ID: 1126817238

View in Genome Browser
Species Human (GRCh38)
Location 15:52466096-52466118
Sequence CTGTGAGAAGGAACTGCTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 1, 2: 3, 3: 27, 4: 265}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126817233_1126817238 9 Left 1126817233 15:52466064-52466086 CCCTAGATCTAACATGCGGAGCA 0: 1
1: 0
2: 0
3: 1
4: 45
Right 1126817238 15:52466096-52466118 CTGTGAGAAGGAACTGCTTGAGG 0: 1
1: 1
2: 3
3: 27
4: 265
1126817231_1126817238 18 Left 1126817231 15:52466055-52466077 CCTTCTAAGCCCTAGATCTAACA 0: 1
1: 0
2: 0
3: 8
4: 99
Right 1126817238 15:52466096-52466118 CTGTGAGAAGGAACTGCTTGAGG 0: 1
1: 1
2: 3
3: 27
4: 265
1126817234_1126817238 8 Left 1126817234 15:52466065-52466087 CCTAGATCTAACATGCGGAGCAG 0: 1
1: 0
2: 0
3: 1
4: 53
Right 1126817238 15:52466096-52466118 CTGTGAGAAGGAACTGCTTGAGG 0: 1
1: 1
2: 3
3: 27
4: 265
1126817229_1126817238 20 Left 1126817229 15:52466053-52466075 CCCCTTCTAAGCCCTAGATCTAA 0: 1
1: 0
2: 0
3: 8
4: 137
Right 1126817238 15:52466096-52466118 CTGTGAGAAGGAACTGCTTGAGG 0: 1
1: 1
2: 3
3: 27
4: 265
1126817228_1126817238 25 Left 1126817228 15:52466048-52466070 CCTTGCCCCTTCTAAGCCCTAGA 0: 1
1: 0
2: 0
3: 14
4: 158
Right 1126817238 15:52466096-52466118 CTGTGAGAAGGAACTGCTTGAGG 0: 1
1: 1
2: 3
3: 27
4: 265
1126817230_1126817238 19 Left 1126817230 15:52466054-52466076 CCCTTCTAAGCCCTAGATCTAAC 0: 1
1: 0
2: 0
3: 5
4: 114
Right 1126817238 15:52466096-52466118 CTGTGAGAAGGAACTGCTTGAGG 0: 1
1: 1
2: 3
3: 27
4: 265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126817238 Original CRISPR CTGTGAGAAGGAACTGCTTG AGG Intronic
900765998 1:4505853-4505875 CCCTGAGAAGCAACTGCTAGGGG - Intergenic
905105493 1:35561201-35561223 CTGTGAGCAGTCACTGCTTAAGG + Exonic
909331502 1:74417541-74417563 CTGTGAGAAACAAATGGTTGGGG - Intronic
910150491 1:84137154-84137176 CTGCTATAAGGAACTGTTTGAGG - Intronic
910865472 1:91784517-91784539 CTGTGGGAAGGCACAGGTTGTGG + Intronic
911135445 1:94434308-94434330 CTTTTTGAAGGATCTGCTTGAGG + Intronic
912028334 1:105206368-105206390 CTCTGAGTAGGAACTGGGTGTGG - Intergenic
912519974 1:110238604-110238626 CTGTGAGCAGGGAGTGCATGGGG - Intronic
915959825 1:160256389-160256411 CTGTAGGAAGGCACTTCTTGAGG - Intronic
916332630 1:163634404-163634426 CTGTGAGAAGAAACTACTCTGGG - Intergenic
916470347 1:165117484-165117506 CTGAGAGAGGGAACGGCTGGTGG + Intergenic
918781171 1:188702354-188702376 CTGTGAGAAAGAATTGCTCCAGG - Intergenic
919434558 1:197541664-197541686 CTGTGAGTAGGAATTTCTAGTGG - Intronic
921410320 1:214829584-214829606 CTGTGAGAAATAAATGTTTGTGG - Intergenic
921611512 1:217217549-217217571 CTGTGAGAATGAAATACTTCTGG + Intergenic
