ID: 1126817236

View in Genome Browser
Species Human (GRCh38)
Location 15:52466084-52466106
Sequence GCAGCCAGGAGACTGTGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 487
Summary {0: 1, 1: 2, 2: 13, 3: 48, 4: 423}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126817231_1126817236 6 Left 1126817231 15:52466055-52466077 CCTTCTAAGCCCTAGATCTAACA 0: 1
1: 0
2: 0
3: 8
4: 99
Right 1126817236 15:52466084-52466106 GCAGCCAGGAGACTGTGAGAAGG 0: 1
1: 2
2: 13
3: 48
4: 423
1126817229_1126817236 8 Left 1126817229 15:52466053-52466075 CCCCTTCTAAGCCCTAGATCTAA 0: 1
1: 0
2: 0
3: 8
4: 137
Right 1126817236 15:52466084-52466106 GCAGCCAGGAGACTGTGAGAAGG 0: 1
1: 2
2: 13
3: 48
4: 423
1126817227_1126817236 26 Left 1126817227 15:52466035-52466057 CCACAGGAAAGTACCTTGCCCCT 0: 1
1: 0
2: 3
3: 21
4: 246
Right 1126817236 15:52466084-52466106 GCAGCCAGGAGACTGTGAGAAGG 0: 1
1: 2
2: 13
3: 48
4: 423
1126817234_1126817236 -4 Left 1126817234 15:52466065-52466087 CCTAGATCTAACATGCGGAGCAG 0: 1
1: 0
2: 0
3: 1
4: 53
Right 1126817236 15:52466084-52466106 GCAGCCAGGAGACTGTGAGAAGG 0: 1
1: 2
2: 13
3: 48
4: 423
1126817230_1126817236 7 Left 1126817230 15:52466054-52466076 CCCTTCTAAGCCCTAGATCTAAC 0: 1
1: 0
2: 0
3: 5
4: 114
Right 1126817236 15:52466084-52466106 GCAGCCAGGAGACTGTGAGAAGG 0: 1
1: 2
2: 13
3: 48
4: 423
1126817228_1126817236 13 Left 1126817228 15:52466048-52466070 CCTTGCCCCTTCTAAGCCCTAGA 0: 1
1: 0
2: 0
3: 14
4: 158
Right 1126817236 15:52466084-52466106 GCAGCCAGGAGACTGTGAGAAGG 0: 1
1: 2
2: 13
3: 48
4: 423
1126817233_1126817236 -3 Left 1126817233 15:52466064-52466086 CCCTAGATCTAACATGCGGAGCA 0: 1
1: 0
2: 0
3: 1
4: 45
Right 1126817236 15:52466084-52466106 GCAGCCAGGAGACTGTGAGAAGG 0: 1
1: 2
2: 13
3: 48
4: 423

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126817236 Original CRISPR GCAGCCAGGAGACTGTGAGA AGG Intronic
900362263 1:2294785-2294807 GGTGCCAGGAGACTGGCAGACGG - Intronic
900555516 1:3278415-3278437 GCAGCCTGCAGAGTGTGGGAGGG + Intronic
900562933 1:3316711-3316733 GGAGCCAGGAAACAGTGACACGG + Intronic
901392779 1:8957957-8957979 ACAGCCAAAAGACTGTGCGATGG + Intronic
901445400 1:9305176-9305198 GCAGCATGAAGAGTGTGAGACGG - Intronic
901872686 1:12147302-12147324 GCAGCCAGGAAGCAGTTAGATGG + Intergenic
902549482 1:17210813-17210835 GCAGCCAGGGGACTGGGGGTTGG + Intronic
902958189 1:19941352-19941374 GCAGAAAGGAGACTGTGATTGGG + Intergenic
903170297 1:21548244-21548266 GCAGCCAGGAGCCTCTGCGAGGG + Intronic
903375038 1:22860491-22860513 GCAGCCTGGGGAGTCTGAGAGGG + Intronic
903379532 1:22887085-22887107 GCAGCCAGGAGAGTGTGCAGAGG + Intronic
905806693 1:40882411-40882433 GCAGAAAGGACACTGAGAGATGG + Intergenic
906590312 1:47018895-47018917 GCAGCCAGGAGCCACTGGGATGG - Intergenic
906955055 1:50367197-50367219 CCAGGCAGGAGACTGGAAGATGG - Intergenic
908336644 1:63132275-63132297 GCAGGCCTGAGACTGTGAGAAGG + Intergenic
908391938 1:63691116-63691138 GCTGCCAGGAGACCAGGAGAAGG + Intergenic
908616240 1:65925943-65925965 ACATCCAGGAGACTGCCAGAAGG - Intronic
908907140 1:69029001-69029023 GCTGCCTGGAGACTGTGTGAAGG + Intergenic
910387966 1:86705083-86705105 GCAGCCAGAGGCCTGGGAGATGG + Intronic
910490036 1:87758474-87758496 GCAGCCAGGGGAGGGAGAGATGG - Intergenic
910671941 1:89782487-89782509 GCAGAGAGGAGACTGTGGGCTGG - Intronic
911292270 1:96071515-96071537 GCCACCAGGAGAGTGTGAGAAGG - Intergenic
911400398 1:97367565-97367587 GCAGGAAGGGGACTGTGAGGTGG + Intronic
911799700 1:102120891-102120913 GCTGCCTGGAGACTGTGTGTTGG + Intergenic
912380601 1:109246217-109246239 GGAGCCAGCAGACTGGGGGATGG - Intergenic
912821116 1:112868434-112868456 AGATCCAGGAGACAGTGAGAGGG + Intergenic
913039078 1:115005530-115005552 GCAGGCAGAAGAATGTGAAAAGG - Intergenic
913061312 1:115211058-115211080 GTAAACAGGAGACTGTGAAATGG - Intergenic
913566894 1:120081318-120081340 GGAGTCAGGAGGCTGTGAGGTGG - Intergenic
913631235 1:120712231-120712253 GGAGTCAGGAGGCTGTGAGGTGG + Intergenic
914287649 1:146242025-146242047 GGAGTCAGGAGGCTGTGAGGTGG - Intergenic
914548680 1:148692768-148692790 GGAGTCAGGAGGCTGTGAGGTGG - Intergenic
914618000 1:149378943-149378965 GGAGTCAGGAGGCTGTGAGGTGG + Intergenic
914900549 1:151709073-151709095 GCAGCCTGGAGAGGTTGAGATGG + Exonic
916085484 1:161266108-161266130 TCAGTGAGGAGACTGTGACAAGG - Intronic
916564365 1:165960480-165960502 GAAGCCAAGAGATTGTTAGAAGG + Intergenic
916734904 1:167598933-167598955 GAAGCCAGGAAAATGTGGGAAGG - Intergenic
918209817 1:182340574-182340596 GGACTCAGGAGACTGTGAGAGGG + Intergenic
