTTTGGTGG - Intronic
912539108 1:110398986-110399008 GACTAAGGGGCTGGGTGCGGTGG + Intergenic
912779416 1:112530700-112530722 GGCACAGAGGCTGGGTGCGGTGG - Intronic
912817114 1:112838161-112838183 GGGAAAGGGGCTGGATGTTGAGG - Intergenic
913487928 1:119350848-119350870 GGCAGAGTGGCTAGTTGTGGTGG + Intergenic
913677045 1:121150680-121150702 GGCACATGGACTTGGGGTGGGGG - Intergenic
913688618 1:121257399-121257421 GGCAATGGGGCCTGGCATGGTGG - Intronic
914148981 1:145022877-145022899 GGCAATGGGGCCTGGCATGGTGG + Intronic
914833465 1:151188321-151188343 GACTTAGGGGCTGGGTGTGGTGG - Intronic
915063920 1:153209231-153209253 GGCAAAGGGGTCTGTGGTGGAGG - Intergenic
915081980 1:153358804-153358826 GGCAATGGGGCTGGGTGGGGTGG + Intronic
915128472 1:153681334-153681356 GGCAGAGGGTCATGGAGTGGGGG - Intronic
915129951 1:153689125-153689147 GGGACAGGGGCTTTGTGTTGGGG - Intronic
915495922 1:156282608-156282630 GGTAAAGCCGCTTAGTGTGGAGG + Exonic
915538970 1:156555511-156555533 AGGAAGGGGGCTGGGTGTGGGGG - Intronic
915843424 1:159236916-159236938 GGTAAAGGGGCTGGGTGCGGTGG + Intergenic
915931151 1:160061749-160061771 GGGAAAGGGGGGTGGGGTGGAGG + Intronic
915956895 1:160228214-160228236 TGTCAAGGGGCTTGGTGTGGTGG - Intronic
916128460 1:161591514-161591536 AGCAAAGAGGAGTGGTGTGGAGG + Intronic
916138376 1:161673345-161673367 AGCAAAGAGGAGTGGTGTGGAGG + Intronic
916306134 1:163335237-163335259 GGCATAGTGGCTGGGTGTGGTGG - Intronic
916914206 1:169388695-169388717 AGCAAAGGGGCTGGGCATGGTGG + Intronic
916972633 1:170041108-170041130 GCAAAAAGGGCTGGGTGTGGTGG - Intronic
917349806 1:174065063-174065085 TACAAATGGGCTGGGTGTGGTGG + Intergenic
918053361 1:180995113-180995135 GGAAAATGAGCTGGGTGTGGTGG - Intronic
918306873 1:183254722-183254744 GGCAAAGGGGCACAGTGTGATGG - Intronic
918466818 1:184829085-184829107 TTCACAGGGGCTGGGTGTGGTGG - Intronic
918952667 1:191160143-191160165 GGCAAATGGGCTTGGTGCGGTGG + Intergenic
919644629 1:200082091-200082113 GGCATTTGGGGTTGGTGTGGAGG - Intronic
919737337 1:200960929-200960951 GGCAGAAGGGCCTGGTGTGTGGG + Intergenic
919868257 1:201800286-201800308 AATAAAGGGGCTGGGTGTGGTGG - Intronic
919958634 1:202443197-202443219 GGCAAAGGTGCCTGGTTTGCTGG - Intronic
920218009 1:204375197-204375219 GGAAAAGGGTCATCGTGTGGGGG - Intronic
920223765 1:204423629-204423651 AGGAAAGGGGCATGGGGTGGGGG - Exonic
920426198 1:205877871-205877893 GTAAAAAGGGCTGGGTGTGGTGG - Intergenic
920464344 1:206169197-206169219 GGCACATGGACTTGGGGTGGGGG - Intergenic
920475942 1:206275900-206275922 GGCAATGGGGCCTGGCATGGTGG - Intronic
920633558 1:207676941-207676963 GCCAAGGGAGCTGGGTGTGGTGG - Intronic
920725066 1:208427301-208427323 GGGAAATTGGCTGGGTGTGGTGG + Intergenic
920787009 1:209051323-209051345 GCCCAGAGGGCTTGGTGTGGGGG + Intergenic
921000436 1:211038246-211038268 GGAGAAGTGGCTGGGTGTGGTGG - Intronic
921028007 1:211307199-211307221 TTTAAAGGGGCTGGGTGTGGTGG + Intronic
921268853 1:213449215-213449237 GGTACTGGGGCTTGGTGGGGCGG - Intergenic
921397965 1:214689068-214689090 GGGAAAGGGGGAGGGTGTGGAGG - Intergenic
921726802 1:218533282-218533304 GGAAAGGGGGCTGGGCGTGGTGG - Intergenic
921897632 1:220416858-220416880 GGCACAGAGGCTGGGTGTGGTGG - Intergenic
922114671 1:222601116-222601138 GGCAGACAGGCTGGGTGTGGTGG - Intergenic
922115751 1:222612017-222612039 GGCAAAGGGGCCGGGTGCGGTGG - Intergenic
922501100 1:226097519-226097541 GGTAAGGGGGCTGGGCGTGGTGG + Intergenic
922507914 1:226137180-226137202 GGCAAAAGGGCCAGGTGCGGTGG + Intergenic
922561339 1:226571926-226571948 GGAAAAGGGGCCGGGTGTGGTGG - Intronic
923081757 1:230663897-230663919 GGGAAAGAGGCCAGGTGTGGTGG + Intronic
923432190 1:233933575-233933597 GGGAACTGGGCTGGGTGTGGTGG + Intronic
923605159 1:235436829-235436851 GTAAAAGGGGCCGGGTGTGGTGG + Intronic
923703514 1:236322892-236322914 GGAAGAGTGGCTGGGTGTGGTGG + Intergenic
924231011 1:241961695-241961717 GGAAAATGGGCTGGGCGTGGTGG + Intergenic
924266415 1:242286601-242286623 GACAAAGGGGATGTGTGTGGGGG - Intronic
924307396 1:242704417-242704439 AAGAAAGGGGCTGGGTGTGGTGG + Intergenic
924466855 1:244305891-244305913 GGCAAAGGGGCAAGCTGTGCCGG - Intergenic
924519530 1:244794231-244794253 GGGGAAGGGGTTGGGTGTGGAGG - Intergenic
924761738 1:246993884-246993906 GCTAAAGGGGCTGGGTGCGGTGG + Intronic
1063187337 10:3663388-3663410 AGAAAAGAGGCTGGGTGTGGTGG - Intergenic
1063448683 10:6136606-6136628 GGCAAGGGAGCCTGGGGTGGTGG + Intergenic
1063905651 10:10777724-10777746 GGCAAAGGGGGCTAGTGTAGAGG - Intergenic
1064049747 10:12049737-12049759 TGCAAAGAGGCCGGGTGTGGTGG + Intergenic
1064121841 10:12625616-12625638 GGCAGAGGGGCGGGGCGTGGGGG - Intronic
1064205784 10:13322431-13322453 AGAAAAGGGGCCAGGTGTGGTGG - Intronic
1064279135 10:13935149-13935171 AACAAATGGGCTGGGTGTGGTGG + Intronic
1064365581 10:14704734-14704756 GGCAAAAGGGCCAGGTGTGGTGG + Intronic
1064704071 10:18052533-18052555 TTGAAAGGGGCTGGGTGTGGTGG + Intergenic
1064801113 10:19073200-19073222 GGTTAAGAGGCCTGGTGTGGTGG - Intronic
1064864950 10:19869107-19869129 TGAAAAGGGGCTTTGTGCGGTGG + Intronic
1065143002 10:22737971-22737993 TGCAAAGTGGCCAGGTGTGGTGG + Intergenic
1065575751 10:27116379-27116401 AGCAAAGAGGCTGGGTGCGGTGG + Intronic
1065619928 10:27570550-27570572 GACAGAAGGGCTGGGTGTGGTGG + Intergenic
1066356805 10:34692585-34692607 GGCAAAGAGGCCAGGCGTGGTGG + Intronic
1066372895 10:34832260-34832282 GACAAGGTGGCTGGGTGTGGTGG + Intergenic
1066718415 10:38311954-38311976 GACAAAGGGGATGTGTGTGGGGG + Intergenic
1067170006 10:43898651-43898673 GGCAAAGGGGGTGGAGGTGGTGG - Intergenic
1067271923 10:44799203-44799225 AGCAAAGAGGCTGGGTGTGGTGG + Intergenic
1067440478 10:46306632-46306654 TGCACAGGGCCTGGGTGTGGCGG + Intronic
1067481676 10:46603909-46603931 GGGAAAGGGGGTGGGTATGGAGG + Intergenic
1067539625 10:47142208-47142230 GACAGAGGGACTTGGTGGGGAGG - Intergenic
1067613075 10:47737818-47737840 GGGAAAGGGGGTGGGTATGGAGG - Intergenic
1067792656 10:49299617-49299639 GGCTAAGGTTCTTGGTGTGCTGG + Intronic
1068026666 10:51653853-51653875 GGCAAAGAGGCCAGCTGTGGTGG - Intronic
1068461800 10:57338983-57339005 CAAAAAGGGGCGTGGTGTGGGGG + Intergenic
1068750719 10:60588631-60588653 TACAAAGGGGCTGGGTGAGGTGG + Intronic
1069314193 10:67077412-67077434 GGCAAAGGGACTGGGTCAGGTGG - Intronic
1069554380 10:69387669-69387691 TGGAAAGTGGCTTGGTGTGGTGG - Intronic
1070628632 10:78068627-78068649 GCCAGAAGGGCTGGGTGTGGTGG - Intergenic
1070665707 10:78342012-78342034 GGTAAAGGGGCTGAATGTGGAGG + Intergenic
1071184569 10:83026654-83026676 TGCAATGAGGCTGGGTGTGGTGG - Intergenic
1071278420 10:84077328-84077350 GGTCCAGGGGCTGGGTGTGGTGG + Intergenic
1071672956 10:87627694-87627716 GTAAAAGTGGCTGGGTGTGGTGG + Intergenic
1071902811 10:90139304-90139326 TGAAAAGGGGCATTGTGTGGGGG - Intergenic
1072162395 10:92780806-92780828 GAAAAAGTAGCTTGGTGTGGTGG + Intergenic
1072214422 10:93276223-93276245 AGAAAATGGGCTGGGTGTGGTGG - Intergenic
1072236961 10:93461714-93461736 GGCAAACGGGCTTTGTGGGAAGG + Intronic
1072328816 10:94325309-94325331 GGGAAAGAGGCTGGGCGTGGTGG + Intronic
1072453029 10:95554339-95554361 GACAAATAGGCTGGGTGTGGTGG - Intronic
1072476448 10:95765007-95765029 GGCAAAGAGGCCAGGCGTGGTGG - Intronic
1072619182 10:97068420-97068442 GACAGAGGGGCTGGGTTTGGGGG - Intronic
1072765952 10:98095390-98095412 GGCAGTGGGGGCTGGTGTGGAGG + Intergenic
1072977055 10:100067864-100067886 GGAAAAGGGGCCAGGTGTGGTGG + Intronic
1072996756 10:100251796-100251818 GCCAATAGGGCTGGGTGTGGTGG - Intronic
1073200439 10:101730970-101730992 GGCAAAGGGGCTGGGCATGGTGG - Intergenic
1073217892 10:101846672-101846694 GGAAAACTGGCTGGGTGTGGTGG + Exonic
1073369146 10:102970901-102970923 GTCTCTGGGGCTTGGTGTGGTGG + Intronic
1074009223 10:109459343-109459365 GATAAAGAGGCTGGGTGTGGTGG - Intergenic
1074509784 10:114101526-114101548 TGCAGAGGGGCTGGGTGAGGAGG + Intergenic
1074749322 10:116568655-116568677 GGCAAAATGTCTGGGTGTGGTGG - Intergenic
1074794651 10:116930298-116930320 GTCACAGGGGCTTGGTGTACAGG + Intronic
1075001600 10:118802665-118802687 GGGAAAAGGGCGTGGTGGGGTGG + Intergenic
1075320655 10:121489359-121489381 AACAGAGGGGCTGGGTGTGGTGG - Intronic
1075377858 10:121993921-121993943 AAGAAAGGGGCTGGGTGTGGTGG - Intronic
1075633425 10:124015085-124015107 GGCAAGGGGGCTGGGGGTTGGGG - Intronic
1075720415 10:124582715-124582737 GCATAAGGGGCTGGGTGTGGTGG + Intronic
1075722383 10:124594916-124594938 AGCAAAGGGGCTGGGTGCGGTGG - Intronic
1076115004 10:127889167-127889189 AGAAAAGTGGCTGGGTGTGGTGG + Intronic
1076267278 10:129118569-129118591 GGCACAGGGGCTAGGTTAGGAGG + Intergenic
1076607915 10:131701422-131701444 GGAAGAGGGGCTTGGAGAGGAGG - Intergenic
1076638137 10:131896265-131896287 GGCACAGGGGCTGGGCGTGGTGG - Intergenic
1076874175 10:133207897-133207919 GGCCAAGGGGGCTGGTGGGGCGG - Intronic
1077095058 11:795726-795748 GGGCAAGGGGCTGGCTGTGGGGG - Intronic
1077454653 11:2671257-2671279 GGCTAAGGGGCTGGGGATGGTGG - Intronic
1077454843 11:2672312-2672334 CTCAAGGGGGCCTGGTGTGGTGG + Intronic
1077473312 11:2774936-2774958 AGCCAAGCGGCTTGGTGGGGAGG - Intronic
1077494492 11:2880310-2880332 TACAAAGGTGGTTGGTGTGGGGG - Intergenic
1077599589 11:3564933-3564955 GGCAAAGTGGCTGGGCATGGTGG - Intergenic
1077885812 11:6386932-6386954 GGCAAAGTGGCCGGGTGCGGTGG + Intergenic
1078180763 11:9008104-9008126 GCCAAAGGGGGTTGGGGTAGTGG - Intergenic
1078282677 11:9918656-9918678 GGCAAAGGGGCCAGGCGTAGTGG - Intronic
1078539746 11:12204005-12204027 GGTAAAGGGACTTGGCGAGGAGG - Intronic
1079151802 11:17906474-17906496 TGCAAAGGGGGTTGGTGGGGTGG + Intronic
1079180137 11:18185549-18185571 AGCAAAGGGGCCAGGTGCGGTGG - Intronic
1079504069 11:21133723-21133745 GGGGATGGGGCTTGGTGGGGGGG + Intronic
1079779688 11:24585038-24585060 GGGATAGGGCCTGGGTGTGGAGG + Intronic
1079795629 11:24799308-24799330 TTCAAAGGGGCCGGGTGTGGTGG + Intronic
1079805435 11:24924363-24924385 GGCAAGCGGGCTGGGTGCGGTGG - Intronic
1079918952 11:26407816-26407838 GGCAAAGGGGAGTGGGGTAGGGG - Intronic
1080357634 11:31470125-31470147 GGCAAATGGGCTGGGTGCAGTGG + Intronic
1080687510 11:34527466-34527488 GGAAAAGGGGCTGGCTGTGGTGG + Intergenic
1081026265 11:38019099-38019121 GCCAAAAGAGTTTGGTGTGGGGG + Intergenic
1081567704 11:44270122-44270144 GGCAAAGGGGTCTAGAGTGGAGG + Intronic
1081641198 11:44755598-44755620 TACATAGGGGGTTGGTGTGGGGG - Intronic
1081721748 11:45294542-45294564 TGCAAAGGGGCTGTGTGTGAAGG - Intergenic
1081935509 11:46901081-46901103 GACAAGGGGGCTGGGTGTGGTGG - Intronic
1082012351 11:47458687-47458709 GCCAAAGGGGCCGGGTGTGGTGG - Intergenic
1082688261 11:56267326-56267348 GGCAAAGGGGCTAGGTGCAGTGG + Intergenic
1082910205 11:58363953-58363975 TGCATAGGGGCCTGTTGTGGGGG + Intergenic