922563149 1:226583600-226583622 CTGTGAGGAGGAGCTCCCTGAGG - Intronic
922981159 1:229828078-229828100 AGGTGAGAAGGAAGTCCTTGAGG - Intergenic
1063895374 10:10676042-10676064 CTGGGAAGAGGAACTGCTGGTGG + Intergenic
1065647515 10:27851066-27851088 GTATGAGAAGAAACTGTTTGAGG + Intronic
1066623928 10:37386221-37386243 CTGAGACAAGGAACTGCTCAAGG - Intergenic
1069360193 10:67633142-67633164 CTGTGAGGAGGAATGGATTGGGG - Intronic
1069380155 10:67835044-67835066 CTCTGAGAAGGAAAAGCTTCAGG + Intronic
1071246707 10:83773099-83773121 CTGTGAGAAGGAACAGCACTAGG + Intergenic
1071260065 10:83911659-83911681 CTGTGAGAAATAAATGTTTGTGG - Intergenic
1071921673 10:90357269-90357291 TTGGAAGATGGAACTGCTTGGGG - Intergenic
1072094991 10:92169437-92169459 CTGCTATAAAGAACTGCTTGAGG - Intronic
1072234692 10:93443344-93443366 CTGAGTGAGGAAACTGCTTGAGG - Intronic
1072910975 10:99500433-99500455 CTTGGAGAAAGAACTGGTTGGGG - Intergenic
1074018196 10:109557130-109557152 CTGGGAGAAGAAGTTGCTTGAGG + Intergenic
1076322385 10:129593106-129593128 CCCTGAGAAGAAACGGCTTGGGG - Intronic
1080320520 11:31004007-31004029 CTGAGAGAAGGAACTTTTGGAGG + Intronic
1081741623 11:45444958-45444980 CAGAGAGAAGGAAGTGCCTGGGG + Intergenic
1082255410 11:50028054-50028076 TTGTGGGAGGGAACTGGTTGGGG + Intergenic
1083010161 11:59389180-59389202 TTGTGAGAAGGAACTTCTGCAGG - Intergenic
1084501077 11:69535892-69535914 GAGTGTGAAGGAGCTGCTTGTGG + Intergenic
1086575473 11:88335242-88335264 CTCGGAGCAGGAACTGTTTGAGG - Intronic
1087292522 11:96335624-96335646 CTGTGAGAAGAGGCTGCTGGAGG + Intronic
1087812070 11:102619192-102619214 CTGTGATAATGCAATGCTTGTGG + Intronic
1089049186 11:115531244-115531266 CTGAGAGATGAGACTGCTTGGGG + Intergenic
1090167912 11:124570904-124570926 CTGGGTCAAGGAACTGATTGTGG - Exonic
1090830223 11:130416071-130416093 CTGTGAGGAGGCACAGCTGGAGG + Intronic
1092167698 12:6352980-6353002 CTGGGAGGAGGAACTGCAGGGGG + Intronic
1094756347 12:33473707-33473729 ATTTGAAAAAGAACTGCTTGAGG + Intergenic
1095393124 12:41732568-41732590 CTGTGATAAGGAATTTATTGAGG + Intergenic
1098277110 12:68823917-68823939 CAGTAATAATGAACTGCTTGTGG + Intronic
1100181953 12:92095552-92095574 CTGTTGGAAGTAACTGCTTGAGG + Intronic
1104762265 12:131304569-131304591 CTGTGAGAGGTACCTGCTTAGGG + Intergenic
1104817511 12:131656227-131656249 CTGTGAGAGGTACCTGCTTAGGG - Intergenic
1105063126 12:133172343-133172365 CTGTGAGGAAGAGCTGCTTTGGG + Intronic
1106858835 13:33882652-33882674 ATGTGAGAAGTAAATGTTTGTGG + Intronic
1106956847 13:34948695-34948717 CTGTAAAACGGAACTGCTAGAGG - Intronic
1107561324 13:41559845-41559867 CTGTGAGAAATAAATGCTTGTGG - Intergenic
1108806764 13:54167315-54167337 CTATGAAAAGGAACTGACTGAGG - Intergenic