918615589 1:186540635-186540657 GCTGCCAGGAGACTGTGGGATGG + Intergenic
918935384 1:190914817-190914839 GCAGGCAAGAGACTGTGTGCAGG - Intergenic
919767563 1:201136987-201137009 GCAGTGAGGAGGCTGGGAGAGGG + Intronic
920329227 1:205193489-205193511 GCAGACAGGAGGCTAGGAGAAGG - Intronic
920372129 1:205485640-205485662 GCGGCCAGGAGGGTGTCAGATGG - Intergenic
920602873 1:207346835-207346857 GCTGCCTGGAGACAGTGTGATGG - Intronic
920656292 1:207877857-207877879 GCAGTCAGGAGAGTGGGGGAGGG - Intergenic
921625418 1:217373388-217373410 GCAGAGAGGAGACTGTGAAGAGG - Intergenic
922719980 1:227895390-227895412 GCAGCAAGGACCCTGTGAGGTGG - Intergenic
922822771 1:228495255-228495277 GCAGCAAGGACTCTGTGAGGTGG - Exonic
923626284 1:235616403-235616425 CCTGCCAGGAGCCTGTGGGATGG + Intronic
924692903 1:246368751-246368773 GCAGGCAGGAGATCGTGAAAAGG + Intronic
1062852899 10:759354-759376 GCTGCCAGGAGATTGTGCGATGG + Intergenic
1062933178 10:1366067-1366089 GCAGCCATGCGTCTGTGACAAGG + Intronic
1064569363 10:16676346-16676368 GCAGGCAAGAGACTGTGTGCAGG + Intronic
1065520241 10:26565169-26565191 TAAGCCAGGAGACTGTGTGAAGG + Intronic
1065605337 10:27413114-27413136 GAGGCCAGGAGAAGGTGAGAGGG - Intronic
1065643983 10:27815429-27815451 GCAGCCTGGAGTCAGTGGGATGG - Intronic
1066623929 10:37386233-37386255 GCAGTCAGGGGACTGAGACAAGG - Intergenic
1067079054 10:43203423-43203445 GAAGGCAGGAGACGGAGAGAGGG + Intronic
1067471614 10:46542109-46542131 GCAGTCAACAGACTGGGAGATGG - Intergenic
1067689470 10:48492328-48492350 GCAGCCAGGAGAGTGACAGTGGG - Intronic
1067725955 10:48771108-48771130 GCAGGCGGGAGGCTGTGACAGGG + Intronic
1067769171 10:49111143-49111165 GTATCCAGGCAACTGTGAGATGG + Intronic
1068303478 10:55175882-55175904 GCAGCCAGGGCACTATAAGAAGG + Intronic
1069714242 10:70510325-70510347 GCAGCCAGGAGAGTGTCAGCAGG + Intronic
1070093265 10:73310628-73310650 GTAGTGAGGAGACTGTGAGTGGG - Intronic
1070946781 10:80398648-80398670 GGAGCCAGGAGGCTGAGGGAAGG + Intergenic
1071246705 10:83773087-83773109 GTGGCCAGGAAACTGTGAGAAGG + Intergenic
1072381971 10:94882106-94882128 GCAGCCAAGAGACTGTGTAGTGG + Intergenic
1072463863 10:95645440-95645462 GCGGCCAGGAGATAGTCAGAAGG - Intronic
1072647260 10:97266742-97266764 GCAGGCAAGAGAGTGTGTGAAGG + Intronic
1072733114 10:97861455-97861477 CCACCCAGCAGACTGTGGGATGG - Intronic
1072790898 10:98317111-98317133 GCAGACAAGAGACAATGAGATGG + Intergenic
1073267228 10:102235095-102235117 ACAGAGAGGAGACTGTGTGACGG - Intronic
1074900178 10:117809695-117809717 GCAGGCAAGAGACTGTGTGCAGG - Intergenic
1076055263 10:127367606-127367628 CCAGACAGAAGCCTGTGAGATGG + Intronic
1076621656 10:131792861-131792883 GGAGCCCAGAGACTGTGATAAGG + Intergenic
1077799239 11:5521923-5521945 GAAGACAGGAGGCTGTGACAGGG + Intronic
1078179430 11:8998531-8998553 TGAGCCAGCTGACTGTGAGATGG - Intronic
1078582308 11:12547928-12547950 ACAGTAAGGAGACTGTGGGATGG - Intergenic
1078669395 11:13351708-13351730 CAAGCCAAGAGACAGTGAGAAGG + Intronic
1081072352 11:38627500-38627522 GCAGGCAGGAAAATGTGAAAAGG + Intergenic
1081244336 11:40746232-40746254 GCTGTCAGGAGACTGTGCAACGG + Intronic
1081752406 11:45521166-45521188 GCAGGCAGGAGAGTGTGTGCAGG + Intergenic
1081764565 11:45600550-45600572 CCAGCCAGGTGACAATGAGAGGG - Intergenic
1081787297 11:45756605-45756627 GGAGCGCGGAGACTGTGTGAAGG - Intergenic
1082160601 11:48884529-48884551 GTTGCCAGGAGACTGTCAGGAGG - Intergenic
1082161765 11:48895877-48895899 GTTGCCAGGAGACTGTCAGGAGG + Intergenic
1082167348 11:48964305-48964327 GTTGCCAGGAGACTGTCAGGAGG + Intergenic
1082239680 11:49856901-49856923 GTTGCCAGGAGACTGTCAGGAGG - Intergenic
1082609721 11:55282270-55282292 GTTGCCAGGAGACTGTCAGGAGG - Intergenic
1082915282 11:58427833-58427855 ACAGTCAAGGGACTGTGAGAAGG + Intergenic
1083010162 11:59389192-59389214 GCAGCTGGGATATTGTGAGAAGG - Intergenic
1084173872 11:67413407-67413429 GCTGACTGGGGACTGTGAGAGGG + Intronic
1084406817 11:68979097-68979119 GGACCCAGGGGACTGTGGGAAGG + Intergenic
1084635239 11:70387795-70387817 TCAGCTGGGAGACTGGGAGAGGG - Intergenic
1084998979 11:73011645-73011667 GCTGCCAGGAGATTGTGTGATGG - Intronic
1085467702 11:76735420-76735442 CCAGCCTGGAGACTGGTAGAGGG + Intergenic
1086159072 11:83701101-83701123 GCAGGCAGGAGTCCGGGAGATGG + Intronic
1087074411 11:94115962-94115984 GCAGGCAGAAAAATGTGAGAGGG - Intergenic
1087100484 11:94359125-94359147 GCAACAAGGAGGCTGGGAGAGGG + Intergenic
1087304427 11:96472367-96472389 GCTGCTTGGAGACTGTGTGAAGG + Intronic
1088799947 11:113296556-113296578 GCAGCCAGCAGAATTTGGGAGGG + Intergenic