1083162253 11:60861871-60861893 GGCCAAGTGGCCAGGTGTGGAGG + Intergenic
1083251034 11:61467291-61467313 AGAAAAGGGGTTTGGTGTGCTGG + Intronic
1083443894 11:62694490-62694512 GGGTAGGGGGCTGGGTGTGGTGG - Intronic
1083589025 11:63881656-63881678 ATCAATGGGGCTGGGTGTGGTGG + Intronic
1083679751 11:64345717-64345739 CGCTCAGGGGCTGGGTGTGGTGG + Intronic
1084078117 11:66798310-66798332 GGTGAAGGGGCTGGGTGTGGTGG + Intronic
1084187748 11:67483825-67483847 GGCAGAGGGGCTGGATCTGGGGG - Intronic
1084201421 11:67561072-67561094 GGTAAAGGGGCTGGGTATGGTGG + Intergenic
1085047968 11:73364255-73364277 GGGACAGGGGCAGGGTGTGGGGG - Intronic
1085170933 11:74449318-74449340 GGCACGGGGGCTTGGTGCTGGGG + Intergenic
1085660061 11:78355876-78355898 GACACAGTGGCTGGGTGTGGTGG + Intronic
1085807715 11:79651490-79651512 GACAAAGAAGCTGGGTGTGGTGG - Intergenic
1086074855 11:82839723-82839745 GGGGAAGGAGCCTGGTGTGGTGG - Intronic
1086344007 11:85876790-85876812 AGAAAAGAGGCTGGGTGTGGTGG - Intronic
1086724032 11:90159662-90159684 GGTGAAGGTGCTGGGTGTGGTGG + Intronic
1086966494 11:93033189-93033211 GGCAATGGGGCATGGAGTTGGGG + Intergenic
1087207469 11:95412119-95412141 GGCAAGGGGGCTGGGGCTGGAGG - Intergenic
1087393172 11:97565225-97565247 GCGAAATGGGCTTGGTGCGGTGG - Intergenic
1088039502 11:105360942-105360964 GGCTATGGAGCTTGGTCTGGAGG + Intergenic
1088279824 11:108124563-108124585 GGGAAGGGGGCCAGGTGTGGTGG - Intronic
1088485390 11:110335435-110335457 GAAAAAAGGGCTTGGCGTGGTGG + Intergenic
1088497749 11:110448416-110448438 GGGAAAGGGGTTAGGTGTCGGGG + Intronic
1088618904 11:111662459-111662481 GGTAAAGGGGCCAGGTGCGGTGG + Intronic
1088860265 11:113792213-113792235 GGAAAAAGGGCTGGGTGCGGTGG + Intergenic
1089143602 11:116308095-116308117 ATCAAAGGGGCCGGGTGTGGTGG + Intergenic
1089495489 11:118906807-118906829 GCCAGAGAGGCTGGGTGTGGTGG - Intronic
1089600296 11:119610238-119610260 AGCAATTGGGCTGGGTGTGGTGG - Intergenic
1089729879 11:120512849-120512871 GGCTGAGGGCCTTGGGGTGGTGG + Intronic
1089743508 11:120601116-120601138 GGTCCAGGGGCTGGGTGTGGTGG + Intronic
1090715461 11:129426662-129426684 GGCAGCGGGGCCAGGTGTGGTGG - Intronic
1090804730 11:130195867-130195889 AGAAAAGAGGCTGGGTGTGGTGG + Intronic
1091069287 11:132548191-132548213 GGCATAGGAGCTTGGTGGGCAGG + Intronic
1091131930 11:133153673-133153695 GAAAAAGGTGCCTGGTGTGGAGG - Intronic
1091432290 12:446668-446690 GGCAAGGGGGCCAGGTGTAGTGG + Intergenic
1091609248 12:1989425-1989447 AGGAAAGGGGCTGGGCGTGGTGG + Intronic
1091759899 12:3080074-3080096 AGGAAAGGGGCTGGGCGTGGTGG - Intronic
1091844506 12:3645495-3645517 AGCCAAGGGGCTGGGGGTGGTGG + Intronic
1092390095 12:8069442-8069464 AGCAATGTGGCTGGGTGTGGTGG + Intergenic
1092486275 12:8904965-8904987 AACAAAGGGGCTTGGTGTAATGG - Intergenic
1092916323 12:13192728-13192750 AGAAAATGGGCTGGGTGTGGTGG + Intergenic
1093193811 12:16106421-16106443 GACAAAGAGGCTGGGTGCGGTGG - Intergenic
1093405717 12:18801659-18801681 GCAATAGGGGCTTGGTGTGGTGG - Intergenic
1094036662 12:26079295-26079317 GTCAAAGGGGCTGGGCATGGTGG + Intronic
1094131826 12:27082862-27082884 GGGAATGGGGCCGGGTGTGGTGG - Intergenic
1094181243 12:27594463-27594485 GGGAATGGGGCTGGGCGTGGTGG - Intronic
1094192650 12:27712727-27712749 TGCCAAGGGGCTGAGTGTGGGGG + Intronic
1094708384 12:32936908-32936930 GGCCATGGATCTTGGTGTGGTGG + Intergenic
1095246539 12:39929841-39929863 GGCACTTGGGCTGGGTGTGGTGG + Intronic
1095406188 12:41869872-41869894 GACAAAGGGGCTGGGTGCAGTGG + Intergenic
1095750367 12:45703967-45703989 AGGAAAGAGGCCTGGTGTGGTGG - Intergenic
1096002831 12:48143793-48143815 TGAAAAGGGGCTTGGTGTTAAGG + Exonic
1096068536 12:48760463-48760485 GGTAAATGGGCTGGGTGTGGTGG - Intergenic
1096267311 12:50134091-50134113 GTAAAACAGGCTTGGTGTGGTGG + Intronic
1096423356 12:51479397-51479419 GACAAAGGGGCTGTGTGCGGTGG + Intronic
1096433935 12:51572175-51572197 GGCAGAAAGGCTGGGTGTGGTGG - Intergenic
1097026378 12:56058793-56058815 GGCTGGGGGGCTGGGTGTGGTGG + Intergenic
1097133266 12:56829870-56829892 GGCAAAGGGGCTGGGCATGGTGG + Intergenic
1097218300 12:57430900-57430922 GGGAAAGGGGCTTGGGAAGGAGG + Exonic
1097413809 12:59289191-59289213 GTCACAGGGCCTTGGTGTGCAGG + Intergenic
1098243209 12:68488753-68488775 GGGAAAGGGGTTGGGTGGGGGGG + Intergenic
1098282349 12:68874326-68874348 TGAAAAGGGGCTGGGCGTGGAGG + Intronic
1098363144 12:69675048-69675070 GGCAAACCTGCTGGGTGTGGTGG - Intronic
1099951732 12:89311309-89311331 AACAAAGGGGCTGGGTGTGGTGG - Intergenic
1100462194 12:94810861-94810883 GGCAAAGGGGCTAGGCGCAGGGG + Intergenic
1100482291 12:94990716-94990738 CTCACTGGGGCTTGGTGTGGTGG - Intronic
1100555209 12:95686469-95686491 GGGCAAGGGGCTGGGCGTGGTGG + Intronic
1100604851 12:96143228-96143250 GGAAATTGGGCTGGGTGTGGTGG + Intergenic
1100678939 12:96898005-96898027 GGCAAAGGGCCTGGGGGCGGGGG + Intergenic
1100736984 12:97546292-97546314 AGGAAATGGGCTGGGTGTGGTGG + Intergenic
1100859056 12:98785180-98785202 GGCAAAGAGGCTAGGCATGGTGG + Intronic
1100915484 12:99415968-99415990 GGCAATGGGGCCTGGCGCGGTGG - Intronic
1102311356 12:111847052-111847074 GGATAAGGGGCTGGGCGTGGTGG + Intronic
1102518371 12:113464867-113464889 GGAAAAGGGGCTATGTGGGGCGG - Intronic
1102653886 12:114463618-114463640 GGCAACTGAGCTTGGTGTGCAGG - Intergenic
1102691501 12:114764933-114764955 GAAAATGGGGCTGGGTGTGGTGG + Intergenic
1102959325 12:117081934-117081956 GGGAAATGGGCCAGGTGTGGTGG + Intronic
1103247007 12:119466552-119466574 GGCAGAAGGGAATGGTGTGGTGG - Intronic
1103352865 12:120297279-120297301 AATAATGGGGCTTGGTGTGGTGG + Intergenic
1103408877 12:120696439-120696461 GGCATAGGGGTTGGGTGTGCGGG - Exonic
1103455546 12:121062533-121062555 TGAAAAGAGGCTGGGTGTGGAGG - Intergenic
1103574695 12:121868806-121868828 GGCAAAGGGGCCGGGCATGGTGG - Intergenic
1103717503 12:122953807-122953829 GGGTAAGTGGCTGGGTGTGGTGG - Intronic
1103784822 12:123424616-123424638 TGGGAAGGGGCTGGGTGTGGTGG - Intronic
1103813758 12:123636628-123636650 AGCCAAGTGGCTGGGTGTGGTGG + Intronic
1103815114 12:123648939-123648961 GGGATGGGGGCTGGGTGTGGTGG - Intronic
1103891814 12:124244888-124244910 GGCAAAAGGGCTGGGTGTGGCGG - Intronic
1104176978 12:126342532-126342554 GAAAAAGAGGCTGGGTGTGGTGG + Intergenic
1104252160 12:127105347-127105369 GTGAAATGGGCTAGGTGTGGTGG - Intergenic
1104588527 12:130066372-130066394 GGAACAGAGGCTGGGTGTGGTGG + Intergenic
1104939557 12:132388512-132388534 GGCAGAGAGGCCTGGAGTGGGGG + Intergenic
1105067470 12:133213394-133213416 TGAAAAGGAGCTGGGTGTGGTGG + Intergenic
1105678629 13:22703122-22703144 AGCACCAGGGCTTGGTGTGGGGG - Intergenic
1105825032 13:24114947-24114969 AGCCAAGGGGCTGGGTGTAGTGG - Intronic
1105857480 13:24386012-24386034 GGGAGAGGGGCTTGGAGGGGAGG - Intergenic
1106017785 13:25885398-25885420 AGCAAGCGGGCTTGGTGCGGTGG - Intronic
1106179271 13:27357159-27357181 TGAAAGGGGGCTGGGTGTGGTGG - Intergenic
1106456357 13:29930694-29930716 GCCAAAGGGGCTGGGTGTGGTGG - Intergenic
1106461566 13:29974761-29974783 GTCAAATGGGTTGGGTGTGGTGG + Intergenic
1106516103 13:30455315-30455337 GGAAATGGGGCTTGGGGTGTAGG + Intergenic
1106593890 13:31120975-31120997 GGAAAAATGGCTGGGTGTGGTGG - Intergenic
1107010535 13:35665913-35665935 TCCAAAGAGGCTGGGTGTGGTGG - Intronic
1107210915 13:37852856-37852878 GGCAAAGGAGCTTCATCTGGTGG - Intronic
1107306826 13:39030712-39030734 TGATAAGGGGCTTGGGGTGGTGG - Intronic
1107785578 13:43953591-43953613 GGCAAAGAGGGTTGTGGTGGGGG + Intergenic
1108046813 13:46391223-46391245 AGCAAAAAGGCTGGGTGTGGTGG - Intronic
1108074747 13:46668141-46668163 GAAAAAGGGGCTTTTTGTGGGGG + Intronic
1108280587 13:48857192-48857214 ACAAAAGGGGCTGGGTGTGGTGG + Intergenic
1108405037 13:50092383-50092405 GGGAAAGGGGCTGGGTGCAGTGG + Intronic
1110107235 13:71692806-71692828 GGTGAACGGGCTGGGTGTGGTGG - Intronic
1110200246 13:72841481-72841503 GGCTAATAGGCTAGGTGTGGTGG + Intronic
1110571623 13:77011050-77011072 GGCAAAGGGGCTGGGTGCAGTGG + Intronic
1110727367 13:78840544-78840566 AGTAAGGGGGCTGGGTGTGGTGG - Intergenic
1111813265 13:93118915-93118937 GGAGAAGAGGCTGGGTGTGGTGG + Intergenic
1112089727 13:96069967-96069989 TGTAATGGGGCTGGGTGTGGTGG + Intergenic
1112445436 13:99460136-99460158 GTAAATGGGGCTGGGTGTGGTGG - Intergenic
1112522941 13:100114288-100114310 GGCAAAATGGCCAGGTGTGGTGG + Intronic
1112530833 13:100201569-100201591 GGCAGTGAGGCTAGGTGTGGTGG + Intronic
1112548080 13:100391257-100391279 GGAACAGAGGCTGGGTGTGGTGG - Intronic
1112698831 13:101980952-101980974 GCCCCAGGGGCTGGGTGTGGTGG + Intronic
1112783877 13:102930423-102930445 GGAAAAGGGGCTGGGCGCGGTGG - Intergenic
1113411665 13:110095488-110095510 AGAAAAGGGGCTGGGTGTGGTGG + Intergenic
1113443776 13:110350048-110350070 GGAAATTGGGCTGGGTGTGGTGG - Intronic
1114275807 14:21143002-21143024 GGCAAGAGGGCTGGGTGTGGTGG - Intergenic
1114310445 14:21461855-21461877 AGCACAGGGGCCAGGTGTGGCGG - Intronic
1114554752 14:23555685-23555707 GGCGAGGGGGGTTGGGGTGGGGG - Intronic
1115189222 14:30729045-30729067 GACAAAGGGGCCAGGCGTGGTGG - Intronic
1115213534 14:30992120-30992142 GGCAAAGGGGCCGGGTGCAGTGG + Intronic
1115463162 14:33684583-33684605 AGCAAAGAGGCTGGGTGTGGCGG - Intronic
1115574603 14:34698505-34698527 GATACAGGGGCTGGGTGTGGCGG + Intergenic
1115760185 14:36572869-36572891 GGCAAAAGGGCTGGGTGCAGTGG - Intergenic
1117129712 14:52673375-52673397 GGCAAAATGGCTAGATGTGGTGG - Intronic
1117445307 14:55798601-55798623 GGCAAAGGTGTTTGGTGAGTTGG + Intergenic
1117711212 14:58531021-58531043 GGCAAAGGGGCCGGGTGCAGTGG + Intronic
1118211013 14:63765642-63765664 GACATATGGGCTGGGTGTGGTGG - Intergenic
1118309077 14:64679520-64679542 AACAAAGTGGCTGGGTGTGGTGG - Intergenic
1118782310 14:69017052-69017074 TGCAAAGGGGCCGGGTATGGTGG - Intergenic
1118795245 14:69137702-69137724 GGCAAAGGGGCTTACTGTACTGG - Intronic
1118818480 14:69329068-69329090 GGCAAAGGGGCCTGGAGCGGTGG + Intronic
1118906840 14:70029456-70029478 GGAAAAGGGACTTTGTGTGAAGG + Intronic
1119091102 14:71782041-71782063 AGCAACGGGGCCTGGTGCGGTGG + Intergenic
1119219932 14:72898396-72898418 GGGATGGGGGCTGGGTGTGGTGG - Intergenic
1119295742 14:73531695-73531717 GACCAAGAGGCTGGGTGTGGTGG - Intronic
1119299385 14:73559405-73559427 GACCAAGAGGCTAGGTGTGGTGG - Intergenic
1119353821 14:73989107-73989129 AGCAAAGTGGCTGGGCGTGGTGG - Intronic
1119447677 14:74679887-74679909 GGCAAAAGGGCCAGGTGTGGTGG + Intronic
1119512298 14:75221069-75221091 TGCAAAGTGGCCGGGTGTGGTGG + Intergenic
1119662037 14:76459130-76459152 GATAGAGGGGCTGGGTGTGGTGG - Intronic
1120191602 14:81445091-81445113 GCAAAAGGGGCCAGGTGTGGTGG + Intergenic
1120193326 14:81459192-81459214 GGAAACGGGGCCGGGTGTGGTGG - Intergenic
1120424518 14:84330139-84330161 GGCAAGGAGGCCAGGTGTGGTGG + Intergenic