1110272261 13:73604213-73604235 CTGTGAGAAATAAATGGTTGTGG - Intergenic
1110384257 13:74890457-74890479 CTGTGAGAAGGATCTGCTGTGGG - Intergenic
1111420636 13:88005863-88005885 CTGTGAGAAGGAATTGCTTCAGG - Intergenic
1112595796 13:100805885-100805907 CTGTGACAAAGAAATGTTTGTGG - Intergenic
1113082657 13:106534938-106534960 CTGTGAGAAGGGACTCCGTGTGG - Exonic
1113596334 13:111536782-111536804 CTTTGACAAGGAACAGTTTGGGG + Intergenic
1116911420 14:50469656-50469678 ATCTGAGGAGGAAATGCTTGTGG + Intronic
1117706042 14:58469163-58469185 CTATGAGAACGAAGTGTTTGTGG - Intronic
1118345544 14:64938193-64938215 CTGTAAGAAGGAAGGGGTTGGGG - Intronic
1118524947 14:66629470-66629492 CTGCCTGAAGGAACTGCCTGAGG + Intronic
1121285907 14:92735655-92735677 CTGTTAGGAGGCAGTGCTTGAGG - Intronic
1122151550 14:99728668-99728690 CTGTGGGAAGGGGCTGCTTCTGG - Intergenic
1122563097 14:102631145-102631167 CTGTGAGAAGTGACTGCATGGGG + Intronic
1122744773 14:103891228-103891250 CTGTGGGAAGGCAGGGCTTGCGG - Intergenic
1123098513 14:105777730-105777752 CTGTGAGAAGGACATGATTATGG - Intergenic
1123107425 14:105849126-105849148 CTGTGAGAAGGACATGATTATGG + Intergenic
1123642858 15:22414483-22414505 CTGCTATAAAGAACTGCTTGAGG - Intergenic
1123670029 15:22647095-22647117 CTCTGAAAAGGCACTGCTGGTGG + Intergenic
1124526001 15:30453510-30453532 CTCTGAAAAGGCACTGCTGGTGG + Intergenic
1124772654 15:32554175-32554197 CTCTGAAAAGGCACTGCTGGTGG - Intergenic
1125800078 15:42438004-42438026 CTTTCAGAAGGAACTGCTTAAGG - Intronic
1126817238 15:52466096-52466118 CTGTGAGAAGGAACTGCTTGAGG + Intronic
1129350895 15:74955537-74955559 GGGTGAGAATTAACTGCTTGAGG - Exonic
1130007106 15:80110210-80110232 ATGTGGGAAGGAACTGCATGAGG + Intronic
1130200997 15:81826662-81826684 CTATGAGAAGGAACTGAATGGGG + Intergenic
1130510185 15:84582753-84582775 CTGTGAGAAATAAATGTTTGTGG - Intergenic
1130964415 15:88686304-88686326 CTGTTCAAAGGAACTGTTTGTGG + Intergenic
1131764825 15:95664077-95664099 CTGTGAAAAGGCACTAATTGGGG - Intergenic
1132899724 16:2246621-2246643 CTTTGGGAATGATCTGCTTGAGG + Intronic
1133336981 16:5012602-5012624 CTGTGAGAAAGAACTACCTGAGG + Intronic
1135565539 16:23508843-23508865 CTGTGAGGAGGAGCTGGTTTAGG - Intronic
1136316566 16:29457928-29457950 CTGTGAGAAGTCACTGCTTTGGG + Exonic
1136431142 16:30197270-30197292 CTGTGAGAAGTCACTGCTTTGGG + Exonic
1137314295 16:47300015-47300037 CTATGAGAAGGAACTACTCCAGG - Intronic
1137550300 16:49433039-49433061 CCTTGAGAAGGAGCTGCTTCTGG + Intergenic
1137574359 16:49588974-49588996 CTGTGAGCAGTAGCTTCTTGGGG - Intronic
1137828148 16:51517320-51517342 CTGGGAGAAGGGGCGGCTTGTGG + Intergenic
