ID: 1126817233

View in Genome Browser
Species Human (GRCh38)
Location 15:52466064-52466086
Sequence TGCTCCGCATGTTAGATCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 47
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 45}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126817233_1126817238 9 Left 1126817233 15:52466064-52466086 CCCTAGATCTAACATGCGGAGCA 0: 1
1: 0
2: 0
3: 1
4: 45
Right 1126817238 15:52466096-52466118 CTGTGAGAAGGAACTGCTTGAGG 0: 1
1: 1
2: 3
3: 27
4: 265
1126817233_1126817236 -3 Left 1126817233 15:52466064-52466086 CCCTAGATCTAACATGCGGAGCA 0: 1
1: 0
2: 0
3: 1
4: 45
Right 1126817236 15:52466084-52466106 GCAGCCAGGAGACTGTGAGAAGG 0: 1
1: 2
2: 13
3: 48
4: 423
1126817233_1126817239 21 Left 1126817233 15:52466064-52466086 CCCTAGATCTAACATGCGGAGCA 0: 1
1: 0
2: 0
3: 1
4: 45
Right 1126817239 15:52466108-52466130 ACTGCTTGAGGAAGTATCCCAGG 0: 1
1: 0
2: 1
3: 12
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126817233 Original CRISPR TGCTCCGCATGTTAGATCTA GGG (reversed) Intronic
906846468 1:49198063-49198085 TGCTTCCCAAGTTAGATCCAGGG + Intronic
910766618 1:90788868-90788890 TGCTCCCTTTGTTAGATTTATGG + Intergenic
914139890 1:144936581-144936603 TCCTCCCCAGGTTAGATGTAAGG - Intronic
914425712 1:147573668-147573690 TGCTCCCCATTTTAGAGATAAGG - Intronic
918139248 1:181706410-181706432 TGATGGGCATGTTAAATCTAAGG + Intronic
920485058 1:206362120-206362142 TCCTCCCCAGGTTAGATGTAAGG + Intronic
1064600022 10:16984272-16984294 TACATCCCATGTTAGATCTATGG - Exonic
1066262831 10:33745748-33745770 TGCTCATGATGTTAGATCTCAGG + Intergenic
1073008229 10:100340608-100340630 TGCTCAGCATGTTTGTTCTGTGG + Intergenic
1084676866 11:70640422-70640444 TGCTCCCCATGGTGGCTCTAGGG - Intronic
1090968902 11:131622797-131622819 TGCTCAGCTTGTTAGCTCAAGGG - Intronic
1093742585 12:22705339-22705361 TGCTCATCATGTTAGCCCTAGGG - Intergenic
1097731482 12:63133190-63133212 TGCTCCTAATGTACGATCTAGGG + Intergenic
1099859642 12:88210502-88210524 TTCTCTGTATGTCAGATCTAAGG - Intergenic
1110686738 13:78384462-78384484 TGGTCCACATTTTAGAGCTAAGG + Intergenic
1116058664 14:39895060-39895082 TTCTCTGTATGTTGGATCTAAGG + Intergenic
1120029086 14:79619914-79619936 TGGTCCCCATGTCAGAACTAAGG - Intronic
1121897389 14:97661206-97661228 TGCCCCACATGTCAGAACTAAGG - Intergenic
1126816103 15:52455885-52455907 TGATCCGTATGTTAGATGAAAGG - Intronic
1126817233 15:52466064-52466086 TGCTCCGCATGTTAGATCTAGGG - Intronic
1128985687 15:72219264-72219286 TGCTCCTCATGTTAGAAAAAGGG + Intronic
1146743166 17:35304498-35304520 AGCTCTCCATGTTAGATCAAAGG - Intergenic
1159264598 18:66064156-66064178 TTCTCCGCATATTCAATCTAGGG - Intergenic
1168147141 19:54426158-54426180 TGCTCCCCACGTTACATGTAGGG + Intronic
931416938 2:62090462-62090484 TCCTCAGGATGTTATATCTATGG - Intronic
932338730 2:70946109-70946131 TGCTCAGCATGTTTGCTCAAAGG + Intronic
940692372 2:156935012-156935034 TACTGCGCATGTTTGTTCTAAGG - Intergenic
1170128094 20:12988146-12988168 TGCTCTGCAGGTGAAATCTAAGG + Intergenic
953511638 3:43546924-43546946 TGCTCAGCTTCTTAGATCTGTGG - Intronic
971820044 4:31539933-31539955 TCCTTCCCATGTTAGATCCAAGG + Intergenic
976139311 4:81973742-81973764 TGCTTCTCATGTCAGTTCTAGGG + Intronic
990529845 5:56662264-56662286 AGCTCCACATGTTAGATCAATGG - Intergenic
992110891 5:73492363-73492385 TGCTCCACATGTTGGTTCTGGGG + Intergenic
996837513 5:127810297-127810319 TGCTCAGCATGTAGGATCCAAGG + Intergenic
1000380181 5:160622002-160622024 TTCTTCGCTTGTTAAATCTAAGG + Intronic
1016175746 6:141075796-141075818 TTCTCCCCAGGTTAGCTCTAGGG + Intergenic
1021937687 7:25647240-25647262 TGCTCAGCATGTCAGAGCCAGGG + Intergenic
1028243235 7:88446509-88446531 TGCTCCGTATGTTGCATCAAAGG + Intergenic
1031997660 7:128243239-128243261 TGCTCAGTTTGTTAGCTCTATGG + Intronic
1034889811 7:154829838-154829860 TGCTCCTCATGTGGAATCTAGGG + Intronic
1041823128 8:62062541-62062563 TGCTCCACCTCTGAGATCTAGGG - Intergenic
1043704558 8:83331889-83331911 TGCTCAGGGTGTTAGATCAAAGG - Intergenic
1043720467 8:83543170-83543192 TGCTCCCCAAGTTAGCTCCAGGG - Intergenic
1043909916 8:85851905-85851927 AGCTCTGCATGTTAACTCTATGG + Intergenic
1044136585 8:88593088-88593110 TGCTCTGGATGTTAGATGTGAGG - Intergenic
1200976479 Y:9217032-9217054 TTCTCTGTATGTCAGATCTAAGG + Intergenic
1202134691 Y:21649499-21649521 TTCTCTGTATGTCAGATCTAAGG - Intergenic