1120987047 14:90343691-90343713 GGTAGTGGGGGTTGGTGTGGGGG + Intergenic
1121149376 14:91617030-91617052 GGAATATGGGCTGGGTGTGGTGG - Intronic
1121201059 14:92118683-92118705 GGTAAAGGGGCCGGGTGTAGTGG + Intronic
1121344150 14:93122811-93122833 GACACAGTGGCTGGGTGTGGTGG + Intergenic
1121432930 14:93900186-93900208 GGCATATGGGCTGGGAGTGGGGG + Intergenic
1122329733 14:100904256-100904278 GGCAAACGTGATTGGGGTGGTGG - Intergenic
1122564278 14:102640964-102640986 AGAAAAGAGGCTGGGTGTGGTGG + Intronic
1122982390 14:105197542-105197564 GGCAAGGGGACATGGGGTGGGGG + Intergenic
1123803372 15:23845370-23845392 GGCAAAACGGCTGGGCGTGGTGG + Intergenic
1124058859 15:26268608-26268630 CGCGAAGTGGCTGGGTGTGGTGG - Intergenic
1124087657 15:26566436-26566458 AGAAAAAGGGCTGGGTGTGGTGG + Intronic
1124159577 15:27256153-27256175 GACAGAGGGGCCGGGTGTGGTGG + Intronic
1124163287 15:27294501-27294523 GGAAAAGAGGCCAGGTGTGGTGG - Intronic
1124449486 15:29773053-29773075 GGGAAACTGGCTAGGTGTGGTGG - Intronic
1124583716 15:30986027-30986049 TGGAAGGGGGCTGGGTGTGGTGG + Intronic
1124937752 15:34188266-34188288 CGCAAATGAGCTGGGTGTGGTGG + Intronic
1125268580 15:37913234-37913256 GAAAAAGGGTCTTGGTGTTGTGG + Intergenic
1125366926 15:38927290-38927312 GGCAAAGGGGCTGGGTGTGGTGG - Intergenic
1125466285 15:39956289-39956311 GGGAATGAGGCTGGGTGTGGTGG - Intronic
1125777137 15:42226285-42226307 GACACAGGGGCTGGGCGTGGTGG - Intronic
1125815036 15:42576573-42576595 GGAAAGGGTGGTTGGTGTGGAGG + Intronic
1125829386 15:42703080-42703102 AGCAAATAGGCTAGGTGTGGTGG - Intronic
1125999584 15:44195875-44195897 GGCAAAGGGTGTTAGAGTGGAGG - Intergenic
1126001773 15:44217503-44217525 GACACAGTGGCTGGGTGTGGTGG + Intergenic
1126039858 15:44579235-44579257 GGAAGAGGGGCTGGGCGTGGTGG + Intronic
1126487930 15:49203336-49203358 GGCAAATGGTCTCGGTGTGGTGG - Intronic
1126574579 15:50184278-50184300 AGGAAAGAGGCTGGGTGTGGTGG - Intronic
1126816182 15:52457152-52457174 GGCAAAGGGGCTTGGTGTGGTGG + Intronic
1127279832 15:57479374-57479396 GGCAAAGGGGCTGGGCATGGTGG + Intronic
1127604964 15:60577354-60577376 TGCAAAGAGGCCTGGTGTGGTGG + Intronic
1127731552 15:61806930-61806952 ATCCAAGGGGCTTGGGGTGGGGG - Intergenic
1128033751 15:64504766-64504788 AGCAAATAGGCTGGGTGTGGTGG - Intronic
1128179314 15:65587691-65587713 GGGAAAAGGGCTGAGTGTGGTGG + Intronic
1128183948 15:65628244-65628266 GCTAAAGGGGCCAGGTGTGGTGG - Intronic
1128263630 15:66250618-66250640 GGCAAAAGGGCTGGGTGCGGTGG + Intronic
1128394330 15:67208645-67208667 GGCAAATGGGGTTGCTGTTGAGG + Exonic
1128552316 15:68606272-68606294 GGCAAAGGGAGTTAGGGTGGTGG + Intronic
1128683050 15:69665479-69665501 GGAAAATGGGCTTGGAGAGGAGG - Intergenic
1128767149 15:70258212-70258234 GGCCAAGGGACATGGCGTGGTGG - Intergenic
1128884265 15:71272113-71272135 GGCAAAGGGGCTGGGTGTGGTGG + Intronic
1129205756 15:74036175-74036197 GGCAAAGAGGCCTGGAATGGTGG - Intronic
1129965698 15:79733514-79733536 GGCACAGGGGTTTGTTGTGCAGG - Intergenic
1130139123 15:81208780-81208802 GGCACAGGGGTTAGGTGTGTGGG + Intronic
1130141348 15:81228780-81228802 GGCACAGGGGTTAGGTGTGTGGG + Intronic
1130256368 15:82327850-82327872 GGCAAAGGGGCTATGGGAGGAGG - Intergenic
1130679224 15:85981650-85981672 GCCCAAGTGGCTGGGTGTGGTGG - Intergenic
1130738679 15:86575209-86575231 TGCACATGGGCTGGGTGTGGTGG + Intronic
1131045888 15:89315094-89315116 AGCAAAGAGGCTGAGTGTGGTGG - Intronic
1131079027 15:89518860-89518882 GGCAATGGGGCTGGGCATGGTGG + Intergenic
1131148996 15:90035201-90035223 GGCCCTGGGGCATGGTGTGGGGG + Intronic
1131704533 15:94978787-94978809 GGCAAATGGGCTGGGCCTGGTGG + Intergenic
1132042185 15:98534851-98534873 GCCAGAAGGGCTGGGTGTGGTGG + Intergenic
1132048921 15:98590955-98590977 AGCACAGTGGCTGGGTGTGGTGG - Intergenic
1132324943 15:100961175-100961197 GGCAAAGGGCCTGAGTGTGCTGG + Intronic
1132801314 16:1755559-1755581 GGAAAAGGGGCCGGGTGCGGTGG + Intronic
1132980350 16:2735886-2735908 GGCAAACGGGCTGGGTGCAGTGG - Intergenic
1133006761 16:2886493-2886515 GACAAAGGGGCAGGGCGTGGTGG - Intronic
1133044081 16:3076521-3076543 GGGGAAGGAGCTGGGTGTGGTGG - Intronic
1133117387 16:3585297-3585319 GGCAAAGGGGCCGGGCGCGGTGG + Intronic
1133328259 16:4955648-4955670 GGCAACTGGGCCAGGTGTGGTGG + Intronic
1133419468 16:5633584-5633606 GGGTAAAGGGCTGGGTGTGGTGG + Intergenic
1133472833 16:6092132-6092154 GGTACATGGGCTTGGTGTGAGGG + Intronic
1133573151 16:7062028-7062050 GGCAACGAGGCCGGGTGTGGTGG + Intronic
1133662844 16:7935604-7935626 AACAAAGAGGCTGGGTGTGGCGG - Intergenic
1133698360 16:8286444-8286466 GGTAAAGAGGAATGGTGTGGGGG - Intergenic
1133972379 16:10577556-10577578 AGGAATGGGGATTGGTGTGGTGG - Intronic
1133988380 16:10685582-10685604 GGAAAAGAGGCTGGGCGTGGAGG - Intronic
1134122127 16:11592286-11592308 GGCACTGGGGCTGGGTGCGGTGG + Intronic
1134143978 16:11745327-11745349 GGCCAAGAGGCTGGGCGTGGTGG - Intergenic
1134161303 16:11892054-11892076 GACAAAGTGGCCTGGTGTGATGG + Intronic
1134230332 16:12423935-12423957 GGACAAGGGGCCTGGTGTCGGGG + Intronic
1135010321 16:18871690-18871712 AGCAAAGAGGCCGGGTGTGGTGG + Intronic
1135236263 16:20759268-20759290 CCAAAAGGGGCTGGGTGTGGTGG + Intronic
1135250039 16:20893323-20893345 GGGAAAGGAGCTGGGCGTGGTGG - Intronic
1135289036 16:21218770-21218792 GGGAAAGAGGCCAGGTGTGGTGG - Intergenic
1135578058 16:23601453-23601475 GTAAAAGAGGCTGGGTGTGGAGG + Intergenic
1135909433 16:26545702-26545724 GGCAAAGGGGCTGGGCACGGTGG + Intergenic
1135963688 16:27018636-27018658 TGCAAAAGGGCTGGGTGCGGTGG + Intergenic
1136037447 16:27550560-27550582 GGGAAAGGGAATTGGTGTGGGGG + Intronic
1136131887 16:28227833-28227855 GAAAAAGTGGCTAGGTGTGGTGG - Intergenic
1136138699 16:28275037-28275059 GGAAAAGGGGCCGGGCGTGGTGG + Intergenic
1136159126 16:28406709-28406731 GGCAATCAGGCTGGGTGTGGTGG - Intergenic
1136203961 16:28708574-28708596 GGCAATCAGGCTGGGTGTGGTGG + Intronic
1136246531 16:28979333-28979355 GGCAGAAGGGCCTGGTGTGGGGG + Intronic
1136418239 16:30116466-30116488 GCCCAGGGGGCTGGGTGTGGTGG - Intronic
1137243701 16:46684011-46684033 GGTAAATGGGCTGGGTGCGGTGG - Intronic
1137253930 16:46759917-46759939 GGAAAAGGGGCTGGGCGTGGTGG - Intronic
1137278779 16:46957311-46957333 TAAAAAGGGGCTGGGTGTGGTGG + Intronic
1137349772 16:47703353-47703375 GGCAAAGGGGCCGGGTGCGGTGG + Intergenic
1137650899 16:50119455-50119477 GAGATAGGGGCTGGGTGTGGTGG + Intergenic
1137653526 16:50140592-50140614 AGCAAAGGGGGTTGTTGAGGTGG + Intergenic
1137675547 16:50302096-50302118 GGGGAAGGGGCTTGGAGGGGCGG - Intronic
1137819009 16:51425772-51425794 GGCAAAGGGGCCAGGTGCGGTGG - Intergenic
1138406454 16:56798578-56798600 GGCAAGAGGGCTGGGCGTGGTGG + Intronic
1138586196 16:57971731-57971753 GGAAGAGGGGCTCAGTGTGGTGG + Intergenic
1138855910 16:60691210-60691232 GGCAAAGGGGACAGGTGTGGTGG - Intergenic
1139229689 16:65271919-65271941 GGCAAAGCATCTTGGTGTGGTGG - Intergenic
1139366081 16:66434352-66434374 GACAAAGGAGCTGGGTGTGGGGG - Intronic
1139391856 16:66610332-66610354 AGCAGAGGGGCTGGGTTTGGGGG - Intronic
1139439942 16:66961411-66961433 TGCAGAGGTACTTGGTGTGGAGG + Intronic
1139574173 16:67830963-67830985 TGTAAAGGGGTGTGGTGTGGTGG - Intronic
1139634622 16:68250556-68250578 GTGAATGGGGCTGGGTGTGGTGG - Intronic
1139693637 16:68657224-68657246 GCCAAACGGGCTCGGTGTGATGG + Intronic
1139786034 16:69392772-69392794 GGCACAATGGCTGGGTGTGGTGG - Intronic
1139841961 16:69888991-69889013 GGCAAGAGGGCCGGGTGTGGTGG - Intronic
1139868327 16:70082037-70082059 GGAAAAGGGGCTGAGCGTGGTGG - Intergenic
1139951830 16:70676211-70676233 GGCACTGGGGCTGGGTTTGGAGG - Intronic
1140245238 16:73242353-73242375 GGCTAATGGGGTGGGTGTGGGGG - Intergenic
1140387004 16:74549824-74549846 GGAAAAGGGGCTGAGCGTGGTGG + Intronic
1140406665 16:74716105-74716127 AATAAAGGGGCTGGGTGTGGTGG - Intronic
1140609272 16:76578621-76578643 GCCAAAGAGGGTTGGGGTGGAGG + Intronic
1140772406 16:78217008-78217030 GGGAGAGGGGCTGGGTGTGGTGG - Intronic
1141175384 16:81715121-81715143 GGCAAAGGGGCCAGGCGCGGTGG + Intergenic
1141371679 16:83492733-83492755 GGCAATGGGGATTGGTGGGAGGG + Intronic
1141375133 16:83523533-83523555 GGCAGAGAGTCCTGGTGTGGGGG - Intronic
1141527085 16:84618389-84618411 GGGAAAGGGGGTTGGGGTAGTGG - Intergenic
1141712484 16:85708108-85708130 GGAAACGGGGCTTGGTGTGGTGG - Intronic
1142372710 16:89691894-89691916 GGCAGAGGGGCCTGGGGTGGGGG + Intronic
1142651764 17:1358099-1358121 GGCAAAAGGGCCTGGTGCAGTGG + Intronic
1142946710 17:3435631-3435653 GGCAGAGGGGCCGGGCGTGGTGG - Intergenic
1143261930 17:5605934-5605956 GGAGAAAGGGCTGGGTGTGGTGG + Intronic
1143296822 17:5877453-5877475 CCCAAAGAGGCTGGGTGTGGAGG - Intronic
1143520032 17:7439716-7439738 GGCAAAGGGACTTGGTGCCGCGG - Exonic
1143622848 17:8090951-8090973 GGGAAAGGGGTTGGGTGGGGAGG + Intergenic
1143648404 17:8247594-8247616 CCGAAAGGGGCTGGGTGTGGTGG - Intronic
1143743591 17:8973103-8973125 GCCTAAGGGGCCAGGTGTGGTGG + Intergenic
1143780437 17:9226144-9226166 GGCAAAGGGATTTGGGGTCGGGG + Intronic
1144025885 17:11275291-11275313 TCCAAAGGGGCTTGGAGAGGAGG + Intronic
1144045113 17:11448241-11448263 GATAAAGAGGCTGGGTGTGGTGG + Intronic
1144536173 17:16094190-16094212 GGCAAAGAGGCTGGGCGTGGTGG - Intronic
1144636446 17:16912264-16912286 GTCAAAGCGGCCAGGTGTGGTGG - Intergenic
1145240670 17:21239500-21239522 TGCAACGGGGCCTGGTGAGGTGG + Exonic
1145742323 17:27285708-27285730 AGCAGTGGGGCTGGGTGTGGTGG - Intergenic
1145850100 17:28084847-28084869 GGGACAGGGGCTGGGTGCGGTGG - Intronic
1145899720 17:28482749-28482771 GGCAAAGGGGGTTGGGGTGAGGG - Intronic
1145902395 17:28497250-28497272 AGCCTAGGGGCTTGGTGTGGTGG - Exonic
1145999303 17:29121822-29121844 GGGCAGGGGGCTGGGTGTGGGGG - Intronic
1146408511 17:32561400-32561422 TGGAAAGTGGCTGGGTGTGGTGG + Intronic
1146796860 17:35787774-35787796 GACAAAGGGGCTGGGTGCAGTGG - Intronic
1146917527 17:36687654-36687676 GGCAGAGGTGCTTGGTGGGCAGG - Intergenic
1147016672 17:37497472-37497494 GACATAGAGGCCTGGTGTGGTGG + Intronic
1147140214 17:38456449-38456471 GGCTGAGGGGCTGGGTGTGGAGG - Intronic
1147225276 17:38971686-38971708 GGCTCAGGGGCCAGGTGTGGTGG - Intergenic
1147258636 17:39196426-39196448 CTCAAAGGGGCCTGGGGTGGAGG + Intronic
1147290053 17:39434780-39434802 AGGAAAGGAGCTGGGTGTGGTGG - Intronic
1147320613 17:39643633-39643655 GGCAGAGGCCCTGGGTGTGGAGG - Intronic
1147370652 17:39990348-39990370 GGCAAAGGGGCCAGGCATGGTGG - Intronic
1147580766 17:41625959-41625981 AGGAGAGGGGCTTGGTGGGGAGG - Intergenic
1147582782 17:41636490-41636512 AGCAAAGGGGCCTGGGGGGGGGG - Intergenic
1148019260 17:44542565-44542587 GGCCAAGGGGGTGGGGGTGGGGG + Intergenic
1148211826 17:45813312-45813334 GGGTCAGGGGCTTGGGGTGGGGG - Intronic
1148600072 17:48887578-48887600 GTCAAATGGGCTGGGCGTGGTGG - Intergenic