1138190422 16:55009621-55009643 CTGGGAGAAGGAAATCCATGTGG + Intergenic
1138351223 16:56347327-56347349 CTGACAGCAGGAACTGCCTGGGG - Exonic
1139603058 16:67998386-67998408 CTGTGAGCTGGCACTGCTGGGGG - Intronic
1140405794 16:74710550-74710572 CCGTGAGCACTAACTGCTTGGGG + Intergenic
1140640383 16:76964989-76965011 CTGTGAGCAGACACTGCATGGGG + Intergenic
1141252388 16:82370224-82370246 CTTAGAGAAAGCACTGCTTGGGG - Intergenic
1141274558 16:82574978-82575000 ATGTGAGAAGGCACTTCATGTGG - Intergenic
1141484194 16:84328093-84328115 AGGTGAGAAGGTGCTGCTTGGGG + Intronic
1143097047 17:4483660-4483682 GGGTGAGAAGGAAGTCCTTGGGG + Intronic
1143730683 17:8881071-8881093 CTGAGAAAAGGAACTGCCAGGGG - Intronic
1144382221 17:14712364-14712386 CTGTGAGATGAAACTGGTTAAGG + Intergenic
1144752979 17:17662847-17662869 CTGGGAGAAGGAACAGCAGGAGG - Intergenic
1144785899 17:17831399-17831421 CTCTGAGAACGCACTGCTCGGGG + Intronic
1147041946 17:37726113-37726135 GTGGGAAAAGGAACTGCTGGGGG + Intronic
1147981014 17:44274007-44274029 CTGGGAGGAGGATCTGCTTGAGG + Intergenic
1148016880 17:44528146-44528168 CGGTGAGCTGGCACTGCTTGGGG - Intergenic
1151813530 17:76459392-76459414 CTGGGAGAAGAAACTATTTGAGG - Intronic
1151880318 17:76890801-76890823 CTGTGAGAAATGAATGCTTGAGG - Intronic
1153011292 18:542006-542028 CTTAGAGAAGGAACTCCATGTGG + Intergenic
1155496199 18:26445327-26445349 CTGAGAGCAGGAACTGTTTCTGG + Intergenic
1159951834 18:74489800-74489822 CTGTGAGAAAAAAATGCCTGTGG - Intergenic
1160157524 18:76444839-76444861 CTGTGAGAGGGCACAGCATGGGG - Intronic
1161274873 19:3410349-3410371 CTCTGAGAAGGAGCTATTTGAGG + Intronic
1162463962 19:10829931-10829953 CTGTGAGTGGGAAGTGCCTGAGG + Intronic
1163653095 19:18530190-18530212 CTGTGAGAAGGCACAGCTGGAGG - Intergenic
1164618196 19:29678984-29679006 CTGTGCGAAGGACCGGCTTCTGG - Intergenic
1165341538 19:35215714-35215736 TTGTGGGAAGCATCTGCTTGAGG + Intergenic
1165610899 19:37151427-37151449 CTCTGAGAAGGCACTGAATGAGG - Exonic
1165614269 19:37185065-37185087 CTCTGAGAAGGCACTGAATGAGG - Exonic
1167037730 19:47004025-47004047 CTATGAGAAGCCACTGCTTTGGG + Exonic
1168629209 19:57944085-57944107 CTGAGAGGAGGAACCGTTTGTGG - Intronic
926832425 2:16978280-16978302 CTGTGAGAAAGAAATGACTGTGG - Intergenic
926971658 2:18472929-18472951 CTGAGAGAAGCAAGTGCTGGTGG - Intergenic
928358401 2:30642178-30642200 CTGTGAGAAAGCACTGGTTGAGG + Exonic
928970511 2:37023352-37023374 CTTTAAATAGGAACTGCTTGGGG - Intronic
930387627 2:50717671-50717693 CTGTGAGAAGTAAATGTTTGTGG - Intronic
931483159 2:62663520-62663542 CTGTCAGAAAAAAATGCTTGTGG + Intergenic
932099642 2:68886201-68886223 CTGGGAGATGTTACTGCTTGAGG + Intergenic
932129351 2:69173786-69173808 CTGAGACATGGAGCTGCTTGGGG - Intronic