1088966057 11:114722299-114722321 GCAGCCAAGAGAGAGTGAGAAGG - Intergenic
1089194503 11:116686220-116686242 GAAGCCAGGAGACAAGGAGATGG - Intergenic
1089458430 11:118639104-118639126 GGAGCCAGGAGACTGTGTGAGGG - Intronic
1089577821 11:119459366-119459388 GCAGCCAGTAGGCAGAGAGAGGG + Intergenic
1091898480 12:4123662-4123684 GCAGCCATGTGACTGTAAGCTGG + Intergenic
1092097992 12:5860092-5860114 ACAGCCAGATGACAGTGAGAAGG - Intronic
1092867740 12:12778827-12778849 AAAGCCAGGAGACAGTTAGAAGG - Intronic
1094313532 12:29113008-29113030 GCTGCCTGGACACTGTGTGATGG - Intergenic
1095679768 12:44960512-44960534 AGAGCCAAGAGGCTGTGAGAAGG + Intergenic
1095950890 12:47781344-47781366 GCAGCAAGGGCACTCTGAGAAGG - Exonic
1096650134 12:53058512-53058534 GCAGGCAGGAGAGTGTGGTATGG + Intronic
1097032114 12:56097280-56097302 CCAGCCAGGAAAAAGTGAGAAGG + Intronic
1097476073 12:60057860-60057882 GAAGACAGGAAAATGTGAGAAGG + Intergenic
1098404356 12:70108505-70108527 GCTGCCAGGAGACCATGGGATGG + Intergenic
1099230201 12:80014540-80014562 GCAGCTAGGAGACTGTGAGAAGG - Intergenic
1101884725 12:108652325-108652347 GCAGCAAGGAGCCTCAGAGAGGG - Exonic
1102033687 12:109759143-109759165 GCAGTCAGGAGACTTGGAGGTGG - Intronic
1102874968 12:116442188-116442210 GGAACAAGGAGACTCTGAGACGG + Intergenic
1102911124 12:116714892-116714914 GCACACAAGAGACTGTGAAAAGG - Exonic
1103458610 12:121086529-121086551 GCAGGCAGGAGACGGTGGGCAGG + Intergenic
1103953124 12:124562534-124562556 GCAGCCCGGAGAGTGGGCGAAGG - Intronic
1105871729 13:24511533-24511555 GCAGCCAAGAGTTTGTGAGGAGG - Intronic
1106047001 13:26151991-26152013 TCATCCTGGAGACAGTGAGAAGG - Intronic
1106240192 13:27905850-27905872 GTTGCCAGGAGACTGGGGGAAGG + Intergenic
1106909042 13:34443485-34443507 GAAGCCAGCAGACTATGAGTTGG - Intergenic
1107998876 13:45888547-45888569 GAAGCCAGGAGCCTGGGGGAGGG + Intergenic
1109106508 13:58258836-58258858 GGAGTCAAGAGACAGTGAGAAGG + Intergenic
1109198880 13:59409382-59409404 GAAGCCAGGAACCTGTGTGAAGG - Intergenic
1109245993 13:59955371-59955393 GCAGACAGGAGACCGTGTGCAGG - Intronic
1111134780 13:84027199-84027221 GCAGCAAGGAGAATGAGTGAAGG + Intergenic
1111420638 13:88005875-88005897 GCAGCCAGAAGACTGTGAGAAGG - Intergenic
1111749563 13:92311626-92311648 GCAGCCAAGAGAGTGTGTGCAGG + Intronic
1112246892 13:97743440-97743462 GAAGTCAGGAGACAGAGAGATGG + Intergenic
1112265538 13:97920141-97920163 GCAGCCAGGAGAGAGTGACTTGG - Intergenic
1112744341 13:102509695-102509717 GCAGGCAAGAGACTGTGTGTAGG - Intergenic
1112746751 13:102535593-102535615 GGAGGCAAGAGACTGAGAGAAGG - Intergenic
1114929967 14:27454169-27454191 GCAGCCAGGAGAATATCTGATGG + Intergenic
1116406019 14:44567550-44567572 GCAGCCAACAGAATGTGGGAGGG + Intergenic
1116515173 14:45796181-45796203 GCAGCAAGGAGGCTGGGGGAGGG + Intergenic
1117277753 14:54206741-54206763 GCAGCCAGGAGAGTGAAAGAAGG + Intergenic
1119060192 14:71465922-71465944 GCAGGCAGAAGAATGTGAAAAGG - Intronic
1119440419 14:74624519-74624541 TCAGCCAGGAGAAGGTGAAAAGG + Intergenic
1120609101 14:86618438-86618460 GCAGCTGGGAGACTGAGAGGAGG + Intergenic
1121162642 14:91759443-91759465 GCAGTCAGGAGACCATGAGAAGG + Intronic
1121310008 14:92930587-92930609 GCTGCCCGCAAACTGTGAGATGG + Intronic
1121972377 14:98370090-98370112 GATGCCAGGAGCCTGTGATAGGG - Intergenic
1121989233 14:98539118-98539140 GCAGGCAAGAGAGTGTGTGAGGG - Intergenic
1122020418 14:98833500-98833522 GAAGCCAGGAGAAAGTGAGGGGG + Intergenic
1122118617 14:99540283-99540305 GCTGCCAGGAGCCAGTGAGCCGG + Intronic
1122641239 14:103160819-103160841 GCAGGCAGGAGGCTGTGGGGGGG - Intergenic
1122641256 14:103160867-103160889 GCAGGCAGGAGGCTGTGGGGGGG - Intergenic
1122689444 14:103524838-103524860 TCAGCCAGGAGGGTGAGAGAGGG - Intergenic
1124568014 15:30834043-30834065 CCAGCCAGGATACAGTGAGTGGG - Intergenic
1125512147 15:40297820-40297842 GCAGACAGGAGACTGGGGGCTGG + Intronic
1125933798 15:43617903-43617925 GCAGCCAGGACACAGTCAGACGG + Exonic
1125946896 15:43717365-43717387 GCAGCCAGGACACAGTCAGACGG + Intergenic
1126817236 15:52466084-52466106 GCAGCCAGGAGACTGTGAGAAGG + Intronic
1126918983 15:53499205-53499227 GCAGGCAGGAGAGTGTGTGCAGG + Intergenic
1126996785 15:54453121-54453143 GCTGCCTGGAGACTGTGCAATGG - Intronic
1128118329 15:65127087-65127109 GCATCCAGGAGAGAGAGAGAAGG - Intronic
1128381754 15:67118267-67118289 GCTGAGAGGAGACTGAGAGAAGG + Intronic
1128384185 15:67135331-67135353 GCAGTCAGGGGACTGTGAAGGGG - Intronic
1129543053 15:76366929-76366951 GCAGCCCTGAGACTCTGAGGTGG + Intronic