1148604995 17:48922479-48922501 GGTAAAGAGGCCAGGTGTGGTGG + Intronic
1148758633 17:49987849-49987871 AGCACAGGGGCTGGGGGTGGAGG - Intergenic
1148871150 17:50659386-50659408 AGCGAAGGGGCTGGGTGTTGGGG - Intronic
1149539966 17:57461418-57461440 GGCAGAGGGGCTTGGAATGAAGG + Intronic
1149607426 17:57934993-57935015 GGGGAACGGGCTGGGTGTGGTGG - Intronic
1150023059 17:61640254-61640276 GGTAGAGGGGCTTGGAGGGGAGG + Intergenic
1150165672 17:62940255-62940277 GCCAGATGGGCTGGGTGTGGTGG + Intergenic
1150242148 17:63643215-63643237 GGGAAACTGGCTGGGTGTGGTGG + Intronic
1150345332 17:64400251-64400273 GGCAAAGGGGCAGGGCGTGGTGG + Intronic
1150385660 17:64757639-64757661 ACCAAATGGGCTGGGTGTGGTGG + Intergenic
1150388827 17:64779641-64779663 GTCCAAGGGCCTTGGTGTGGGGG + Intergenic
1150489722 17:65565913-65565935 GACAAATTGGCTGGGTGTGGTGG + Intronic
1151274745 17:73025825-73025847 GGAAAAGGGGCTGGGCGTGGTGG + Intronic
1151309870 17:73286377-73286399 GGCCAACGTGCATGGTGTGGCGG + Exonic
1151382770 17:73736960-73736982 GGCAGATGGGGTTGGTGGGGAGG + Intergenic
1151628372 17:75292467-75292489 GACATAGGGGCCAGGTGTGGTGG - Intergenic
1151766168 17:76134480-76134502 GGTAAATGGGCTGGGTGAGGTGG + Intergenic
1151847103 17:76664263-76664285 AGCAAACAGGCTGGGTGTGGTGG - Intergenic
1152069957 17:78129508-78129530 TCCAAATGGGCTTGGGGTGGGGG - Intronic
1152076303 17:78161986-78162008 GCCCCAGGGGCTGGGTGTGGTGG + Intronic
1152112326 17:78363953-78363975 GGCAGACGGGCTGGGCGTGGTGG + Intergenic
1152120493 17:78415341-78415363 GGCATTGGGGCTGGGTGTGGTGG + Intronic
1152142906 17:78548912-78548934 AGCCAAGGGGCTTGGTGGAGGGG - Intronic
1152269356 17:79314853-79314875 GGGAACGGGGCTGGGTGTGCTGG + Intronic
1152360840 17:79832388-79832410 GGCCAAGGCCCTTGGTGTCGCGG - Intergenic
1152365036 17:79850653-79850675 GGAAAAGGGGCTGGGTGTGGTGG - Intergenic
1152385504 17:79971865-79971887 GGCATGGGGGCTGGCTGTGGGGG + Intronic
1152545164 17:80996789-80996811 GGGACAGGAGCTGGGTGTGGTGG + Intronic
1152547827 17:81011378-81011400 GGAAAATTGGCTGGGTGTGGTGG + Intergenic
1152801070 17:82330922-82330944 GCTAAAGGGACTTGGTGGGGAGG - Intronic
1153123735 18:1764350-1764372 GGCAGTGGGGCTGGGGGTGGGGG + Intergenic
1153223728 18:2882463-2882485 GGCAAACAGGCCGGGTGTGGTGG + Intronic
1153301068 18:3592549-3592571 GACATGGGGGCTGGGTGTGGTGG + Intronic
1153824693 18:8864746-8864768 GCAAAATGGGCTGGGTGTGGTGG - Intergenic
1153849351 18:9078641-9078663 GGAAAATAGGCTGGGTGTGGTGG - Intergenic
1153875811 18:9369551-9369573 GGCAAAGGGCCCAGGTGCGGTGG - Intronic
1154143116 18:11843209-11843231 AAAAAAGGGGCTGGGTGTGGTGG + Intronic
1154372886 18:13780850-13780872 GGCAGAGGGGCCGGGTGCGGTGG + Intergenic
1155034701 18:22016267-22016289 GGCAGAAAGGCCTGGTGTGGTGG - Intergenic
1155428588 18:25731789-25731811 AGCAGAGAGGCTGGGTGTGGTGG + Intergenic
1155483126 18:26311345-26311367 AGCAAAGGGGCTGGGCGTGGTGG + Intronic
1155564527 18:27119186-27119208 GGCAAATGTACTTGGTTTGGTGG - Intronic
1155913528 18:31533179-31533201 TGATAAGGGGCTGGGTGTGGTGG + Intronic
1155930777 18:31705673-31705695 GTCAAAGGGGCTGAGTGTGGTGG - Intergenic
1156029080 18:32691389-32691411 GCCAAAGAGTCTGGGTGTGGTGG + Intronic
1156056763 18:33014966-33014988 AGGAAAGAGGCTGGGTGTGGTGG + Intronic
1156281241 18:35641155-35641177 GGGAAAAGGGCTTGGGATGGTGG + Intronic
1156325530 18:36071504-36071526 GGCCAAGGGGCTGGGGGCGGGGG + Intergenic
1156469363 18:37367925-37367947 GGAAGATGGGCTGGGTGTGGGGG - Intronic
1156645879 18:39161938-39161960 TATAAAGGGGCTTGGTGTGGTGG + Intergenic
1157244739 18:46043096-46043118 GAAAAAGGGGCCAGGTGTGGTGG + Intronic
1157335333 18:46733616-46733638 GGATAAGGGGCTTGGGGTGGGGG + Intronic
1157337041 18:46748257-46748279 GGCAAAGGGGCTGGGCGTGGTGG + Intronic
1157376938 18:47175962-47175984 GGCCCAGGGGGTTGGGGTGGAGG - Intronic
1158378671 18:56903705-56903727 GGAAAAATGGCTGGGTGTGGTGG - Intronic
1158970596 18:62662805-62662827 GGCAAATGTGCTGGGAGTGGTGG - Intergenic
1159002267 18:62984872-62984894 GAGAAAATGGCTTGGTGTGGAGG + Intergenic
1159670104 18:71212413-71212435 GTCAATGGTACTTGGTGTGGTGG + Intergenic
1160089465 18:75812751-75812773 CCCAAGGGGGCTTGGGGTGGGGG - Intergenic
1160550073 18:79688825-79688847 GCCAGAGTGGCTGGGTGTGGTGG - Intronic
1160571570 18:79820933-79820955 GGCAAAGGGGCTAGGCATGGTGG - Intergenic
1160575183 18:79849108-79849130 GGCAGAGGGGCTCGATGTGGAGG - Intergenic
1160600791 18:80010987-80011009 TGGAAAGGGGCATTGTGTGGGGG + Intronic
1161179342 19:2869004-2869026 GATAAAGGGGCCAGGTGTGGTGG - Intronic
1161359751 19:3841252-3841274 GGCAACGGGTCTTGGAGAGGAGG + Intronic
1161600047 19:5176415-5176437 GGCAATTGGGCCGGGTGTGGTGG + Intronic
1161748879 19:6079598-6079620 TGCAAGTGGGCTGGGTGTGGTGG + Intronic
1161784257 19:6313403-6313425 GGAAAAGGGGCTGGGTGCAGTGG - Intronic
1161799865 19:6411687-6411709 AACAAGGGGGCTGGGTGTGGAGG - Intergenic
1161884122 19:6980382-6980404 TACAAATGGGCTGGGTGTGGTGG - Intergenic
1161911363 19:7197053-7197075 GGCAAAGGGGCAGGGGTTGGGGG + Intronic
1161929654 19:7329474-7329496 AACAAGGGGGCTGGGTGTGGTGG + Intergenic
1162088831 19:8264587-8264609 GGCAAAGAGACCAGGTGTGGTGG + Intronic
1162134312 19:8545744-8545766 GGAAAAGGGGGTGGATGTGGGGG + Intronic
1162340461 19:10088656-10088678 AGCAGAGGGGCCAGGTGTGGTGG + Intronic
1162357820 19:10197343-10197365 AGCAAATGGGCTGGGTGCGGTGG + Intronic
1162509845 19:11111481-11111503 GAGAAAGAGGCTTGGTGGGGAGG - Intronic
1162568955 19:11459872-11459894 GGAAGAGTGGCTGGGTGTGGTGG - Intronic
1162821054 19:13223876-13223898 GCCAAATGGGCCGGGTGTGGTGG + Intronic
1162945009 19:14037745-14037767 GGCCAAGGGGGATGGTGCGGGGG + Intronic
1163018508 19:14470925-14470947 GGCAAAGCGGCTAGGCATGGGGG - Intronic
1163090700 19:15017905-15017927 TGGAAAGGGGCCGGGTGTGGTGG + Intronic
1163541263 19:17912170-17912192 GGGCATGGGGCTGGGTGTGGTGG - Intergenic
1163693650 19:18751234-18751256 GGGAAATGGGCTGGGTGTGGTGG + Intronic
1164245253 19:23422605-23422627 AGCACAGGGGCCGGGTGTGGTGG - Intergenic
1164308808 19:24028936-24028958 AGCACAGGGGCCGGGTGTGGTGG + Intergenic
1164630403 19:29758094-29758116 GGCAGAGGGGCTGTGTGTGTGGG + Intergenic
1164837122 19:31363696-31363718 GGAACAGTGGCTAGGTGTGGTGG + Intergenic
1165219435 19:34303030-34303052 ATCAAAGAGGCTGGGTGTGGTGG - Intronic
1165263694 19:34642426-34642448 GGCAAAGGGGCCGGGCCTGGTGG + Intronic
1165304027 19:34992435-34992457 AGCAAAGGGGCTGGGCGTAGTGG + Intergenic
1165828669 19:38719819-38719841 GGCCAAGGGGCTGGGTGTGGTGG + Intronic
1165967159 19:39592134-39592156 GGCAAAGGGGCCGGGCGTGGTGG + Intergenic
1166055084 19:40283801-40283823 GCCAAGGGGACTTGGAGTGGGGG - Intronic
1166073592 19:40400727-40400749 GCCAGAGAGGCTGGGTGTGGTGG - Intronic
1166196658 19:41210708-41210730 GGCAATGGGGCCAGGTGCGGTGG + Intergenic
1166228278 19:41410847-41410869 GGCAAGGGGCCTGGGCGTGGGGG - Intronic
1166407780 19:42533827-42533849 GGCAAAGGGGCTGGATGCGGTGG + Intronic
1166930516 19:46298750-46298772 TGCAAAGGGACTTGGCATGGGGG - Intronic
1167042512 19:47030925-47030947 GGCAAAGGGGCCCAGTGTGGTGG - Intronic
1167477630 19:49710133-49710155 GGGATAGGGGCTGGGCGTGGTGG - Intronic
1167575238 19:50314784-50314806 GTCAAAGGAGCTGGGGGTGGGGG - Intronic
1167712627 19:51121873-51121895 AGCAAAGAGGCTGGGTGCGGCGG - Intergenic
1167906449 19:52664736-52664758 GGACAAGGGGCCTGGTGTGGGGG + Intronic
1167971978 19:53193379-53193401 GGCAAAGGGGCGGGTTGCGGTGG + Intronic
1167998763 19:53427785-53427807 AGCAAAGGGGCTGGGCGTGGTGG - Intronic
1168008883 19:53513895-53513917 AGCAAAGGGGCTGGGCGTGGTGG - Intergenic
1168278492 19:55290281-55290303 GGCAAAGAGGCCGGGAGTGGTGG - Intronic
1168406086 19:56111400-56111422 GGCACAAGGGCTTGGTGCTGGGG + Intronic
925036712 2:692661-692683 GGCACAGGGGCTGTGTGGGGAGG - Intergenic
925055191 2:851817-851839 GGCAAGGGGGTTTGGTTGGGAGG + Intergenic
925250602 2:2433964-2433986 AGCAAAGGGACTGAGTGTGGTGG + Intergenic
925285905 2:2715614-2715636 GGGAAAGGGGCGTGGTGTGGAGG - Intergenic
925730226 2:6914819-6914841 AGACAAGGGGCTGGGTGTGGTGG - Intergenic
925998918 2:9314644-9314666 AGAAAAGGGGCTGGGTGTAGTGG + Intronic
926104896 2:10143951-10143973 GGCAGAGGGGCCGGGTGTGGTGG - Intronic
926106074 2:10152233-10152255 GGCAAAGGGGCCGGGCATGGTGG - Intronic
926754327 2:16223404-16223426 GGCAGAGAGGCCTGGTGTTGGGG - Intergenic
927009375 2:18886809-18886831 GGATGAAGGGCTTGGTGTGGTGG - Intergenic
927886001 2:26719294-26719316 CACAAATGGGGTTGGTGTGGGGG - Intronic
927899577 2:26809554-26809576 AGCAAATGGGCCGGGTGTGGTGG + Intergenic
927949221 2:27156034-27156056 GGCTGTGGGGCTGGGTGTGGTGG + Exonic
928390919 2:30910390-30910412 GGAATAGGGGCATGGGGTGGGGG - Intergenic
928537633 2:32255725-32255747 GGAAAAGTGGCTAGGCGTGGTGG + Intronic
928640135 2:33289550-33289572 GAGACAGGGGCTTGCTGTGGTGG + Intronic
929119388 2:38471732-38471754 AGGAGAGGGGCTGGGTGTGGTGG - Intergenic
929277812 2:40044514-40044536 GGCAAAGGGGCCAGGCGTGGCGG - Intergenic
929502790 2:42504525-42504547 GTTCATGGGGCTTGGTGTGGTGG - Intronic
929569577 2:43012763-43012785 TGCAAAGGGGCCAGGTGTGGTGG - Intergenic
929595525 2:43173302-43173324 GACAAATGGGCTGGGCGTGGTGG - Intergenic
930207563 2:48603214-48603236 GACAAAGGGGCTTGGGCTTGGGG + Intronic
930283849 2:49403617-49403639 GGCAAGTGGGCCTGGTGTTGAGG - Intergenic
930377236 2:50583327-50583349 GGTAGAGGCGCTAGGTGTGGTGG - Intronic
931294174 2:60905379-60905401 TGCAAACAGGCTGGGTGTGGTGG - Intronic
931316664 2:61139460-61139482 GGCAAAAGGGCTAGCTGTGGTGG - Intergenic
931409194 2:62012603-62012625 GCCAAAGGGGCCGGGTGCGGTGG - Intronic
931575052 2:63710140-63710162 GGCAAAGGTGCTTGTTGATGTGG - Intronic
931716081 2:65029755-65029777 GGGAAAGTGGCCTGGTATGGTGG + Intergenic
931780804 2:65578021-65578043 GTTAAATGGGCTAGGTGTGGTGG + Intergenic
932065246 2:68550517-68550539 TGTAAATGGGGTTGGTGTGGTGG - Intronic
932274435 2:70441485-70441507 TGCAAGGGGCCTTGGGGTGGGGG + Intergenic
932528703 2:72502258-72502280 GGTAAAGAGGCTGGGCGTGGTGG + Intronic
932661847 2:73661534-73661556 GGCAAAGGGGCTGGGCACGGTGG - Intergenic
932793378 2:74674676-74674698 GGTGAGGGGTCTTGGTGTGGAGG + Exonic
933504455 2:83160217-83160239 GACAATGAGGCTGGGTGTGGTGG + Intergenic
933717877 2:85374991-85375013 GTCACAGCTGCTTGGTGTGGAGG + Intronic
933733939 2:85480051-85480073 GTCAAAGGAGCCAGGTGTGGTGG + Intergenic
933772574 2:85753712-85753734 GGCCAAGGGGATGGGGGTGGGGG + Intronic
934112605 2:88756985-88757007 GGCAAAGGGCCCTAGTGCGGAGG - Intergenic
934759501 2:96845819-96845841 GGCAAAGGGGCCGGGCGTGGTGG + Intronic
935160143 2:100522959-100522981 GGGAGCTGGGCTTGGTGTGGGGG + Intergenic
935271845 2:101441438-101441460 GGCAAGGGGGCTGAGTGTGCTGG - Intronic
935744473 2:106178743-106178765 GGAAAGGGGGCTGGGGGTGGGGG - Intronic