934048751 2:88192573-88192595 CTGTAAGAAGCAAGGGCTTGGGG - Intergenic
934057316 2:88262236-88262258 GTGTGAGAAGGAACAGATGGAGG - Intergenic
937302874 2:120853907-120853929 CTATGAGATGGAGCAGCTTGGGG + Intronic
938472833 2:131581520-131581542 GTGTGTGTAGGAACTGCTTTGGG + Intergenic
938767227 2:134468405-134468427 CTGTGAGATGGAAGTGTCTGTGG + Intronic
938792363 2:134688179-134688201 CAGTGAGAAGCTCCTGCTTGGGG - Intronic
939818688 2:146929061-146929083 CTGGGAGTAGGAAATGATTGAGG - Intergenic
940040064 2:149350902-149350924 CTGTGTGAAAGATCTGCCTGTGG - Intronic
940096090 2:149977866-149977888 CCTTCAGAAGGACCTGCTTGAGG - Intergenic
941773050 2:169363712-169363734 GTGTGAGAAGGGGCTGTTTGCGG + Intergenic
942514772 2:176740294-176740316 TTGTCTGATGGAACTGCTTGTGG - Intergenic
942747451 2:179251268-179251290 GGGTGAGAAGGAACTGGGTGTGG + Intronic
945664615 2:212725337-212725359 CTGTGAGAAATAAATGTTTGTGG - Intergenic
947638827 2:231694503-231694525 CTGCCAGAAGGAACTGGTGGAGG - Intergenic
948055087 2:235005089-235005111 CTGCGAGGAAGCACTGCTTGTGG + Intronic
1169849197 20:10031853-10031875 CTGTGAGCTGGCACTGCTGGGGG - Intronic
1169988166 20:11469923-11469945 CTGTGAGAAGGAACTGTTCTGGG - Intergenic
1170132015 20:13030769-13030791 CAGGCAGAAGGAAGTGCTTGAGG - Intronic
1170293435 20:14797078-14797100 CTGTGATAATGAATTGCTTATGG - Intronic
1170686557 20:18574857-18574879 CTGGAAGATAGAACTGCTTGAGG - Intronic
1172429938 20:34881600-34881622 ATGTTAGGAGGAACTCCTTGAGG - Intronic
1173809629 20:45948096-45948118 CCATGAGAAGGAGCTGCTGGAGG - Intergenic
1173908594 20:46647236-46647258 CTCTGAGAAGGAAGAGTTTGGGG - Intronic
1174390238 20:50214442-50214464 ATGGGAGGAGGAACTGGTTGGGG + Intergenic
1174713988 20:52737260-52737282 CTGTGAGAACAATCTGCTTTGGG - Intergenic
1175109068 20:56633390-56633412 CTGTCAGAAGGAGCTGGTGGGGG + Exonic
1175571762 20:60028385-60028407 TTGAGGGAAGGAACTGGTTGTGG + Intronic
1176738526 21:10575274-10575296 CAGTGAGGAGGAATTGATTGGGG - Intronic
1177474924 21:21607617-21607639 CTGTGAGAAAAAAGTGCATGAGG - Intergenic
1177633334 21:23754348-23754370 ATGTGAGAAGGAACAGCTTGTGG + Intergenic
1177642836 21:23865591-23865613 CTGTGAGAAACCACTGTTTGTGG + Intergenic
1178266822 21:31151098-31151120 CAATGAGGAGGAACTGCTGGAGG + Intronic
1178984456 21:37290964-37290986 CTGTTATAAGGAAATGGTTGGGG + Intergenic
1179008983 21:37538650-37538672 CTGTTAGAAGGAGATGCCTGTGG + Intergenic
1180032993 21:45224693-45224715 CTGTAGGAAGGAACTGGTTTCGG + Exonic
1182827427 22:33277838-33277860 CTATGAAAAGGAACTCCTGGAGG + Intronic
1183140496 22:35933811-35933833 CTGGGAGAAGAAAGGGCTTGGGG - Intronic
1184032311 22:41902305-41902327 ATATGAGAAGGTACTGCATGTGG - Intronic