1130312313 15:82766197-82766219 GCAGACCAGAGACTGTGGGAGGG - Intronic
1130654385 15:85781944-85781966 GCAGCCAGCAGTGGGTGAGAGGG - Intronic
1131680806 15:94721010-94721032 GGAGCCAGGAGATGGAGAGAGGG - Intergenic
1131700492 15:94930208-94930230 GGAGTCAGGAGAATATGAGAAGG + Intergenic
1132629524 16:910437-910459 GCAGCCAAGAGACCATGAGGAGG + Intronic
1132772413 16:1571343-1571365 TCAGTCAGGAGACAGTGTGATGG - Intronic
1132896584 16:2232211-2232233 GGAGCTGGGAGACGGTGAGATGG + Exonic
1133319618 16:4904836-4904858 GCAGCCAGGTGACAGCGAGGTGG + Intronic
1133735426 16:8611364-8611386 GCAGCCAGGATAATTAGAGATGG + Intergenic
1134567431 16:15263560-15263582 GCAGCCAAGCCACTGTGAAATGG + Intergenic
1134735061 16:16493140-16493162 GCAGCCAAGCCACTGTGAAATGG - Intergenic
1134782590 16:16911858-16911880 GCAGGCAAGAGCCTGTGTGAAGG - Intergenic
1136287857 16:29254690-29254712 GGAGCCAGGAGACAGAGAGAAGG - Intergenic
1136377931 16:29876531-29876553 GCAGCCCGGAGAAGATGAGAGGG + Intronic
1137314297 16:47300027-47300049 GTAGCCAGGAGACTATGAGAAGG - Intronic
1137496410 16:48972401-48972423 GCAGCCAGGAACCTTTAAGAAGG - Intergenic
1137701994 16:50503936-50503958 GCAGAAAGGAGACAGAGAGAAGG - Intergenic
1139070253 16:63371662-63371684 GCAGGCAGTAGAATGTGAAAAGG + Intergenic
1140305056 16:73795161-73795183 GCAGCCAGGAGTCTGGGAGGAGG + Intergenic
1140477034 16:75244185-75244207 GACGCCAGGAGACTCTGAGGAGG - Intronic
1140515765 16:75540149-75540171 TCAGCCAGGATTCTGGGAGATGG - Exonic
1140710259 16:77670953-77670975 GCAGCCAGGAGTCAGTGAGCTGG + Intergenic
1141392208 16:83674383-83674405 GCAGCCAGGCAAATGAGAGAAGG + Intronic
1141478705 16:84292052-84292074 CCAGCAAGGAGGCTGAGAGAGGG + Intergenic
1142093508 16:88227393-88227415 GGAGCCAGGAGACAGAGAGAAGG - Intergenic
1142093556 16:88227544-88227566 GGGGCCAGGAGACAGGGAGAAGG - Intergenic
1142323723 16:89400914-89400936 GCAGGGTGGAGCCTGTGAGAGGG - Intronic
1142391049 16:89800275-89800297 GGAGCCAGAAGACGGTGAGAAGG + Intronic
1142687689 17:1587199-1587221 GCAGACAGGAGAATGTCAGCAGG - Intronic
1142960654 17:3550496-3550518 GCAGGCAGGAAAATGAGAGAAGG - Intronic
1143028915 17:3956611-3956633 GCAGCCAGCAGCCTGTGAGATGG + Intronic
1143650750 17:8263150-8263172 GCAGCGAGGAGACCCGGAGATGG + Exonic
1144666285 17:17104589-17104611 GCAGCCAGGGGAAGGTGACAGGG - Intronic
1146322591 17:31858762-31858784 GCTGCCAGGAGCCTGGGCGAGGG - Intronic
1146607307 17:34271667-34271689 GCAGAAAGGAGACAGTCAGATGG - Intronic
1146758750 17:35456674-35456696 GCAGGCAGGAAAATGTGAAAAGG + Intergenic
1147935995 17:44011490-44011512 GCTGTTTGGAGACTGTGAGAGGG - Exonic
1148160347 17:45446200-45446222 TCAGCCAGGAGAGACTGAGATGG - Intronic
1148215640 17:45832803-45832825 ACTGCCAGGGGACTGTGAGGAGG + Intronic
1150236038 17:63593325-63593347 GCAGCAGTGACACTGTGAGAGGG - Exonic
1150391633 17:64793079-64793101 TCAGCCAGGAGAGACTGAGATGG - Intergenic
1150994912 17:70306423-70306445 GCAACCAGGAGACACTGAGCAGG + Intergenic
1152069472 17:78127831-78127853 GCACCCAGGACACTGAGGGAGGG - Intronic
1152285463 17:79410168-79410190 GCGGCCAGGACACTGTGTGCAGG - Intronic
1152431944 17:80253105-80253127 GCAGGCAGGAGTCTGGGAGGCGG + Exonic
1152701744 17:81822990-81823012 GCAGCCAGGTGGCTGGGGGAGGG + Intronic
1153333290 18:3896706-3896728 GGAGACAGGAGGCTGGGAGAAGG - Intronic
1153519735 18:5940383-5940405 GCATCCAGGAGGCTGAAAGAAGG + Intergenic
1153828677 18:8900566-8900588 GCAGCCAGCAGAATCTGGGAGGG + Intergenic
1157491027 18:48123956-48123978 GTAGCCTGGGGACAGTGAGATGG + Intronic
1157539208 18:48487530-48487552 GTGGCCAGGACACTGTGAAAAGG + Intergenic
1157974446 18:52310832-52310854 GCAGCCACAAGAATGTGGGAGGG - Intergenic
1158224380 18:55185320-55185342 GCAGGCAGGAGAGTGTGTGCAGG - Intergenic
1159195124 18:65103543-65103565 TCAGCCAGGTGTCTGTGAGAGGG - Intergenic
1159369920 18:67516736-67516758 GCAGCCCGGGGAGGGTGAGACGG + Exonic
1160292374 18:77606662-77606684 GCATCCAGGAGACCTGGAGAAGG + Intergenic
1160375078 18:78405636-78405658 GCAGCCAAGGGGGTGTGAGAAGG + Intergenic
1163904119 19:20136810-20136832 GCAACCAGGAGAAAGTGAGCAGG - Intergenic
1164032423 19:21419559-21419581 GCAGGCAGGAAAATGTGAAAAGG - Intronic
1164967443 19:32497566-32497588 GCAGCCGGATGACTGTGGGAGGG + Intergenic
1165479730 19:36055308-36055330 GCAGCGAGGAGAAAGTGGGAGGG - Intronic
1166760890 19:45224025-45224047 GCAGCTATGTGGCTGTGAGAGGG + Intronic
1166878259 19:45911445-45911467 CCGGCCTGGAGCCTGTGAGAAGG - Intergenic
1167567988 19:50268855-50268877 GCAGCCAGGAGACGGAGAGAGGG - Intronic
1168289653 19:55351428-55351450 GGAGCCAGGGGACAGTGAGCAGG + Intronic