936163812 2:110103446-110103468 GGCAAAGGGCCCTAGTGCGGAGG - Intronic
936634783 2:114243606-114243628 GGGAAATGGGCTGGGTGTGGTGG + Intergenic
937619320 2:123967400-123967422 GTTAAAGGGGCTAGGTGCGGTGG - Intergenic
939173294 2:138721052-138721074 GCCAGAGGGGCTGAGTGTGGTGG + Intronic
939341754 2:140905224-140905246 GGCCCAGGGGCTTGGGGAGGGGG - Intronic
939631216 2:144528585-144528607 GGCAAAGGAGCTGGGTGCAGTGG + Intergenic
940042720 2:149377491-149377513 AGCAAAGTGGCTGGGTGCGGTGG + Intronic
940194274 2:151076121-151076143 GGCAAAGGGACTGGGTGCAGTGG + Intergenic
940262037 2:151790982-151791004 CCCAAAGGGGCTGGGTGTGGTGG - Intronic
940902616 2:159139933-159139955 CATAAAGGGGCTGGGTGTGGTGG + Intronic
940971742 2:159903809-159903831 TGCCAAGGGGTGTGGTGTGGTGG + Intronic
941292790 2:163697386-163697408 GACACAGAGGCTGGGTGTGGTGG - Intronic
941397340 2:164990171-164990193 GACAACTGGGCTGGGTGTGGTGG + Intergenic
941837500 2:170041053-170041075 GACAAATAGGCTGGGTGTGGTGG + Intronic
941871645 2:170391865-170391887 AGGAAATGGGCTGGGTGTGGCGG + Intronic
942583698 2:177450122-177450144 GGCAAATAGGCTGGGCGTGGTGG - Intronic
943029138 2:182666328-182666350 AGACAAGGGGCTGGGTGTGGTGG + Intergenic
944202011 2:197117654-197117676 GGCAAAGAGGCCAGGCGTGGTGG - Intronic
944719146 2:202405399-202405421 GGAAAAGGGGCAGGGCGTGGTGG + Intronic
944727490 2:202485830-202485852 GGCAAAGGGGCTGGGTGCCCTGG - Intronic
944954352 2:204790815-204790837 AGAAAATGGGCTGGGTGTGGTGG + Intronic
945060108 2:205901255-205901277 AGAAAAGTGGCTGGGTGTGGTGG - Intergenic
945074343 2:206022864-206022886 GGCATGGTGGCTGGGTGTGGTGG - Intronic
946064304 2:216973553-216973575 GGGAAAGGGGATGGGTGAGGTGG - Intergenic
946382039 2:219355329-219355351 GGCAAAGAGGCAGGCTGTGGAGG + Intergenic
946490121 2:220140654-220140676 GGCAAAGGGGCTGGGCGCGGTGG - Intergenic
946651232 2:221894112-221894134 GGGAATGGGGCTGGGCGTGGTGG + Intergenic
946866366 2:224044504-224044526 AGAAAAGGGGCTGGGTGCGGTGG - Intergenic
947547984 2:231025285-231025307 TGCATAGGGGCTGGGTGTGGTGG + Intergenic
947622578 2:231600268-231600290 GAGAAAAGGGCTGGGTGTGGTGG - Intergenic
947797550 2:232904514-232904536 TGGGAAGGGGCTGGGTGTGGTGG - Intronic
947977523 2:234379889-234379911 CATAAACGGGCTTGGTGTGGGGG + Intergenic
948091695 2:235301326-235301348 GGGAAGGGAGCTTGGTGGGGTGG - Intergenic
948096725 2:235341203-235341225 AGGAAAGAGGCTGGGTGTGGTGG - Intergenic
948255522 2:236565844-236565866 GCAGAAGGGGCTTGGTGTTGCGG + Intergenic
948324623 2:237104005-237104027 GGTAATAGGGCTGGGTGTGGTGG + Intergenic
948470145 2:238172337-238172359 GGAAAACAGGCTGGGTGTGGTGG - Intronic
948714959 2:239855187-239855209 TGCAAAAGGGCCTGGCGTGGTGG + Intergenic
948817466 2:240519965-240519987 GGCAAAGGGTTTTGGTGCTGAGG - Intronic
948958777 2:241315837-241315859 GGCAAAGGGGCGGGGTGACGCGG + Intronic
948967988 2:241399595-241399617 AACAAAGAGGCTGGGTGTGGTGG - Intronic
949013581 2:241696496-241696518 GGCAAAAGTGCTGGGTGCGGTGG + Intergenic
1169049229 20:2562093-2562115 CCCAAAGGGGCTTGATGTGAGGG + Intronic
1169049490 20:2564013-2564035 GACAAATGGGCCAGGTGTGGTGG - Intronic
1169101600 20:2954508-2954530 GGCAAAGGGGCCAGGTGTGGTGG - Intronic
1169152564 20:3301473-3301495 GGATAAGGGGCTGGGCGTGGTGG - Intronic
1169157414 20:3343600-3343622 GGCAAAGGGGTTGGCTGTGGGGG - Intronic
1169188522 20:3641301-3641323 GGAAAAGAGGCCGGGTGTGGTGG + Intronic
1169438476 20:5614044-5614066 GGCAGAGAGGCTGGGTGCGGTGG + Intergenic
1169460884 20:5793995-5794017 GAGAAAGGGGCCTGGCGTGGTGG - Intronic
1169804010 20:9541021-9541043 TGAAAAGTGGCTGGGTGTGGTGG - Intronic
1170249150 20:14260588-14260610 AGCTTAGGGGCTGGGTGTGGTGG - Intronic
1170440164 20:16371297-16371319 GACAAATGGGCTGAGTGTGGTGG + Intronic
1170882379 20:20308432-20308454 GGGGAAGGGGGCTGGTGTGGGGG + Intronic
1170882388 20:20308451-20308473 GGGGAAGGGGGCTGGTGTGGGGG + Intronic
1171144172 20:22767284-22767306 GAGAAAAGGGCTTGGCGTGGTGG - Intergenic
1171167339 20:22983666-22983688 GCCTGAGGGGCCTGGTGTGGTGG - Intergenic
1171187223 20:23131347-23131369 GGCATGGAGGCCTGGTGTGGTGG + Intergenic
1171206875 20:23288289-23288311 GGAAAAGCAGCTTGGTGAGGAGG + Intergenic
1171489400 20:25505974-25505996 GGCAGAGGGGCTGGGCGCGGTGG + Intronic
1171984222 20:31648273-31648295 GACAGAGGGGCCGGGTGTGGTGG - Intergenic
1172672253 20:36642554-36642576 TGCAAAGAGGCTGGATGTGGTGG - Intronic
1172788703 20:37487508-37487530 TGCAAAGAGGCTGGGTGTGGTGG - Intergenic
1172795078 20:37531511-37531533 AAGAAAGGGGCTGGGTGTGGTGG + Intergenic
1172960436 20:38795429-38795451 GACTAAGGAGCTGGGTGTGGTGG - Intergenic
1173082110 20:39877996-39878018 GGCAAAGGGGAGAGGTGAGGAGG + Intergenic
1173179529 20:40794025-40794047 GGCAGAGAGGATGGGTGTGGTGG - Intergenic
1173299388 20:41787841-41787863 GCAAAAAGGGCTGGGTGTGGTGG - Intergenic
1173333903 20:42097941-42097963 GGAACTGGGGCTTGGTGGGGTGG + Intronic
1173468009 20:43299615-43299637 GGAAATGAGGCTTGGTATGGAGG + Intergenic
1173470359 20:43318948-43318970 GTCAATGGGGATTGGCGTGGGGG - Intergenic
1173520780 20:43698819-43698841 GGGGAGGGGGCTGGGTGTGGCGG - Intronic
1173546667 20:43903203-43903225 GCCACAGGGGCTGGGAGTGGAGG - Intergenic
1173594144 20:44247846-44247868 GGGAAGGCGGCTTGGTGGGGTGG + Intronic
1173739571 20:45388662-45388684 GGCAGAGGGGCCAGGTGTGATGG + Intronic
1173802492 20:45903167-45903189 GGCAAGGGGTTTGGGTGTGGTGG - Intronic
1174011542 20:47453742-47453764 GAGAGAGGGGCTGGGTGTGGTGG + Intergenic
1174185879 20:48705951-48705973 GGCACAGGGACTTGGTTTTGAGG - Intronic
1174195385 20:48769251-48769273 AGCAAAGAGGCTGGGGGTGGTGG + Intronic
1174645407 20:52081051-52081073 GGGACAGGGGCTAGGTGGGGTGG + Intronic
1175086474 20:56463593-56463615 GGAAATGGTGCGTGGTGTGGTGG + Intergenic
1175463513 20:59172990-59173012 GGAGCAGGGGCTTGTTGTGGTGG + Intergenic
1175711317 20:61223377-61223399 GTCAAAAGGGCATGATGTGGAGG + Intergenic
1176085660 20:63294410-63294432 CTCAAAGGGGCTGGGAGTGGAGG - Intronic
1176153360 20:63604961-63604983 GGCAGAGGGGCCGGGTGCGGTGG + Intronic
1176183485 20:63765137-63765159 GGCTTAGAGGCTTGGGGTGGGGG + Intronic
1176228206 20:64015838-64015860 AGAATAGGGGCTGGGTGTGGTGG + Intronic
1176725857 21:10431989-10432011 GGCAAAGGAGCCAGGCGTGGTGG - Intergenic
1176978004 21:15346029-15346051 TGCAAACAGGCTGGGTGTGGTGG - Intergenic
1177275751 21:18910943-18910965 GGCAAATTAGCTGGGTGTGGTGG + Intergenic
1177363051 21:20098992-20099014 AAGAAAGGGGCTGGGTGTGGTGG - Intergenic
1178056275 21:28802438-28802460 GGCAAACAGGCCAGGTGTGGTGG + Intergenic
1178256034 21:31053376-31053398 GACAAACAGGCTGGGTGTGGTGG - Intergenic
1178345801 21:31827098-31827120 GAAAAAGGGGCTGCGTGTGGTGG + Intergenic
1178506696 21:33168648-33168670 GGGAGGTGGGCTTGGTGTGGTGG + Intronic
1178564075 21:33667113-33667135 AGCAAATAGGCTGGGTGTGGTGG - Intronic
1178593901 21:33935660-33935682 GACAAACAGGCTGGGTGTGGTGG - Intergenic
1178878762 21:36432327-36432349 GGAAGAGGGGCCAGGTGTGGTGG - Intergenic
1179177025 21:39015602-39015624 AGCAAATAGGCTGGGTGTGGTGG + Intergenic
1179413277 21:41178445-41178467 GGCACATTGGCTGGGTGTGGCGG + Intronic
1179487773 21:41722020-41722042 AGGACAGGGGCTGGGTGTGGTGG - Intergenic
1179887146 21:44319023-44319045 GGCGAGGGGGCCGGGTGTGGGGG + Intronic
1179979266 21:44887966-44887988 GGCAGAGGGGCTGGGGCTGGGGG - Intronic
1180172196 21:46065385-46065407 GGGAAAGGGGCCAGGAGTGGTGG - Intergenic
1180207141 21:46267907-46267929 GACAATGGGGCTGGGTGTGGTGG + Intronic
1180517826 22:16164484-16164506 ATAAAAGGGGCTGGGTGTGGTGG - Intergenic
1180753410 22:18142230-18142252 GGCAAATGGGCCGGGTGTGGTGG + Intronic
1180882018 22:19211018-19211040 TGCAAAGTGACCTGGTGTGGTGG - Intronic
1180994174 22:19956661-19956683 AGAAAATGGGCCTGGTGTGGTGG - Intronic
1181110989 22:20602889-20602911 GGCACGGGGGCATGGGGTGGTGG + Intergenic
1181869642 22:25887674-25887696 GGCACAGGGGCTTTGGATGGAGG - Intronic
1181885539 22:26019213-26019235 GGCAAATGGGCTTGCTGAGAAGG - Intronic
1181919404 22:26308843-26308865 GGCAAAGAGGGTTGCTCTGGAGG - Intronic
1182069938 22:27456363-27456385 GGGAAAGGGGCTGAGTGCGGTGG + Intergenic
1182207936 22:28647550-28647572 GGCAAATGGGCCAGGCGTGGTGG + Intronic
1182229363 22:28825517-28825539 GTTAAACAGGCTTGGTGTGGTGG + Intergenic
1182254027 22:29025267-29025289 GGCATAGAGGCTGGGTATGGTGG - Intronic
1182497078 22:30716723-30716745 AGCAAAGGGGCTAGGCATGGTGG - Intronic
1182497409 22:30719412-30719434 GGAAAAGTTGCCTGGTGTGGTGG + Intronic
1182540143 22:31035271-31035293 GGCAGAAGGGCCGGGTGTGGTGG - Intergenic
1182799490 22:33019878-33019900 AGCAATGGGGCTGGGCGTGGTGG - Intronic
1183103176 22:35596463-35596485 TGCAAAGGGGCTGGGTGTGGTGG + Intergenic
1183280740 22:36930715-36930737 GGCAGTGGTGCCTGGTGTGGAGG - Exonic
1183606977 22:38871834-38871856 GGCACCGGGGCCTGGGGTGGGGG - Intronic
1183897493 22:40981006-40981028 GGCAAAGGGGCCAGGCATGGTGG - Intergenic
1183904383 22:41029308-41029330 ATGAAAGGGGCCTGGTGTGGTGG + Intergenic
1183968218 22:41456381-41456403 GGCAAAGGGGCTGAGAGTGCTGG + Intergenic
1184256564 22:43290422-43290444 GGCAAAGGAACTTGGTGTTACGG - Intronic
1184526686 22:45028034-45028056 GGAAGAGGGGCTGGATGTGGTGG + Intergenic
1184566001 22:45292516-45292538 GGCAAAGGGCCCTGGTCTGACGG - Intronic
1184988546 22:48152724-48152746 GGGCACGGGGCTTGGGGTGGGGG - Intergenic
1185363748 22:50424925-50424947 GGAAAAGGGGCTGGGTGCAGTGG - Intronic
949143812 3:670318-670340 GACAAATGGGCTGGGCGTGGTGG - Intergenic
949516781 3:4814589-4814611 GGCAAAGGGGGCGGGTGGGGTGG + Intronic
949681020 3:6514570-6514592 GTCAAAGGGGCATAGTGTGTAGG - Intergenic
949807420 3:7970861-7970883 AGCAAGGGGGCTAGGAGTGGGGG + Intergenic
949906773 3:8864391-8864413 GGCAGAGGGGCTGGGGGTGATGG + Intronic
949966511 3:9361389-9361411 TGCAAAGGGGCTGGGAGTGGTGG - Intronic
950103366 3:10372152-10372174 AGCAAAGGGGCAGGCTGTGGTGG - Intronic
950137661 3:10593071-10593093 AGCAAATGGGCTGGGCGTGGTGG - Intronic
950209031 3:11104199-11104221 GGCAAAAGGGCTGGGTGTGGTGG - Intergenic
950365030 3:12477046-12477068 GGCAAAAGGGCCTGTTGTGTTGG + Intergenic
950637486 3:14324955-14324977 GTCAGAGGAACTTGGTGTGGAGG + Intergenic
950883383 3:16342159-16342181 GGTACAGGGTATTGGTGTGGGGG - Intronic
951935016 3:28013372-28013394 AGAAAAGGGGATTGGGGTGGGGG + Intergenic
952365842 3:32674345-32674367 AGTAAAGGGGCCAGGTGTGGTGG + Intergenic
952394747 3:32911581-32911603 AGAAAAAGGGCTGGGTGTGGTGG - Intergenic
952434211 3:33256301-33256323 TGCAAAATTGCTTGGTGTGGGGG - Intergenic
952838910 3:37627943-37627965 GGGAAGGGGGCTGGGTGTCGGGG + Intronic
952944297 3:38467158-38467180 GACAAATGGGCTGGGTGCGGTGG + Intronic
953606194 3:44414888-44414910 GACAAGGGGGCCTGGTGAGGCGG - Intergenic
953706787 3:45237314-45237336 GGGAAAGGGGCATGGAGTGGAGG - Intergenic