1184364319 22:44040041-44040063 CTGTGGGCAGGAGTTGCTTGGGG + Intronic
1184437331 22:44487290-44487312 CTGTGAGAAGTAAATGTTTGTGG - Intergenic
1184544483 22:45157384-45157406 CTTTGTGAAGGACCTGGTTGGGG - Intergenic
1185109946 22:48895251-48895273 CTCTGAGAAGGAGCTGGGTGAGG - Intergenic
951541578 3:23787099-23787121 CTTAGAGAAAGAACTGCATGGGG - Intergenic
952019048 3:28994917-28994939 CTGTGGAAAAGAACTGGTTGTGG + Intergenic
953742646 3:45550868-45550890 CCGTGAGCAGGAACTTCATGGGG - Intergenic
954197209 3:49003878-49003900 CTGAGAAAAGGAACTGCTCTGGG + Intronic
955550477 3:60079497-60079519 CTGAGAGAAGGAGCAGCTGGTGG - Intronic
957310484 3:78512189-78512211 CTGTAAGAAAAAACTTCTTGTGG - Intergenic
958580015 3:96006843-96006865 CTGTGAGAAGGAATTGCTCCAGG + Intergenic
959605502 3:108237086-108237108 CTGTGAGAAGGAGCTCCTGTGGG - Intergenic
960484772 3:118238588-118238610 CTGTTTGAAAGAACTGCTTCTGG + Intergenic
962360732 3:134740695-134740717 ATGTGCTAAGGAACAGCTTGGGG - Intronic
963092278 3:141494994-141495016 AATTGAGAAAGAACTGCTTGAGG + Intronic
965032476 3:163391012-163391034 CTGTGAGAAGAAACTTCTCCAGG + Intergenic
966127683 3:176599030-176599052 CTGTGATATAGAACTGCTAGAGG + Intergenic
968744481 4:2352637-2352659 CTGTGAGAAGGATCTGGAGGGGG - Intronic
968867871 4:3225352-3225374 CTGTGAATAGGAACTGGTTGTGG - Intronic
969675618 4:8612812-8612834 CTGAGAGAAGGACTTGCTGGAGG + Intronic
971020400 4:22529522-22529544 CTGGGAGAGGGAACAGCTTGTGG + Intergenic
971217128 4:24672115-24672137 CTCTGAGAATGACATGCTTGAGG + Intergenic
972976341 4:44640985-44641007 CTGTGAGAAGGAACTGCTTTAGG - Intronic
973269865 4:48251604-48251626 ATATGTGAAGGAACTGCTTTAGG - Intronic
973853475 4:54986349-54986371 CTGTGACACAGAACTGCTTCAGG + Intergenic
976005386 4:80423836-80423858 CTTTGAGCTGGAACTGCATGTGG + Intronic
977259687 4:94783771-94783793 CTGTGAGTAGGGACTGGTGGAGG + Intronic
978591775 4:110331298-110331320 CTGCTATAAGGAACTACTTGAGG - Intergenic
978778984 4:112530257-112530279 CAGAGAGAAGGAACTCCTTTTGG + Intergenic
979289595 4:118965289-118965311 CAGTGAGAAGGCCCTGGTTGGGG - Intronic
979610444 4:122683677-122683699 CTGTGAGAAGGAACTGTTTCAGG - Intergenic
980634737 4:135486448-135486470 CAGTGTGAAGGAACATCTTGTGG + Intergenic
980741101 4:136950283-136950305 CTATGAGAAAGAACTGCTCCAGG - Intergenic
980816644 4:137955427-137955449 CTCTCAAAAGTAACTGCTTGGGG - Intergenic
982798872 4:159677415-159677437 CTGTGATTTGGCACTGCTTGGGG - Intergenic
983114347 4:163794087-163794109 CTCTGTGAGGGAACTGCTTAAGG + Intronic
983316727 4:166142302-166142324 CTGAGACAATGAACTCCTTGAGG + Intergenic
983753322 4:171303283-171303305 CGGTGAGGAGGAACAGATTGAGG - Intergenic