1168319120 19:55498558-55498580 GCAGGCAGGGCACTGGGAGATGG + Intronic
925728820 2:6901933-6901955 GCCCCCAGGAGAAAGTGAGAAGG - Intergenic
925941838 2:8828158-8828180 GCAGCCAGGAGGGTGAGAGGGGG - Intronic
926295197 2:11564023-11564045 TCAGCCAGGAGACTGTGGAGGGG + Intronic
926787231 2:16530396-16530418 TCAGCCTGGAAACTGTGAGTTGG + Intergenic
926940105 2:18126618-18126640 CCAGTCAGGAATCTGTGAGAAGG + Intronic
927096299 2:19750045-19750067 GTGGCCAGGAGAGTGTCAGAGGG - Intergenic
927125803 2:20011975-20011997 GCAGCCTGAGGACTGTGGGAGGG + Intronic
927743162 2:25590610-25590632 GCAGACAGGAGACTCTGGGGTGG + Intronic
929043857 2:37772171-37772193 GCAGCCAGAGGACACTGAGAAGG + Intergenic
929448874 2:42023205-42023227 GCAGGCAAGAGAGTGTGTGAAGG - Intergenic
931822847 2:65969676-65969698 GCAGCCAAGAGATGGTGATAAGG - Intergenic
932421246 2:71602728-71602750 ACATCCAGGAGATGGTGAGAGGG - Intronic
932574831 2:72956824-72956846 ACAGCAAAGAAACTGTGAGATGG - Intronic
932586939 2:73036335-73036357 GGAGCCAGGAGGCTGGGGGAAGG + Intronic
934558588 2:95300557-95300579 GCAGGCAGGAGCCTGAGAGTCGG + Intronic
935127464 2:100237222-100237244 GCAGCCAGCAGGCGGTGAGAAGG + Intergenic
936080392 2:109428985-109429007 TCAGCCAGGAGACTCTGAACTGG + Intronic
936872291 2:117147251-117147273 GCAGGCAGGAGAGTGTGTGCAGG + Intergenic
937130844 2:119511680-119511702 CCAGCCAGGAGACAGGGAGAGGG - Intronic
939233064 2:139455237-139455259 GCTGTCAGGAGACTGTGTGATGG - Intergenic
939366853 2:141244487-141244509 GCAGCCAGGCAACTGAAAGAAGG + Intronic
939705409 2:145446791-145446813 GCAGGCAGGAGGAGGTGAGAGGG - Intergenic
940387152 2:153086509-153086531 GCAGGCAAGAGACTGTGTGCAGG - Intergenic
941674382 2:168328403-168328425 GCTGCCAGGAGATTGTATGATGG + Intergenic
941706806 2:168667416-168667438 GCAGGCAGGAGAGTGTGACATGG - Intronic
942215998 2:173719636-173719658 GCAGCCTGGAGACTGAGTGGAGG - Intergenic
942232596 2:173874046-173874068 GCAGGAAAGAGACTCTGAGAGGG + Intergenic
942892257 2:181005444-181005466 GAAGCATGTAGACTGTGAGAAGG + Intronic
945804843 2:214478134-214478156 GCAGCCAGGAACAGGTGAGAAGG + Intronic
946163158 2:217848207-217848229 GCAGCCGGGAGGCTGTGCAAAGG - Exonic
946769325 2:223072355-223072377 GTAGAAAGGAGACTGTGTGAAGG + Intronic
948646333 2:239407418-239407440 TCAGCCAATAGACTGTGACAAGG + Intergenic
948813025 2:240494700-240494722 GCTTCCAGGAGACTGTGGGATGG - Intronic
948878205 2:240841367-240841389 GCTGCAAGGAGGCTGGGAGATGG - Intergenic
948947102 2:241226297-241226319 GCAGCCAGGAGGGGCTGAGATGG - Intergenic
1169029153 20:2394807-2394829 GCTGCCAGCAGACAGTGGGATGG + Intronic
1169637868 20:7714733-7714755 ACAGCCAGGACACTGTGTGTTGG + Intergenic
1170413098 20:16111573-16111595 GCAGCCTGGAGACTGAGAGATGG - Intergenic
1170933968 20:20793897-20793919 GACTCCAAGAGACTGTGAGAAGG + Intergenic
1171042940 20:21782493-21782515 CCAGCCAGAAGAGTGTGAGCAGG + Intergenic
1172397770 20:34621599-34621621 GCAGGCAGGAGACTCAGAAAGGG + Intronic
1173613830 20:44389956-44389978 GCAGTCAGGAAAAGGTGAGAAGG + Intronic
1173740741 20:45400034-45400056 GAAGACAGGAAAATGTGAGAAGG + Intronic
1174134238 20:48367936-48367958 GCAGCCAGGAGCCTCCGAGGCGG + Intergenic
1175420992 20:58833430-58833452 GGAGCCAGGAGAATGAAAGAAGG - Intergenic
1175520249 20:59598216-59598238 ACATCCAGGTGACTGGGAGAGGG - Intronic
1176382807 21:6121450-6121472 GCTGCAGGGGGACTGTGAGATGG + Exonic
1179409678 21:41153119-41153141 GCGGCCAGGAGAATGTGCAAGGG + Intergenic
1179740662 21:43416789-43416811 GCTGCAGGGGGACTGTGAGATGG - Exonic
1179886944 21:44318265-44318287 GCAGCGAGGACTCTGTGAAATGG + Intronic
1180068844 21:45426038-45426060 CCAGCCAGGCAACTGTGAAAAGG - Intronic
1180189120 21:46154288-46154310 GCAGCCCGGGGTCTGTGTGATGG + Exonic
1180898992 22:19357397-19357419 GCAGCCAGGAGACTGTCCTGTGG - Intronic
1181093419 22:20489790-20489812 ACAGCCAGGAGTCTGGGAGGTGG + Intronic
1181260454 22:21593517-21593539 GAAGGCAGAAGACTGTGAGATGG - Intronic
1181738998 22:24904979-24905001 GCAGGCAGGAGGCTGAGGGAGGG + Intronic
1182086732 22:27566101-27566123 ACTTCCAGGAGACTCTGAGAAGG - Intergenic
1182349357 22:29690419-29690441 ACAGCCAGCAGGCTGTGAGACGG - Intronic
1183178759 22:36244472-36244494 GCAGCCAGCAGAATTTGGGAGGG - Intergenic
1183310124 22:37105118-37105140 GGAGCCAGGAAGCTGGGAGAAGG - Intronic
1183642735 22:39101909-39101931 GCAGTCAGCAAACTCTGAGAGGG - Exonic
1184596280 22:45516122-45516144 GCGGCCAGGAGAGGGTGACAGGG + Intronic
1185278441 22:49959955-49959977 GCAGCCAGGACCGTGTCAGACGG + Intergenic