953858286 3:46518647-46518669 GATAAAGGGGCCGGGTGTGGTGG - Exonic
954023526 3:47763297-47763319 CCCAAAAGGGCTGGGTGTGGTGG - Intronic
954038682 3:47867958-47867980 GACAAATGGGCTAAGTGTGGAGG - Intronic
954239298 3:49281031-49281053 GAAAATGGGGCTGGGTGTGGTGG + Intronic
954531854 3:51327967-51327989 GGTGATGGGGCTGGGTGTGGTGG - Intronic
954805123 3:53214423-53214445 AGTAAAGGGGCTGGGTGCGGTGG + Intergenic
955205634 3:56893464-56893486 AGCAAAGGGGTTGGGCGTGGTGG - Intronic
955693886 3:61616574-61616596 GGGAGAAGGGCTTGGCGTGGAGG - Intronic
956370261 3:68551366-68551388 GACAAAGGGGCTGAGTGTGAGGG - Intergenic
956789311 3:72668502-72668524 TACAAAGGAGCCTGGTGTGGGGG - Intergenic
957607961 3:82428949-82428971 GTCAAAGGGGTTTGTTCTGGCGG - Intergenic
958267142 3:91451592-91451614 AGCAAAGTGGCAGGGTGTGGTGG + Intergenic
959059502 3:101603342-101603364 GGCATAGAGGCTGGGTGTGGTGG - Intergenic
959195273 3:103172407-103172429 GGCACAGGGGCTGGGTATGGTGG - Intergenic
959262559 3:104100276-104100298 GGCAAAGGGGCTGGGCGTGGTGG - Intergenic
959416907 3:106086887-106086909 AACAAAGAGGCTGGGTGTGGTGG + Intergenic
959815445 3:110669011-110669033 TGCAGAGGGGCCAGGTGTGGTGG + Intergenic
960056684 3:113280896-113280918 GGCACAGGGGCGGCGTGTGGAGG - Intronic
960119618 3:113933952-113933974 GGCAAAGGGGCTGGGAGTTTTGG + Intronic
960144716 3:114188497-114188519 TGAAATGGGGCTGGGTGTGGTGG - Intronic
960211443 3:114971871-114971893 GGCAAAGCTGCTTGATGAGGAGG - Intronic
960552324 3:118989639-118989661 TATAAAGGGGCTGGGTGTGGTGG - Intronic
960609696 3:119544173-119544195 GGTAACGGGGCTGGGTATGGTGG - Intronic
961358652 3:126354340-126354362 GACAGAGGGGCTGGGTGTAGAGG - Intronic
961503022 3:127350819-127350841 TGCAAAGGAGGTTGGCGTGGGGG - Intergenic
961650975 3:128416481-128416503 GGGAGATGGGCATGGTGTGGGGG - Intergenic
961950006 3:130739657-130739679 TGCAAATATGCTTGGTGTGGTGG - Intronic
962206928 3:133442440-133442462 TTCAGAGGGGCTAGGTGTGGTGG - Intronic
962296490 3:134193468-134193490 GTCAAAGGGGCCGGGTGTGGTGG - Intronic
963044812 3:141094768-141094790 GGCAAAGGGGCGGGGGGCGGGGG - Intronic
963171725 3:142257787-142257809 TGCAGAGGGGCTGGGGGTGGGGG + Intergenic
963335449 3:143970267-143970289 GGAAAAGGAGTTTGGTGTGATGG - Intergenic
964299554 3:155273008-155273030 GACAAAGGGGCCGGGTGTGGTGG + Intergenic
964558039 3:157962690-157962712 GGCAACAAGGATTGGTGTGGAGG - Intergenic
965318270 3:167218028-167218050 GAGAAAGGGGCCGGGTGTGGTGG - Intergenic
965429490 3:168568741-168568763 GGCCAGGGGGCCAGGTGTGGTGG - Intergenic
965459843 3:168948651-168948673 TGAAAAGGGGCCAGGTGTGGTGG + Intergenic
965519973 3:169662178-169662200 GGCTAAGGGGTTTGGGGAGGGGG - Intronic
965601975 3:170463668-170463690 GGAAATAGAGCTTGGTGTGGTGG - Exonic
965646792 3:170892137-170892159 TGGAAAGGGGCTGGGTGTGGTGG + Exonic
965802392 3:172508053-172508075 TGCACAGAGGCCTGGTGTGGTGG + Intronic
965901925 3:173652079-173652101 GGCAAAGGGGCCGGGCATGGTGG - Intronic
966731437 3:183154624-183154646 GGCAAAGGGGCTGGGTGCTGTGG - Intronic
966761313 3:183421569-183421591 TTCAAAGGGGCCAGGTGTGGTGG - Intronic
966780760 3:183582053-183582075 GGAAAGGGGGCCAGGTGTGGTGG + Intergenic
966915908 3:184583922-184583944 GTCAACGGGGCGAGGTGTGGCGG + Intronic
967000914 3:185333764-185333786 GAAAAAGAGGCTGGGTGTGGTGG + Intronic
967018855 3:185505014-185505036 GACAAAGGGGCAGGGTGTAGTGG + Intergenic
967038060 3:185662965-185662987 GGGAATGGGGCTGGGTGTGGTGG - Intronic
967042038 3:185702767-185702789 GGTGGAGGGGCTTGGTGTGAAGG - Intronic
967269548 3:187721364-187721386 GTCAAACTGGCTTGGTCTGGAGG - Exonic
967869361 3:194217405-194217427 GGGAACGGGGCTTGGTGAGGAGG - Intergenic
967918925 3:194600045-194600067 GGAAAAGGGGCTGGGCTTGGTGG - Intronic
967993851 3:195152103-195152125 GGCGAAGAAGCTTGATGTGGAGG - Intronic
968020226 3:195379504-195379526 GACAAAGGGACTGGGTGTAGTGG + Intronic
968166022 3:196466014-196466036 GTAAAAGAGGCCTGGTGTGGTGG - Intergenic
968177836 3:196566793-196566815 GGGGAAGGGGCTTGGTGGGGTGG + Intronic
968494063 4:905767-905789 GGCAGCGTGGCCTGGTGTGGTGG - Intronic
968685395 4:1954640-1954662 AGCAAACAGGCTGGGTGTGGTGG - Intronic
968704554 4:2071889-2071911 GGCCAAGTGGCTGGGGGTGGTGG + Intergenic
969340080 4:6535059-6535081 GGCAATGGGGGCTGGTGGGGTGG + Intronic
969561816 4:7953206-7953228 GGTAAGGTGGCTGGGTGTGGCGG + Intergenic
969619677 4:8272813-8272835 GGAAATGGGGCCTGGTGGGGAGG + Intronic
969801879 4:9573786-9573808 TGCAAAGCGGCCGGGTGTGGTGG - Intergenic
969819559 4:9709797-9709819 GGCACATGGGTTTGGTGTGACGG - Intergenic
969837360 4:9852901-9852923 GGCACAGAGGCCAGGTGTGGTGG + Intronic
969902046 4:10359150-10359172 GGGAAAGGGTCTTGGTCAGGTGG + Intergenic
969944390 4:10768401-10768423 TGGAAAGGGGCTGCGTGTGGTGG + Intergenic
970279191 4:14435340-14435362 AGTAAAGGGGCTGGGTGTGATGG + Intergenic
970523821 4:16911792-16911814 GAAAAAGGGGCTGGGTGCGGTGG + Intergenic
970665025 4:18326885-18326907 GGCAAAAAGGCTGGGCGTGGTGG + Intergenic
970867217 4:20772919-20772941 GGGAAAGGGGCCGGGTGTGGTGG - Intronic
970877888 4:20893709-20893731 GGCAAGGTGGCTGGGTGAGGTGG - Intronic
970928751 4:21484137-21484159 GAGAAAGGGGCTGGGTGTGGTGG + Intronic
971609731 4:28707745-28707767 ATTAAAGGGGCTGGGTGTGGTGG + Intergenic
971676294 4:29633865-29633887 GGCAAAGGGGCCGGGCATGGTGG + Intergenic
972200344 4:36707074-36707096 AACAAAGAGGCTGGGTGTGGTGG + Intergenic
972293145 4:37710109-37710131 GACAAAAGGGCCGGGTGTGGTGG - Intergenic
972315489 4:37922022-37922044 GGAAAAGAGGCTGGGTGTGGTGG - Intronic
972447242 4:39156728-39156750 GGGAAAGGGGCCAGGTGTGGTGG + Intergenic
972463192 4:39325936-39325958 TCCAATGGGGCTGGGTGTGGTGG + Intronic
972601197 4:40574560-40574582 TGGAAATGGGCTGGGTGTGGTGG + Intronic
973729749 4:53811637-53811659 AGCAAAGGGGCCTGCAGTGGAGG - Intronic
973733174 4:53843302-53843324 GGCAAATGGGCTGGGTGCAGTGG + Intronic
974700552 4:65439427-65439449 GGCAGCGGGGGGTGGTGTGGGGG - Intronic
975131083 4:70833804-70833826 GGGAAAAAGGCTGGGTGTGGTGG - Intronic
975207263 4:71659516-71659538 AACAAATGGGCTAGGTGTGGTGG - Intergenic
975708062 4:77130264-77130286 GGCAAAAGGGCTGGGCATGGTGG - Intergenic
976796748 4:88942277-88942299 GTCAAAGAGGCTGGGTATGGTGG + Intronic
976937081 4:90649817-90649839 GGTCAAGGGGCTGGGTGTGGTGG + Intronic
977329386 4:95618376-95618398 GACAAAGGGGCTAGGCATGGTGG + Intergenic
977580417 4:98718559-98718581 GGGAAAGGGTCTGGGTGCGGTGG - Intergenic
977694503 4:99950699-99950721 GGGAATGGGGCTGGGAGTGGTGG - Intergenic
978425408 4:108577013-108577035 GTCAAAGGGGCCAGGTGCGGTGG + Intergenic
979477191 4:121172018-121172040 GGAATAGGGGCCAGGTGTGGTGG - Intronic
979613688 4:122717810-122717832 AGAAAAGTGGCTCGGTGTGGTGG - Intergenic
980066809 4:128198171-128198193 TACAATGGGGCTGGGTGTGGTGG - Intronic
980935419 4:139221224-139221246 ACCACAGGGGCTGGGTGTGGTGG + Intergenic
981090937 4:140731402-140731424 GGAAAAAGGGCTGGGTGAGGTGG + Intronic
981105943 4:140881449-140881471 TACAAAGGGGCCAGGTGTGGTGG - Intronic
981811787 4:148783845-148783867 GGAGAAGGGGCTGGGTGTGGGGG - Intergenic
982013860 4:151132786-151132808 GGCAAAGAGGCTGGGTATGATGG - Intronic
982090628 4:151877085-151877107 AGCAAATGGGCTGGGCGTGGTGG + Intergenic
982797070 4:159659147-159659169 GGGCAAGGGGCTGGGTGAGGAGG - Intergenic
982862993 4:160477692-160477714 GCAACAGGGGCTGGGTGTGGTGG + Intergenic
982935799 4:161473717-161473739 GTCACAAGGGCCTGGTGTGGTGG - Intronic
983025059 4:162726204-162726226 AGCAAATGGGCTGGGCGTGGTGG - Intergenic
983032661 4:162822479-162822501 AGAAAAGTGGCTGGGTGTGGTGG + Intergenic
983254767 4:165385592-165385614 GGCAAACAGGCAGGGTGTGGTGG - Intronic
984418293 4:179487961-179487983 GACACAGAGGCTGGGTGTGGTGG - Intergenic
984480644 4:180297154-180297176 GGCAAAGGGGCTTGCTTTCATGG - Intergenic
985677966 5:1242188-1242210 TGCAAAGGGGGTGGGGGTGGTGG - Intronic
985682478 5:1263854-1263876 GGGACAGGGCCATGGTGTGGGGG - Intronic
985725304 5:1512987-1513009 GGGAAAAGGGCGTGGGGTGGAGG + Intronic
986155492 5:5170663-5170685 GGCAAAAGAGCTGGGTGTGGTGG - Intronic
986714858 5:10515993-10516015 GGCAAAGAGGCTGGGTGCAGTGG + Intronic
987098432 5:14570709-14570731 TGAAAATGGGCTGGGTGTGGTGG + Intergenic
987105073 5:14630495-14630517 GGCAAAGAGGCTGGGCATGGTGG - Intergenic
987484608 5:18509261-18509283 GGAAATGGGGCATTGTGTGGGGG + Intergenic
987524311 5:19028805-19028827 GGCATGGGGGCTGGGTGCGGTGG + Intergenic
987936861 5:24478297-24478319 GGGAGAGGGGGTTGGCGTGGAGG + Intergenic
988032217 5:25777771-25777793 GGCAAAGGGGCCAGGCGCGGTGG + Intergenic
988052134 5:26044091-26044113 GAAAAAGAGGCTAGGTGTGGTGG + Intergenic
988321822 5:29708230-29708252 GATAAAGGGCCTGGGTGTGGTGG + Intergenic
988373599 5:30404732-30404754 GGAAACAGGGCCTGGTGTGGTGG - Intergenic
988428781 5:31094422-31094444 GGAAAATGGGCCTGGTGTGGTGG + Intergenic
988500414 5:31779198-31779220 GGCAAGGAGGGCTGGTGTGGAGG - Intronic
988622954 5:32842322-32842344 AACAATGGGGCTGGGTGTGGTGG + Intergenic
989606823 5:43252427-43252449 GGCAAGTTGGTTTGGTGTGGGGG - Intronic
989733571 5:44676186-44676208 GGAAGAGAGGCTGGGTGTGGTGG + Intergenic
989754195 5:44932781-44932803 TGAAAAGAGGCTGGGTGTGGTGG - Intergenic
990422596 5:55651533-55651555 GCAAAAGGGGCCAGGTGTGGTGG - Intronic
990550112 5:56867117-56867139 GAAAAAGGAGCTGGGTGTGGTGG - Intronic
990709642 5:58565769-58565791 GGTAAGGAGGCTGGGTGTGGTGG + Intergenic
990966444 5:61453661-61453683 GTAAAAGTGGCTGGGTGTGGTGG - Intronic
991034590 5:62115732-62115754 GGTCCAGGGGTTTGGTGTGGGGG + Intergenic
991316907 5:65319390-65319412 AGCAAACAGGCTAGGTGTGGTGG + Intronic
991348358 5:65694102-65694124 GGCATAGGGGCATGGTCAGGAGG + Intronic
991678023 5:69108015-69108037 GGCAATGTGGCTGGGTATGGTGG - Intronic
991908013 5:71531460-71531482 GGAGAAGGGAGTTGGTGTGGGGG + Intronic
992282915 5:75200583-75200605 AGTAAATGGGCTGGGTGTGGTGG - Intronic
992571969 5:78068035-78068057 AGAAAAGAGGCCTGGTGTGGTGG + Intronic
993006998 5:82439412-82439434 GGCAGAGAGGCTGGATGTGGTGG + Intergenic
993378148 5:87174438-87174460 TGCAAATGGGCCAGGTGTGGTGG + Intergenic
993718888 5:91302208-91302230 TGCAAACAGGCTTGGTATGGTGG - Intergenic
994660419 5:102647398-102647420 GGCAAAAGGGCTGGGTGTGGTGG + Intergenic
994704240 5:103181278-103181300 GGAAGAGGGGCCTGGCGTGGTGG + Intronic
995201109 5:109426028-109426050 GTGAAAGTGGCTGGGTGTGGTGG - Intergenic
995324671 5:110876273-110876295 AGAAAAAGGGCTGGGTGTGGTGG - Intergenic
995483089 5:112612234-112612256 GGTAAACTGGCTTGGGGTGGGGG - Intergenic
995648730 5:114343679-114343701 GACAAAGATGCATGGTGTGGGGG + Intergenic
996465157 5:123792287-123792309 AGCAAAAGGGCTGAGTGTGGTGG - Intergenic
996543564 5:124654306-124654328 GACATAGAGGCTGGGTGTGGTGG - Intronic
997341747 5:133150554-133150576 GAAAAAGGGGCTGGGTGTGGTGG + Intergenic