985176729 4:187210490-187210512 CTGTGAGAAGGTCATGCCTGTGG - Intergenic
986647194 5:9929040-9929062 CAGTGAGAAGGTCCTGCTGGTGG - Intergenic
986972045 5:13348382-13348404 ATGTGGGAAGGAACTGATGGAGG - Intergenic
987074623 5:14369351-14369373 CTGTGAGCAGGAAAAGTTTGAGG - Intronic
989363345 5:40628232-40628254 CCCTGAGAAAGAACTCCTTGGGG - Intergenic
989501677 5:42176119-42176141 CTGCTATAAGGAACTGCCTGAGG + Intergenic
989738873 5:44745190-44745212 CTGTGAGAAGTATATGTTTGTGG - Intergenic
990863543 5:60354939-60354961 ATGTGAGAAGGCAGTGCTGGTGG + Intronic
993001735 5:82387883-82387905 CTGTGGGAAGGTAGTTCTTGCGG + Intergenic
993756893 5:91742840-91742862 CTTTGAGAAGGAAGGGCATGTGG - Intergenic
995099193 5:108278240-108278262 CTGTGAAAAGGAACTACTTCAGG + Intronic
996533400 5:124550078-124550100 CTATGAGAAGGAGCTGCTGCTGG - Intergenic
996904513 5:128582806-128582828 CCGTGATAAAGAACTGCCTGAGG - Intronic
1001591182 5:172866474-172866496 CTTTGGGAAGAAAATGCTTGTGG + Intronic
1002706422 5:181163662-181163684 CTTTCAGAAGAAGCTGCTTGGGG - Intergenic
1005945709 6:30594122-30594144 CTAGGAGAAAGGACTGCTTGAGG - Intronic
1006209002 6:32376563-32376585 CTGTGAGAAGGCAATACTTGGGG + Intergenic
1006456321 6:34133940-34133962 CTGAGAGAAGGAGATGCTAGAGG + Intronic
1006887007 6:37390335-37390357 CTCTGAGCAGGAACTATTTGAGG + Intronic
1008420756 6:51296572-51296594 CTGGAAGAAGGAACTGCTATAGG + Intergenic
1009552452 6:65116563-65116585 ACGTGACAAGGAACTGCTTATGG + Intronic
1009613709 6:65978602-65978624 CTATGAGTGGAAACTGCTTGAGG + Intergenic
1011911749 6:92449354-92449376 CTGTGAGGAGGAACTGTTCCAGG + Intergenic
1013938917 6:115636667-115636689 CTCTCAGAAAGATCTGCTTGAGG - Intergenic
1014967090 6:127768376-127768398 AAGTCAGAAGGAACAGCTTGTGG - Intronic
1016518131 6:144919704-144919726 ATGTGAAAAGCAAATGCTTGGGG + Intergenic
1017312838 6:152993913-152993935 CTTTGAGAAGGAACTCTTAGTGG - Intronic
1017947893 6:159110480-159110502 TTGTGAGAAGGACCAGCTTTAGG + Intergenic
1019119700 6:169793033-169793055 CGATGAAAAGGAACAGCTTGGGG - Intergenic
1020788505 7:12596321-12596343 CAGGGAGAAGCAACTTCTTGGGG - Intronic
1024050312 7:45617020-45617042 CTGTAAGCAGGAACTGCTCCAGG + Intronic
1024165200 7:46723572-46723594 CTGTGAGGAGGAACGGGTTGGGG - Intronic
1024498995 7:50081557-50081579 CTCTAAGAATGAACTGTTTGGGG - Intronic
1024526963 7:50357217-50357239 CTGTGAGAGGTCCCTGCTTGTGG - Intronic
1026419702 7:70221479-70221501 CTGACAGAAGGAACTTCCTGAGG - Intronic
1026655670 7:72254542-72254564 CTGTGAGAGGGCAATGCTTTAGG + Intronic
1028708419 7:93877678-93877700 TTGTGAGAAGGCATTGCTTAGGG + Intronic
1029170158 7:98624813-98624835 CTGTGTGAGGGACCTTCTTGTGG + Intronic