1203295987 22_KI270736v1_random:43568-43590 GCAGCCAGAAGACACTGAGAAGG + Intergenic
949384811 3:3489463-3489485 GCTTCCTGGAGACTGTGTGAAGG + Intergenic
949635360 3:5976337-5976359 GCAGGCAGGAAAATGTGAAAAGG - Intergenic
950078777 3:10206371-10206393 GCAGCCAGGAGAATGCGAGCTGG - Intronic
950611529 3:14130196-14130218 CAAGCCAGGACACTGAGAGATGG - Intronic
950652179 3:14414123-14414145 GGAGCCGGGAGACAGAGAGAAGG - Intronic
952232623 3:31447797-31447819 GCAGCCAGGAGACTGTAGGAAGG + Intergenic
953337286 3:42104102-42104124 GCAGCAGGGAGGCTGGGAGAGGG + Intronic
953460770 3:43079910-43079932 TCTGCCAGGAGACAGTGAGGCGG + Exonic
953477035 3:43213978-43214000 CCAGCCAGGAGGCTGTGAGATGG + Intergenic
953713289 3:45293478-45293500 GCAGGCAGGAAAATGTGGGAAGG + Intergenic
954709112 3:52496229-52496251 GCAGCCAGGAGCCTGTCACAGGG - Intronic
955255089 3:57323096-57323118 GCATCCAGGACACTGCAAGATGG + Intronic
955689988 3:61581539-61581561 GTGGCCACGAGAATGTGAGAGGG + Intronic
955960550 3:64336538-64336560 GCAGCCAGAAGAATGTAATAAGG + Intronic
956260516 3:67335703-67335725 GCAGTCAGCAGATTGTCAGAGGG - Intergenic
956388578 3:68747460-68747482 GCAGGCAGGAGAGTGTGTGCAGG - Intronic
956718492 3:72098728-72098750 TCTGCAAGGAGACTCTGAGATGG + Intergenic
957735455 3:84196695-84196717 GCTGCCTGGAGACAGTGAGTTGG + Intergenic
958580013 3:96006831-96006853 ATGGCCAGAAGACTGTGAGAAGG + Intergenic
958790475 3:98645432-98645454 GCAGCCAGCAGAATTTGGGAGGG - Intergenic
959214927 3:103438750-103438772 GCAGGCAAGAGAGTGTGTGAAGG + Intergenic
959559853 3:107767270-107767292 ACTGGCAGGAGACTGGGAGATGG + Intronic
959559922 3:107767865-107767887 ACTGACAGGAGACTGGGAGATGG + Intronic
960091575 3:113645343-113645365 GAAGCCAGGAGACAGTGGAATGG - Intergenic
960227102 3:115181258-115181280 GCAGACAGAAGAATGTGAAAAGG + Intergenic
961363092 3:126380318-126380340 GCAGGCAGCAGGCTGGGAGAAGG - Intergenic
961818013 3:129561273-129561295 GCAGCCAGGAGGCTGTGCCTGGG + Intronic
962040846 3:131706001-131706023 GCAGCCAGGAGAAAGAGAAAAGG + Intronic
962257202 3:133880679-133880701 GCAGCGAGCAGGCTGTGTGAGGG - Intronic
962347351 3:134627929-134627951 GGAACAAGGAGACTGTGAAAAGG - Intronic
962442022 3:135429261-135429283 GCAGTTAGGAGACTGTGAGAAGG + Intergenic
962957348 3:140278431-140278453 GCAGCCATGAGCCTGGGAAAAGG - Intronic
963430757 3:145198791-145198813 GAAGCCAGGAGAGAGTGACATGG + Intergenic
965395439 3:168155607-168155629 GTAGTAGGGAGACTGTGAGAAGG - Intergenic
965606971 3:170507461-170507483 GAAGCCCGGAGACTGGGGGAGGG + Intronic
965978223 3:174652514-174652536 GCAGGCAAGAGACTGTGTGCAGG + Intronic
967509532 3:190293177-190293199 GCAGGCAAGAGAATGTGTGAAGG + Intergenic
967627418 3:191702777-191702799 GCTGCCTGGAGACTGTGCAATGG + Intergenic
967875758 3:194267564-194267586 ACTGCCAGGAGACTGTGAGGAGG + Intergenic
967881576 3:194305511-194305533 ACAGCCTGGAGCCTGTGAGTGGG + Intergenic
968040107 3:195581606-195581628 GCAGACAGGAGAGGGGGAGATGG - Intronic
969367294 4:6704050-6704072 GCACCGAGTAGACTGTGAAAAGG - Intergenic
969398950 4:6940812-6940834 GCAGCCAGGAGGCTGTGCTTGGG + Intronic
969551598 4:7871902-7871924 GAAGCCAAGACACTGTAAGAAGG + Intronic
972325877 4:38014759-38014781 GGAGCCAGGAGCCTGTGCGCAGG + Exonic
972557112 4:40192985-40193007 GCAGCTGTGAGGCTGTGAGATGG + Intronic
972808376 4:42554880-42554902 GCAGGCAGAAAACTGTGAAAAGG + Intronic
972976343 4:44640997-44641019 GCAACCAGGAAACTGTGAGAAGG - Intronic
974940789 4:68465300-68465322 GCAGCCATCAGACTCTGACAAGG - Intronic
975404806 4:73976954-73976976 CCAGCCAGGAGACTGTGGGATGG - Intergenic
978718378 4:111874227-111874249 GAAGACAGAAAACTGTGAGACGG + Intergenic
979610446 4:122683689-122683711 GCACCTGGAAGACTGTGAGAAGG - Intergenic
981362394 4:143862793-143862815 GCAGGCAGCAGAATCTGAGATGG + Intergenic
981373124 4:143983562-143983584 GCAGGCAGCAGAATCTGAGATGG + Intergenic
981382219 4:144086836-144086858 GCAGGCAGCAGAATCTGAGATGG + Intergenic
981442611 4:144799867-144799889 GCAGCCAGAAGAATTGGAGAGGG - Intergenic
981826206 4:148944352-148944374 GCAGCCAGGATATTGTCAGGAGG + Intergenic
981965664 4:150599259-150599281 GCAGAAAGGGGAGTGTGAGATGG - Intronic
982191063 4:152855710-152855732 GCTGCCAGGAGATTGTGTGATGG - Intronic
983884788 4:172968359-172968381 TCAGCTTGGAGCCTGTGAGAGGG - Intronic
984505834 4:180617360-180617382 GCAGCCAGCAAACAGTGAGGTGG - Intergenic
984951880 4:185014144-185014166 GCAGTCAGGCGGCAGTGAGAGGG - Intergenic
985250033 4:188014650-188014672 GCAGCCTTGAGAGTGTGAAATGG - Intergenic
985384872 4:189434682-189434704 GCTGCCAGGAGATGGGGAGAAGG + Intergenic