997348990 5:133216636-133216658 AACAAACGGGCTGGGTGTGGTGG - Intronic
997349465 5:133220266-133220288 GGAACAGAGGCCTGGTGTGGGGG + Intronic
997518541 5:134507320-134507342 GAGAAAGAGGCCTGGTGTGGTGG + Intergenic
997644570 5:135472900-135472922 GGCTAAGGGGCCAGGTGTGGTGG + Intergenic
997910079 5:137863201-137863223 AACCTAGGGGCTTGGTGTGGTGG + Intergenic
998947011 5:147350653-147350675 GGCAAATAGGCTGGGCGTGGTGG - Intronic
999020347 5:148158702-148158724 GCCAAAGGGGCTGGGTGTGGTGG - Intergenic
999194504 5:149772967-149772989 GGTAAAGGCGCTGGCTGTGGTGG + Intronic
999201799 5:149822001-149822023 GGCAAAGGGGTTCAGTGTAGCGG - Intronic
999988043 5:157023327-157023349 GGCAAAAGGGCCGGGTGTGGTGG + Intergenic
1000541152 5:162541940-162541962 AGGGAAGGGGCCTGGTGTGGTGG + Intergenic
1000597248 5:163230193-163230215 GGCAGAGGTGCTGAGTGTGGGGG - Intergenic
1000938190 5:167328476-167328498 GGGAAACTGGCTGGGTGTGGTGG - Intronic
1001000063 5:167997024-167997046 TTCAAATGGGCTGGGTGTGGTGG - Intronic
1001455750 5:171858563-171858585 AGCCACGGGGCTTAGTGTGGAGG - Intergenic
1001734490 5:173987971-173987993 AGGAAAGGGGCTGGGTGTGGTGG + Intronic
1002030963 5:176430120-176430142 GGCATAGGGTTTTTGTGTGGTGG + Intergenic
1002080574 5:176734850-176734872 AAAAAAGGGGCTGGGTGTGGCGG - Intergenic
1002513447 5:179738931-179738953 GCCAATGAGGCTGGGTGTGGTGG - Intronic
1002607772 5:180393411-180393433 AGAAAAGAGGCTGGGTGTGGTGG + Intergenic
1003013972 6:2453012-2453034 GTTAAAGGGGCTGGGTGCGGTGG - Intergenic
1003232706 6:4269171-4269193 GGTAAAGGGGCTGAGTGTGCTGG - Intergenic
1003355254 6:5363211-5363233 GGCAAAGGGGCTGGGCGAGGTGG - Intronic
1004182491 6:13393066-13393088 AGAAAAAGGGCTGGGTGTGGTGG + Intronic
1004489847 6:16104187-16104209 GGCAAGGGGGGATGGTGGGGTGG + Intergenic
1004647740 6:17579325-17579347 GAAAAATGGGCTGGGTGTGGTGG - Intergenic
1004794342 6:19064422-19064444 AGCAAAAGAGCATGGTGTGGAGG - Intergenic
1005305822 6:24513350-24513372 AGAAAAGAGGCTGGGTGTGGTGG - Intronic
1005446640 6:25930850-25930872 AGCAAGGGGGCATGGTGTGGAGG + Intergenic
1005944214 6:30583906-30583928 AGAAAAGGGGCTTGGTGGGGTGG + Intronic
1006147962 6:31970538-31970560 GGGAAAGGGACTTGGGGAGGAGG - Intronic
1006458019 6:34143092-34143114 GGCTAAGGTGCGGGGTGTGGGGG + Intronic
1006587276 6:35124079-35124101 CGAAAAGGGGCTGGCTGTGGTGG - Intronic
1006650795 6:35549720-35549742 AGGAAAGGGGCCAGGTGTGGTGG - Intergenic
1007117196 6:39351067-39351089 ACCGAAGGGGCTTGGGGTGGGGG + Intronic
1007744553 6:44035345-44035367 GGCACAGGGCCTTACTGTGGAGG - Intergenic
1008103906 6:47422270-47422292 AGCAAACAGGCTGGGTGTGGTGG - Intergenic
1008607891 6:53158249-53158271 GGCAAATAGGCCAGGTGTGGTGG + Intergenic
1008941496 6:57050601-57050623 GGCAAAGGGGCTGGGAGCAGTGG - Intronic
1009268806 6:61591897-61591919 AGAAAAGGGGCCAGGTGTGGTGG + Intergenic
1009420598 6:63460243-63460265 GGGAATGGGGCCGGGTGTGGTGG - Intergenic
1009906397 6:69874462-69874484 TGCAGAGAGGCTGGGTGTGGTGG + Intronic
1009976267 6:70674398-70674420 GCAAAAGGGGCTGGGTGTGGTGG - Intronic
1010243522 6:73640601-73640623 GGCCACTGGGCTTGGTGTAGAGG - Intronic
1010682943 6:78817945-78817967 GGCAATGGGGCTGGGGGAGGGGG + Intergenic
1011130963 6:84051568-84051590 GGAAAAGAGGCCAGGTGTGGTGG + Intronic
1011207486 6:84915364-84915386 GGAAAAGGGGCTTGGGGCAGTGG - Intergenic
1012447802 6:99324353-99324375 AGCAAAAAGGCTAGGTGTGGTGG - Intronic
1012729222 6:102859227-102859249 ATCAAAAGGGCTGGGTGTGGTGG - Intergenic
1013009239 6:106105155-106105177 TGCAGAGGGGCTTGGAGTGGTGG - Exonic
1013076748 6:106778668-106778690 AGAAAATGGGCTGGGTGTGGTGG - Intergenic
1013514406 6:110873086-110873108 GGCAAGAGGGCTGGGTGCGGTGG + Intronic
1013768047 6:113596374-113596396 GCCAAAGGGGCGGGGTGGGGGGG - Intergenic
1013784865 6:113768301-113768323 TGGAAAGGGGCCTGGAGTGGTGG + Intergenic
1013887596 6:114988887-114988909 GGAAAGGGGGCCTGGTGCGGTGG - Intergenic
1013895228 6:115080339-115080361 AGGAAAGGGGCCAGGTGTGGTGG + Intergenic
1014318106 6:119892129-119892151 GGGACAGTGGCTGGGTGTGGTGG + Intergenic
1014428924 6:121342769-121342791 AGTACAGGGGCTGGGTGTGGTGG + Intergenic
1014439625 6:121459457-121459479 GACAAAAGGGCCTGGTGTGGTGG - Intergenic
1014857931 6:126425656-126425678 AGCAAAAGAGCTTGGTGTTGAGG + Intergenic
1015664767 6:135616482-135616504 TGTATAGGGGCTGGGTGTGGTGG + Intergenic
1015735935 6:136400127-136400149 GGAAAATAGGCTGGGTGTGGTGG + Intronic
1015785932 6:136921920-136921942 GGCCGAGGGGCTTGGGTTGGAGG - Intergenic
1015957379 6:138613048-138613070 AGAAAATGGGCCTGGTGTGGTGG - Intronic
1016261292 6:142173959-142173981 GGCAAAGGGGCTTAGGGAGCAGG - Intronic
1016310412 6:142727641-142727663 GGAAGAGAGGCCTGGTGTGGGGG + Intergenic
1016846530 6:148573390-148573412 TGAAAAGTGGCTGGGTGTGGTGG + Intergenic
1017249512 6:152263927-152263949 CGAAAATGGGCTGGGTGTGGTGG + Intronic
1017380090 6:153818140-153818162 GGAGAAGGGACTTGGTGTGTTGG - Intergenic
1017483442 6:154880778-154880800 ATCAAATGGGCTGGGTGTGGTGG - Intronic
1017696085 6:157017836-157017858 GGAAACTGGGCTGGGTGTGGTGG + Intronic
1017829066 6:158108495-158108517 AGAAATGGGGCTGGGTGTGGTGG - Intergenic
1018272391 6:162094200-162094222 GGAAAGGTGGCTGGGTGTGGTGG + Intronic
1018550293 6:164989901-164989923 TGAAAATGGGCTGGGTGTGGTGG - Intergenic
1019261801 7:86092-86114 GGAAATGGGGGTGGGTGTGGGGG + Intergenic
1019555617 7:1629139-1629161 GCAGAAGGGGCTTGGCGTGGTGG + Intergenic
1019578308 7:1748212-1748234 GGAGCAGGGTCTTGGTGTGGTGG + Intergenic
1019660218 7:2219872-2219894 GGAAAGGAGGCTTGGTGAGGCGG + Intronic
1019948130 7:4346491-4346513 GTCAATGAGGCTGGGTGTGGTGG - Intergenic
1020054719 7:5109559-5109581 GGGGAAGGGGCCAGGTGTGGTGG - Intergenic
1020182487 7:5933303-5933325 GTCAAATTGGCTGGGTGTGGTGG - Intronic
1020203094 7:6095380-6095402 GCCAGAGGGGCCGGGTGTGGTGG + Intergenic
1020236462 7:6359611-6359633 GACAAAGAGGCTAGGTGCGGTGG - Intergenic
1020257637 7:6510834-6510856 GCAAAATGGGCTTGGTGAGGTGG - Intronic
1020300425 7:6791454-6791476 GTCAAATTGGCTGGGTGTGGTGG + Intronic
1020441690 7:8223637-8223659 CGCAAAAGGGCTGAGTGTGGTGG + Intronic
1020446166 7:8270572-8270594 GACAAAAGGGCTGGGCGTGGTGG + Intergenic
1020499072 7:8892247-8892269 GAGAATGGGGCTGGGTGTGGTGG - Intergenic
1020661286 7:10986269-10986291 TGTAAAGGGGCTATGTGTGGTGG - Intronic
1022283137 7:28930661-28930683 TGCAAAGGGGCTGGAAGTGGAGG - Intergenic
1022290134 7:28993792-28993814 GACAATTGGGCTGGGTGTGGTGG + Intergenic
1022488577 7:30799520-30799542 GGCAAAGGGGTTAGGGATGGTGG - Intronic
1023176474 7:37440481-37440503 AACAAAGAGGCTGGGTGTGGTGG + Intronic
1023389008 7:39689278-39689300 GGCATGTGGGCTGGGTGTGGTGG - Intronic
1023805086 7:43867265-43867287 AGGAAAGGGGCTAGATGTGGTGG - Intronic
1023805933 7:43873000-43873022 GGCACAAGGGCTGGGTTTGGTGG + Intronic
1023837097 7:44074570-44074592 GGGATGGGGGCTCGGTGTGGTGG - Intronic
1024032704 7:45477772-45477794 GGCAAAAAGGCTGGGTGCGGTGG + Intergenic
1024129041 7:46331233-46331255 GGCAAAGGGGCCGGGCATGGTGG - Intergenic
1024581736 7:50806225-50806247 GGGAAGGGGGCAAGGTGTGGCGG - Intergenic
1024715731 7:52077533-52077555 GGCAAAGGTGATTGGTGGGTAGG - Intergenic
1024818861 7:53303612-53303634 GGAAAAGAGGCTGGGTGAGGAGG + Intergenic
1024881317 7:54088422-54088444 GGCAAAGAGTCCTGGTATGGTGG - Intergenic
1025520663 7:61725410-61725432 GGCGAAGGGGCCGGGTGCGGTGG + Intergenic
1025914731 7:65856551-65856573 GGAAGAAGGGCTGGGTGTGGTGG + Intergenic
1025992650 7:66507172-66507194 GAAAAAGGGGCCAGGTGTGGTGG - Intergenic
1026654919 7:72248384-72248406 GGCAAAGAGGCCGGGCGTGGTGG - Intronic
1026774815 7:73224896-73224918 GGAAAAGGAGCCAGGTGTGGTGG - Intergenic
1026988215 7:74568216-74568238 GGGAACGGAGCTGGGTGTGGTGG + Intronic
1027015669 7:74778267-74778289 GGAAAAGGAGCCAGGTGTGGTGG - Intronic
1027035414 7:74921772-74921794 GACAAATGGGCTGGGTGTGGTGG - Intergenic
1027072358 7:75167670-75167692 GGAAAAGGAGCCAGGTGTGGTGG + Intergenic
1027188048 7:75983507-75983529 ATCAAAGGGGCTGGGTGGGGAGG - Exonic
1027188581 7:75985530-75985552 GGGCAAGGGCCTCGGTGTGGCGG + Intronic
1027263049 7:76478698-76478720 GTCAAGGGGACTGGGTGTGGTGG - Intronic
1027314432 7:76976803-76976825 GTCAAGGGGACTGGGTGTGGTGG - Intergenic
1027481802 7:78706917-78706939 GTCAACAGGCCTTGGTGTGGAGG + Intronic
1028996404 7:97105142-97105164 GTCAAATGGGCTGGGCGTGGTGG + Intergenic
1029212343 7:98919311-98919333 GGCGTAGGGGCCAGGTGTGGTGG + Intronic
1029231826 7:99076190-99076212 GGAGTAGGGGCTGGGTGTGGGGG - Intronic
1029290698 7:99500203-99500225 TGGAGAGGGGCCTGGTGTGGTGG - Exonic
1029330124 7:99846062-99846084 GGAAAAGGGGCCAGGCGTGGTGG - Intronic
1029394641 7:100299369-100299391 GACAAATGGGCTGGGTGTGGTGG + Intergenic
1030211981 7:107005879-107005901 AGCAAATGGGCTGGGTGCGGTGG - Intergenic
1030218584 7:107073771-107073793 GACAGAGAGGCCTGGTGTGGTGG + Intronic
1030641742 7:112013864-112013886 CGTAAATGGGATTGGTGTGGTGG - Intronic
1030764765 7:113395396-113395418 AGCGAAGGGATTTGGTGTGGTGG - Intergenic
1031356279 7:120791039-120791061 GGCAAACTGGCTGGGTGTGGGGG + Intronic
1032064990 7:128761329-128761351 AGTAAAGGAGCTGGGTGTGGTGG + Intronic
1032169039 7:129569004-129569026 AGAAAAGGGGCTGGGTGTGGTGG + Intergenic
1032217032 7:129965385-129965407 GATAAAGAGGCTGGGTGTGGTGG - Intergenic
1032394483 7:131579485-131579507 AGGAAAGGGGCCTGGCGTGGTGG + Intergenic
1032394901 7:131582158-131582180 GACAAATGGGCTGGGTGGGGTGG + Intergenic
1032652807 7:133896948-133896970 GGCAACTGGGCCGGGTGTGGTGG - Intronic
1032669455 7:134069757-134069779 GGTAAAGGGGCCAGGTGTGGTGG - Intergenic
1032678621 7:134157808-134157830 GGCATAGTGGCTGGGTGCGGTGG - Intronic
1033365439 7:140670048-140670070 GGCTCAGGGGCTGGGCGTGGTGG - Intronic
1033740729 7:144273923-144273945 GGCAGAGGAGCTGGGGGTGGGGG - Intergenic
1033753177 7:144375690-144375712 GGCAGAGGAGCTGGGGGTGGGGG + Intronic
1034230285 7:149520356-149520378 GACAAAAGGGCTGGGCGTGGTGG + Intergenic
1034528220 7:151679450-151679472 GGGAAAGGGGCTGGGAGAGGAGG - Intronic
1034607857 7:152334166-152334188 GACAAAGGGGCCGGGTGCGGTGG + Intronic
1035037727 7:155906389-155906411 GGCAAAAGGGATGGGTGTTGAGG + Intergenic
1035449612 7:158968034-158968056 GTCAAAGGGGCTAGGCATGGTGG + Intergenic
1035496073 7:159327450-159327472 AGTAAATGGGCTCGGTGTGGTGG + Intergenic
1035844513 8:2848417-2848439 GATAAATGGGCTGGGTGTGGTGG - Intergenic
1036155668 8:6339805-6339827 GGCAATTGGGCCAGGTGTGGTGG + Intergenic
1036500943 8:9313395-9313417 AGAAAAGGGGCTGGGTGTGGTGG - Intergenic
1036524527 8:9522292-9522314 AGAAATGTGGCTTGGTGTGGTGG - Intergenic
1036685480 8:10906744-10906766 GTCAAAGAGGCTGGGCGTGGTGG + Intronic
1036692817 8:10955466-10955488 GGCAGAGAGGCTGGATGTGGTGG - Intronic