985989077 5:3540182-3540204 GCAGCCAGACCACTGTTAGATGG - Intergenic
986734019 5:10654980-10655002 GCTGCCAGGAGTCTGTCAGGAGG - Intergenic
987342137 5:16948644-16948666 GGAGAGAGAAGACTGTGAGATGG + Intergenic
987794415 5:22608173-22608195 GCAGCCAGGAGGTGGTGAGGGGG + Intronic
988642412 5:33055595-33055617 TCATCCAGGAGGCTGAGAGATGG - Intergenic
989338520 5:40348324-40348346 GCTGCTGGGAGACTGTGGGATGG + Intergenic
990639156 5:57762258-57762280 GCAGCCATGGGCCGGTGAGAAGG - Intergenic
993022196 5:82605304-82605326 GCTGCCTGGAGACCGTGTGAAGG + Intergenic
995811815 5:116115177-116115199 GCAACCAGGAGACTGTATAAAGG - Intronic
997786649 5:136719560-136719582 GCAGCAAGGACAGAGTGAGAAGG + Intergenic
998545575 5:143024474-143024496 TCAGCCAAGAGACAGTGAGCAGG + Intronic
999404657 5:151296327-151296349 CCAGCACGCAGACTGTGAGAGGG - Intronic
999424154 5:151472298-151472320 GCAGGCAGAAGAATGTGAAAAGG - Intronic
999673782 5:153979273-153979295 GCAGCCAGGGATCTGTGATAGGG - Intergenic
1000019541 5:157307070-157307092 GCATTCAGGAGACTATTAGAAGG + Intronic
1001153789 5:169255374-169255396 GGAGGCAGAAGACAGTGAGATGG + Intronic
1001666632 5:173438541-173438563 GCTGCCAGCAGGCTGTGAGGTGG + Intergenic
1002538049 5:179888990-179889012 GAAGCCAGGACAGTGTGAGCTGG + Intronic
1003145965 6:3511030-3511052 GCCTCCAGGAGTCTGGGAGAAGG + Intergenic
1003241238 6:4347464-4347486 ACATGCAGGAGACTGCGAGATGG - Intergenic
1004450639 6:15742196-15742218 GCAGGCAAGAGAATGTGTGAAGG + Intergenic
1005956988 6:30671143-30671165 GCAGTGAGGAGACTGTGAGTAGG - Exonic
1007232750 6:40359978-40360000 AAAGCCAGGAGCCTGTGAGCAGG + Intergenic
1007261673 6:40568397-40568419 GCATCAAGGAGACTCTTAGACGG + Intronic
1008140394 6:47825099-47825121 CCAGCCAGGAGTCTGTGAAATGG + Intronic
1008674837 6:53808152-53808174 GAAGCAGGGAGACTGGGAGAGGG + Intronic
1009521960 6:64694487-64694509 GCAATCAGGAGACTGTGAGGAGG + Intronic
1010496426 6:76538112-76538134 GCTACCAGGAGACCATGAGATGG - Intergenic
1010613417 6:77984495-77984517 GGTGCCAGGAGACAATGAGATGG + Intergenic
1010868074 6:81005139-81005161 GCAGGCAGAAAAATGTGAGAAGG + Intergenic
1011150111 6:84262657-84262679 GCAGCCAGGATACTTTAAAAAGG - Intergenic
1011160414 6:84383104-84383126 GCTGCCAGGATATTGTGTGATGG - Intergenic
1013146574 6:107400165-107400187 GCAGTGGAGAGACTGTGAGAAGG + Intronic
1013367526 6:109447064-109447086 GCACCCAGGAGATGGTGAGTGGG - Exonic
1013615348 6:111837837-111837859 GCTGCCATGAGAAAGTGAGATGG - Intronic
1013871961 6:114774900-114774922 GCAGTCAGGATACTGGCAGAGGG + Intergenic
1013996167 6:116310766-116310788 GCAGAGAGGAGACTATGAGGAGG - Intronic
1014331748 6:120076252-120076274 CATGCCAGGACACTGTGAGAAGG + Intergenic
1016142106 6:140625805-140625827 GCAGGCAAGAGAGTGTGTGAAGG + Intergenic
1016497754 6:144683464-144683486 GGAGCCAGGAGCCTGGGAGGTGG - Intronic
1017800525 6:157891729-157891751 TCAGCCAGCAGGCTGTGGGAAGG + Intronic
1019448813 7:1085463-1085485 GCAACCATGAGACGGGGAGAAGG + Intronic
1019541948 7:1555561-1555583 GGAGGGAGGAGACAGTGAGACGG + Intronic
1019997372 7:4733538-4733560 GCAACCATGAGACTATGAGCTGG - Intronic
1021784259 7:24136569-24136591 GTAGCCAGGAGAAGGGGAGATGG - Intergenic
1022438049 7:30408857-30408879 GCTGACAGGAGACAGAGAGAGGG - Intronic
1022818020 7:33932118-33932140 CCAGCCTGGCGACTCTGAGAGGG - Intronic
1023364865 7:39453594-39453616 GCAGACAGCAGACAGTCAGATGG + Intronic
1023993977 7:45147323-45147345 CCAGCAAGGAGACTTTGAGCAGG + Intergenic
1024490357 7:49975359-49975381 GCAGTCAGGAAACTATGAGAAGG - Intronic
1026606242 7:71818418-71818440 GTAGCCAGGAGAAGGTGGGAAGG + Intronic
1026769827 7:73188611-73188633 GCATTCAGGACACTGTGATAGGG - Intergenic
1026922486 7:74166419-74166441 GCAGGCAGGAGAGTGTGTGCAGG + Intergenic
1026963028 7:74421519-74421541 CCACCCAGGAGACAGAGAGACGG - Intergenic
1027010695 7:74741993-74742015 GCATTCAGGACACTGTGATAGGG - Intronic
1027077347 7:75204047-75204069 GCATTCAGGACACTGTGATAGGG + Intergenic
1027176555 7:75907574-75907596 GCAGCAAGGAGACCGGAAGAAGG + Intronic
1027250899 7:76398034-76398056 GCTGCCAGGAGACAGGGAGCAGG - Intronic
1027375313 7:77542297-77542319 GCAGGCTGGAGAAGGTGAGATGG - Intronic
1028334647 7:89636745-89636767 ACTGCCCGGAGACTGTGAGAAGG - Intergenic
1030501010 7:110358616-110358638 GGAGGCAGGAGACAGTGATATGG - Intergenic
1032414187 7:131723727-131723749 ACATCCAGGAGACAGAGAGAGGG - Intergenic
1032974323 7:137204828-137204850 GGAGCAAGGAGGGTGTGAGAGGG - Intergenic
1033965065 7:146965285-146965307 GCAGCCCAAAGACTGTGAGATGG - Intronic
1034263707 7:149771972-149771994 GCAGCCTGGAGTCTGAGAGGGGG - Intronic
1034547956 7:151801351-151801373 GCAGCAAGGAAGCTGGGAGAAGG + Intronic
1034725084 7:153328389-153328411 GCAGGCAGAAAAATGTGAGAAGG + Intergenic
1034863347 7:154619034-154619056 GCAGGCAGGAGAATGTGTGGAGG - Intronic
1035381880 7:158445717-158445739 GGGGCCAGGAGACCCTGAGAGGG + Intronic
1036502246 8:9324789-9324811 GCAGCCAGAAGACGGTCAGACGG - Intergenic
1037666316 8:20973105-20973127 GCAGCAAGGAAACTCTAAGAGGG + Intergenic
1038159275 8:25021323-25021345 GCAGTCAAGAGACTGTGTGCAGG - Intergenic
1038573854 8:28687016-28687038 GAAGCCATGAGACTTTGAGGTGG + Intronic
1039228982 8:35422129-35422151 GCAGCTCGGAGAGTGTGAGATGG - Intronic
1040857647 8:51965603-51965625 GAAGCCAGAAGACAGTGGGACGG - Intergenic
1040989654 8:53336078-53336100 GCAGCCAGCAGAATTTGGGAGGG - Intergenic
1041208938 8:55526864-55526886 GCAGTCAGGAGAATGTAAGGAGG + Exonic
1043035209 8:75188894-75188916 GCAGCGAGGAGATGGTGGGAAGG + Intergenic
1045675734 8:104606621-104606643 GCAGGCAAGAGACTGTGTGCAGG - Intronic
1045945111 8:107786811-107786833 GTAGCCAGGAGACTACGGGATGG - Intergenic
1045945261 8:107788508-107788530 GCTGCCAGGAGACTACGGGATGG + Intergenic
1047862173 8:128979344-128979366 GCAGCCAGGAATGTCTGAGAAGG - Intergenic
1048908821 8:139114776-139114798 GCAGGCAGAAAAATGTGAGAAGG - Intergenic
1049234297 8:141504202-141504224 ACAGGCAGGAGACTGGGACAAGG + Intergenic
1049546821 8:143236055-143236077 GCTGCCAGGTGACAGAGAGATGG + Intergenic
1049624649 8:143614576-143614598 CCAGCCAGGAGTCGGGGAGAGGG - Intronic
1049657253 8:143804362-143804384 CCAGCCAGGAGACTGTGTCAAGG + Intronic
1050402088 9:5266735-5266757 GCAGTTGGGAGACTGTGAGAAGG - Intergenic
1051480938 9:17559784-17559806 GCAGCCAGGAGGCGGAGTGAAGG + Intergenic
1051957658 9:22715479-22715501 AAAGCCAGAAGACTGTGGGAAGG - Intergenic
1055821623 9:80271646-80271668 GCAGGCAAGAGACTGTGTGCAGG + Intergenic
1057154495 9:92829269-92829291 GCTGCCTGGAAACTGTGTGATGG + Intergenic
1057423078 9:94927667-94927689 GCAGCCAGGGGAGGGAGAGATGG - Intronic
1057711874 9:97452963-97452985 GCAGTCTGGGGACTGGGAGAGGG + Intronic
1059807734 9:117822107-117822129 GCATCCATGAGACAGAGAGAGGG - Intergenic
1059829123 9:118072895-118072917 CCAGCCTAGAGACAGTGAGACGG - Intergenic
1060649616 9:125314077-125314099 GAAGCCAGGAGATTGTGGTATGG + Intronic
1060915227 9:127384907-127384929 GCAGCCAGAGGAATGAGAGATGG + Intronic
1061827912 9:133273439-133273461 GCAGCCAGGAGCTGGTGAGCTGG - Intronic
1061908422 9:133710559-133710581 GCAACCAGGAGTCTCTGAGCAGG + Intronic
1062250117 9:135589596-135589618 GCTGCCAGGAGCCTTTGGGACGG - Intergenic
1062391371 9:136335279-136335301 GCAGGAAGGAGGCTGTGAGTGGG - Intronic
1203689461 Un_GL000214v1:29154-29176 GCATGCAGGAAACTGGGAGAGGG - Intergenic
1203646814 Un_KI270751v1:74899-74921 GCATGCAGGAAACTGGGAGAGGG + Intergenic
1185592240 X:1285250-1285272 ACAGCCAGGGGGCTGTGAAAAGG + Intronic
1185821479 X:3209008-3209030 GTGGCCAGGAGACTGTGGGCTGG - Intergenic
1186193945 X:7093456-7093478 GGCGCCAGGAGGCTGTGAGCGGG + Intronic
1186789719 X:12985209-12985231 GCAGGCAGGAGGCTGGGGGATGG - Intergenic
1187136243 X:16550416-16550438 GCAGGTAGGAGAATGTGAGGGGG - Intergenic
1187816010 X:23232621-23232643 GCAGGCAGGAGAGTGTGTGCAGG - Intergenic
1188461444 X:30431990-30432012 GCAGGCAAGAGACTGTGTGAAGG + Intergenic
1189215580 X:39320297-39320319 GCTGCCAGGAGATGGTGAGCTGG + Intergenic
1189325272 X:40107767-40107789 CCAGCCAGGGGGCTGTGAGAGGG - Intronic
1191047149 X:56150657-56150679 GCAGCCAGGAGGTTGTGTAATGG - Intergenic
1192059834 X:67812625-67812647 GCAGTCTGGAGACTGTGAGAAGG + Intergenic
1192352524 X:70368956-70368978 GCAGCAATGAGGCTGTGGGAGGG - Intronic
1193012159 X:76688246-76688268 GCAGTGGGGAGACTGTGAGAAGG - Intergenic
1194130091 X:90070811-90070833 GCAGGCAGGAAAATGTGAAAAGG + Intergenic
1194443838 X:93963642-93963664 GCAGCCAGAAAAATGTGAAAAGG + Intergenic
1194830900 X:98621056-98621078 GCAGGCAAGAGAGTGTGTGAAGG + Intergenic
1194844328 X:98785166-98785188 GGAGGCAGGAGAATGAGAGAGGG - Intergenic
1196310785 X:114162572-114162594 GCTGCCTGGAGACTATGAGATGG - Intergenic
1196389837 X:115195846-115195868 GCATCCAAGAGACTGTGAGAAGG + Intronic
1196964686 X:121042690-121042712 GCAGTCAGCAGACTGTTACAGGG + Intergenic
1198494448 X:137177325-137177347 GCAGTGCGGAGACTGTAAGATGG + Intergenic
1198622889 X:138533795-138533817 GCTGCCATGAGACTGTGGGATGG + Intergenic
1198725115 X:139668407-139668429 GTTACCAGGAGACCGTGAGATGG - Intronic
1198929574 X:141838999-141839021 GCTGCCAGGAGATTGTATGATGG - Intronic