1036786890 8:11693731-11693753 GGCACAAGGGCTGGGAGTGGGGG - Intronic
1036941199 8:13054256-13054278 GCACAAGGGGCTGGGTGTGGTGG - Intergenic
1037822375 8:22141253-22141275 GCCAACGAGGCTTGGTGGGGCGG + Intronic
1037822652 8:22142341-22142363 GGGAAAGGGGGGAGGTGTGGGGG + Intergenic
1038032145 8:23651743-23651765 GGAAAAGGGGTGGGGTGTGGTGG - Intergenic
1038162057 8:25049208-25049230 TGCAATGGGGCCAGGTGTGGTGG + Intergenic
1038741303 8:30219416-30219438 CACAAAGGGGCTGGGTGTGGTGG - Intergenic
1038759648 8:30374749-30374771 GGAAAGGCGGCTGGGTGTGGTGG - Intergenic
1038759864 8:30376360-30376382 GAGAAAGAGGCTGGGTGTGGTGG - Intergenic
1038975406 8:32690318-32690340 GGGTAAGGGACTTGCTGTGGGGG - Intronic
1039331696 8:36544453-36544475 GGCAAAGGGGCTGGGCATGGTGG + Intergenic
1039369881 8:36973654-36973676 GTCATAGGGGCTGGGCGTGGTGG + Intergenic
1039470837 8:37812973-37812995 GGACAAGGGGCTGGGTGTGGTGG - Intronic
1040447630 8:47511692-47511714 GGCAAATGGTCTTGGTGTACTGG + Intronic
1041048477 8:53909539-53909561 GCATAAGGGGCTGGGTGTGGTGG - Intronic
1041237085 8:55814534-55814556 GAAAAAGGGGCTGGGTGTGATGG + Intronic
1042507749 8:69578874-69578896 GGAAAAGGGGCTGGGTGCGGTGG + Intronic
1043983225 8:86664521-86664543 GGGGAAGGGGCTTGGGGTAGTGG + Intronic
1044610945 8:94091629-94091651 GGCAAAGAGGGTTTGTGTAGGGG - Intergenic
1044616534 8:94148252-94148274 CACAAAGGGGCTGGGCGTGGTGG + Intronic
1044635482 8:94319716-94319738 GGCATTAGGGCTTGGAGTGGGGG + Intergenic
1044664407 8:94621014-94621036 AGAAAAGGGGCTGGGTGTTGTGG - Intergenic
1044848949 8:96409119-96409141 GGAAATGGGGCTGGGTGTGGTGG + Intergenic
1045072520 8:98523660-98523682 GGCAAAGGGGCTGGGCATGGTGG - Intronic
1045417068 8:101978009-101978031 GGACAAGGGGCTTGTTGGGGAGG - Intronic
1045520853 8:102901723-102901745 GGCAAAGTAGTTGGGTGTGGTGG + Intronic
1046933278 8:119862475-119862497 GAAATAGGGGCTGGGTGTGGTGG - Intergenic
1047071977 8:121355292-121355314 GGCAAAGGGTATAGGTGTTGAGG - Intergenic
1047366525 8:124216587-124216609 TGCAAAGGGGCCGGGTGCGGTGG - Intergenic
1047591288 8:126330019-126330041 GGCAAGGGAGCTTGGTATGCAGG + Intergenic
1048410194 8:134164380-134164402 GTAAAAGGGGCCAGGTGTGGTGG - Intergenic
1048574135 8:135677771-135677793 GGCAAAGGGTCTTGCAGTGAGGG + Intergenic
1048994245 8:139782090-139782112 GAAAAAGGGGCCAGGTGTGGTGG + Intronic
1049135969 8:140900432-140900454 TGAAGAGGGGCTGGGTGTGGTGG + Intronic
1049764525 8:144348202-144348224 GAAAAAAGGGCTAGGTGTGGTGG - Intergenic
1049797851 8:144504722-144504744 GGCACATGGGCTGGGGGTGGGGG - Intronic
1049991204 9:993546-993568 AAAAAAGAGGCTTGGTGTGGTGG + Intergenic
1050516223 9:6446690-6446712 GGAAAATTTGCTTGGTGTGGTGG + Intronic
1050718283 9:8555127-8555149 CTCAAAGGGGCCAGGTGTGGTGG + Intronic
1050721448 9:8595148-8595170 GGTTTAGGGGCTGGGTGTGGTGG - Intronic
1050744189 9:8857920-8857942 GGAAAAGGGGGTAGGGGTGGAGG - Intronic
1051983353 9:23051242-23051264 ATCAAAGGAGCTGGGTGTGGTGG + Intergenic
1052501681 9:29299850-29299872 GCCAATGAGGCTGGGTGTGGTGG + Intergenic
1052672128 9:31571618-31571640 CACAAAGGGGCTGGGTGAGGTGG - Intergenic
1052714067 9:32093597-32093619 GGCAAATGGATTTGGAGTGGGGG - Intergenic
1052905040 9:33826409-33826431 TGCAAAGTGGCTAGGAGTGGTGG + Intronic
1052968504 9:34361738-34361760 AGAAAAGGGGCTGGGTGCGGTGG - Intergenic
1053186715 9:36022515-36022537 GGCAGTGGGGGTTGGGGTGGGGG + Intergenic
1053420567 9:37974980-37975002 GGCACTGGGGGTTGGTGGGGTGG - Intronic
1053612603 9:39730031-39730053 AGCAAATGGGCTGGGTGTGGTGG - Intergenic
1053680052 9:40480415-40480437 GGCTGTGGGGCTTGGGGTGGGGG - Intergenic
1053680660 9:40483433-40483455 GGCAAAGGAGCTGGCTGAGGCGG + Intergenic
1053870642 9:42487989-42488011 AGCAAATGGGCTGGGTGTGGGGG - Intergenic
1053930044 9:43108725-43108747 GGCTGTGGGGCTTGGGGTGGGGG - Intergenic
1054085650 9:60741127-60741149 AGCAAATGGGCTGGGTGTGGTGG + Intergenic
1054240912 9:62612362-62612384 AGCAAATGGGCTGGGTGTGGTGG + Intergenic
1054283053 9:63141502-63141524 GGCAAAGGAGCTGGCTGAGGCGG - Intergenic
1054283660 9:63144520-63144542 GGCTGTGGGGCTTGGGGTGGGGG + Intergenic
1054293132 9:63315925-63315947 GGCTGTGGGGCTTGGGGTGGGGG - Intergenic
1054293742 9:63318948-63318970 GGCAAAGGAGCTGGCTGAGGCGG + Intergenic
1054391159 9:64620418-64620440 GGCTGTGGGGCTTGGGGTGGGGG - Intergenic
1054391766 9:64623437-64623459 GGCAAAGGAGCTGGCTGAGGCGG + Intergenic
1054503961 9:65892891-65892913 GGCAAAGGAGCTGGCTGAGGCGG - Intronic
1054504569 9:65895909-65895931 GGCTGTGGGGCTTGGGGTGGGGG + Intergenic
1054555044 9:66646886-66646908 AGCAAATGGGCTGGGTGTGGTGG + Intergenic
1054704399 9:68448066-68448088 GGAAAAGGGGCTTTGAGGGGAGG + Intronic
1054823648 9:69548814-69548836 AACAAAGGGGCTTTGTGGGGAGG - Intronic
1054932915 9:70654566-70654588 GGCCTAGGGGTTTTGTGTGGTGG - Intronic
1055071935 9:72175317-72175339 CTCAATGGGGCTGGGTGTGGTGG - Intronic
1055467181 9:76577328-76577350 GACAAAGAGACTTGGAGTGGAGG + Intergenic
1055554178 9:77459081-77459103 GCTAAAGTGGCTGGGTGTGGTGG + Intronic
1055945906 9:81690426-81690448 TGCAAAGGGGGTGGGTGGGGTGG - Intergenic
1056525609 9:87440406-87440428 GGCAATGGGGCTGGGTGCAGTGG + Intergenic
1056875162 9:90321752-90321774 GACAAAAGGGCTGGGCGTGGTGG + Intergenic
1056970696 9:91199393-91199415 CACAAAGTGGCTCGGTGTGGTGG - Intergenic
1057053297 9:91942074-91942096 ACCACAGGGGCCTGGTGTGGTGG - Intronic
1057124494 9:92605972-92605994 GGCAAAGGGGCCAGGCGTAGTGG + Intronic
1057300409 9:93875842-93875864 GAGAAAGGGGATGGGTGTGGTGG + Intergenic
1057426804 9:94957493-94957515 GATAAACGGGCTGGGTGTGGTGG - Intronic
1057900371 9:98943771-98943793 GGGAAAGGGGCGTGGGGAGGCGG + Exonic
1057956247 9:99410353-99410375 GGCAGAGGAGCTAGGTGCGGAGG + Intergenic
1058352252 9:104039517-104039539 GGTAAGGGGGCTGGGTGTGGTGG - Intergenic
1058453155 9:105115598-105115620 AGCAAAGAGGCTGGGCGTGGTGG + Intergenic
1058896291 9:109403550-109403572 GGGAGATGGGCTGGGTGTGGTGG + Intronic
1058965537 9:110034443-110034465 GCAAAAGAGGCTGGGTGTGGTGG - Intronic
1059683188 9:116606173-116606195 AGAAATGGGGCTTGTTGTGGGGG - Intronic
1059777274 9:117488210-117488232 GGCAAGGGGGCTGGGAGTAGGGG + Intergenic
1060129627 9:121082682-121082704 AGAAAAGGGGCTGGGTGTGGTGG + Intronic
1060171081 9:121461568-121461590 GGAAAAGGGGGCTGGAGTGGGGG + Intergenic
1060876386 9:127086924-127086946 GGCAAGATGGCTTGGCGTGGAGG + Intronic
1061561117 9:131404066-131404088 GGAAAAATGGCTGGGTGTGGTGG - Intronic
1061803275 9:133124393-133124415 GACACAGAGGCTGGGTGTGGTGG + Intronic
1061901564 9:133675054-133675076 GGCAAAGGGGCCGGGTGTGGTGG + Intronic
1062042487 9:134410552-134410574 GGCAGGGAGGCTTGCTGTGGTGG + Intronic
1062316797 9:135971395-135971417 GTCACAGGGGCCTGGGGTGGAGG + Intergenic
1062320258 9:135987297-135987319 CCCAAAGGGGCTGGGTGCGGTGG + Intergenic
1062332066 9:136049220-136049242 GGCAAAGGGGCTGGGTTCAGGGG + Intronic
1185626408 X:1485929-1485951 TAAAAAGGGGCTAGGTGTGGTGG + Intronic
1185697667 X:2207391-2207413 TACAAAGGGGGTTGGAGTGGGGG - Intergenic
1186056655 X:5656306-5656328 GTGAAAGGGGCTGGGTGTGGTGG + Intergenic
1187016919 X:15338358-15338380 GGAAAATGGGCTTGATGTTGAGG + Intergenic
1187044473 X:15632602-15632624 GCTAAAGAGGCTGGGTGTGGTGG + Intronic
1187139454 X:16578437-16578459 GGCCTAGGGGTTTTGTGTGGTGG - Intergenic
1187188384 X:17009701-17009723 GGAAAAGAGGCTGGGTATGGTGG - Intronic
1187293030 X:17973582-17973604 GGGAAAGGACCTTGGTGTGGTGG - Intergenic
1187311313 X:18146138-18146160 GGAAAAGGGACACGGTGTGGTGG - Intergenic
1187346502 X:18470047-18470069 AGTAAATGGGCTGGGTGTGGTGG + Intronic
1187459846 X:19477414-19477436 TGCAAAGGGGCTGGGCATGGTGG + Intronic
1187505313 X:19874440-19874462 GGCAAAGTGGGGGGGTGTGGAGG + Intronic
1188207443 X:27378125-27378147 TGCAAATTGGCTGGGTGTGGTGG + Intergenic
1188826193 X:34838155-34838177 GCCATAGCGGCTGGGTGTGGTGG - Intergenic
1189132212 X:38511564-38511586 GGAAAATGGGCTGGGTTTGGTGG - Intronic
1189462317 X:41252908-41252930 GGTAAAGGGGTGTGGTGAGGAGG - Intergenic
1189771712 X:44433645-44433667 AGCACAGGGGCTGGGTGCGGTGG - Intergenic
1189782616 X:44530626-44530648 GACAGAGGGGCTGGGCGTGGTGG + Intronic
1190103515 X:47541754-47541776 GAAAAAGCGGCTGGGTGTGGTGG + Intergenic
1190212137 X:48457569-48457591 AGAAAAGGGGCTGGGTGTGGTGG - Intergenic
1190391156 X:49933148-49933170 GGAAAAGGGGCTGGGGGTGGAGG - Intronic
1190825824 X:54017160-54017182 GGAGAAGGGGCTGGGCGTGGTGG + Intronic
1190993788 X:55583710-55583732 GATAAAGGGGCTGGGTGCGGTGG + Intergenic
1192191783 X:68995546-68995568 GGCAATGGGGATAGGTGAGGAGG - Intergenic
1192426363 X:71080438-71080460 GATAAATGGGCTGGGTGTGGTGG + Intergenic
1192490819 X:71576089-71576111 GGCAAAGTGGCCTTGTGTGGTGG + Intergenic
1192574895 X:72235678-72235700 GGAAGAGGGGCTGGGTGTGGTGG - Intronic
1192603115 X:72485832-72485854 TGAAAAGGGGCTAGGCGTGGTGG + Intronic
1192909098 X:75584212-75584234 GGGAAAGTGGCATGGTGTTGTGG + Intergenic
1192942741 X:75930175-75930197 GACAACTGGGCTGGGTGTGGTGG - Intergenic
1193108897 X:77707455-77707477 GGCAAAGGGGCTGGGCACGGTGG + Intronic
1193109295 X:77711545-77711567 GTCAACTGGGCTGGGTGTGGTGG + Intronic
1194015788 X:88619035-88619057 AACAAAGGGGCTGGGTGTGGTGG + Intergenic
1194682688 X:96872779-96872801 GGCACAGGGGCCAGGCGTGGTGG - Intronic
1194847167 X:98824622-98824644 GGCAACGTGGCTTAGTGTGAGGG + Intergenic
1195002788 X:100657913-100657935 GGCAAAGGGGCTGGGCGCAGTGG - Intronic
1195043127 X:101032298-101032320 GGAAGAGGGGCTGGGTGCGGTGG + Intronic
1195070721 X:101276840-101276862 GGAAGAAGGGCTGGGTGTGGTGG + Intronic
1195374493 X:104213678-104213700 AACAATGGGGCCTGGTGTGGTGG - Intergenic
1195538737 X:106038459-106038481 AACAAAGGGGGTTGGTATGGAGG - Intronic
1195544536 X:106100390-106100412 GGCAATGAGGCATGGGGTGGTGG + Intergenic
1195768183 X:108319081-108319103 AGCCAAGGGGTTAGGTGTGGTGG + Intronic
1196132451 X:112172044-112172066 GGCAAAAAGGCTGGGCGTGGTGG + Intergenic
1196703714 X:118698482-118698504 GGTAATGGGGCTTGGAGTTGAGG + Intergenic
1197370690 X:125622106-125622128 GCCCAGGGGGTTTGGTGTGGAGG - Intergenic
1197900580 X:131367534-131367556 GGCAAAGGAGAGTGATGTGGAGG - Intronic
1198098593 X:133404258-133404280 TGCAGAGGGGCCAGGTGTGGTGG + Intronic
1198257165 X:134933933-134933955 AGGAAAGGGGCTGGGTGCGGTGG - Intergenic
1198321326 X:135521318-135521340 GGTAAAGGGGCTACGGGTGGGGG + Exonic
1199066323 X:143422801-143422823 GGCAAAAGGGCTGGGCATGGTGG - Intergenic
1199480138 X:148289355-148289377 AGCAAAGGGGCCTGGCATGGAGG - Intergenic
1199797285 X:151212626-151212648 AGAGAAGGGGCTGGGTGTGGTGG + Intergenic
1200170795 X:154072818-154072840 GACAAAGGGGCTGGGCATGGTGG + Intronic
1200385776 X:155889512-155889534 GCCAAACATGCTTGGTGTGGAGG + Exonic
1201600244 Y:15720473-15720495 AGAAAATGGGCTGGGTGTGGTGG + Intergenic