1030405893 7:109112767-109112789 CTGAGCTAAGTAACTGCTTGAGG - Intergenic
1031146589 7:118003735-118003757 CTGTGATAGGGAACTGTGTGGGG - Intergenic
1035736068 8:1888438-1888460 CTGTGAGGAGGCACTGAGTGGGG + Intronic
1037095129 8:14977172-14977194 CTGTTAGAAGGAACTCGTTGAGG + Intronic
1037846564 8:22287932-22287954 ATGTGAGAAGGTGCTTCTTGAGG - Intronic
1038840969 8:31184407-31184429 CTGTAAGAAGGATCCACTTGGGG - Intergenic
1039410408 8:37350148-37350170 ATGTGAGATGGGACTGCATGGGG - Intergenic
1039724862 8:40205107-40205129 GTTTGAGAAGGTACTGCTTCGGG - Intergenic
1040820706 8:51553360-51553382 CTGTGAAAAGGCACTGCCTGGGG + Intronic
1040957155 8:52991116-52991138 CTGAAAGAAGGAACTTCTGGAGG + Intergenic
1043997373 8:86834863-86834885 CCTTCTGAAGGAACTGCTTGAGG + Intergenic
1044125828 8:88457259-88457281 CTGTGAGGAGGAACAGGATGGGG - Intergenic
1049035338 8:140071250-140071272 CTGCAAGAAGGGACTGCTGGAGG + Intronic
1049154582 8:141059058-141059080 CTGGTTGAAGGAACTGCATGTGG + Intergenic
1050148628 9:2597009-2597031 CAGTGAGATGGAGCTGCTTTAGG - Intergenic
1050861882 9:10445094-10445116 TGGTGAGAAGGAATTTCTTGTGG + Intronic
1051521569 9:17995014-17995036 CTGTGAGAAAGAATCTCTTGTGG - Intergenic
1052066398 9:24026803-24026825 TTGTGAGAGGGACCTGGTTGGGG + Intergenic
1053222338 9:36322856-36322878 CTGTGGGAAGGGACTGCCTAAGG - Intergenic
1053614551 9:39750063-39750085 GAGAGAGAAAGAACTGCTTGTGG - Intergenic
1053900172 9:42787916-42787938 GAGAGAGAAAGAACTGCTTGTGG + Intergenic
1054238967 9:62592329-62592351 GAGAGAGAAAGAACTGCTTGTGG + Intergenic
1054261469 9:62869680-62869702 AAGAGAGAAAGAACTGCTTGTGG - Intergenic
1054553096 9:66626851-66626873 GAGAGAGAAAGAACTGCTTGTGG + Intergenic
1055098280 9:72437038-72437060 CTGTAGGAAAGAACTGGTTGGGG - Intergenic
1056269053 9:84928740-84928762 CTGGGAGATGGAACTGCTAAAGG + Intronic
1058833818 9:108842934-108842956 CTGTGAGAACGAACTAATTAAGG - Intergenic
1059148654 9:111926708-111926730 CTGTGCGCAGGAAATGCCTGCGG + Intronic
1203487509 Un_GL000224v1:71016-71038 CTTTGAGAAGCAAAGGCTTGAGG - Intergenic
1203500130 Un_KI270741v1:12911-12933 CTTTGAGAAGCAAAGGCTTGAGG - Intergenic
1185882138 X:3750929-3750951 GTGTGAGAAGGAACTGATACAGG - Intergenic
1186074562 X:5863995-5864017 CTGTGAGAAGACACTACTTTTGG - Intronic
1188980233 X:36720752-36720774 CTGTGAGGAGGAACTGGCTTGGG + Intergenic
1191178237 X:57529622-57529644 ACGTGAGATGAAACTGCTTGAGG - Intergenic
1191641993 X:63436201-63436223 CTATAAGAAGGAACTGCTCTGGG + Intergenic
1192059836 X:67812637-67812659 CTGTGAGAAGGAACAGCACTGGG + Intergenic
1192428329 X:71096351-71096373 CTGTGTGAAGGGACAGCTTAGGG + Exonic
1193005896 X:76617899-76617921 CCGTGAGAAGGAACTGGATTGGG - Intergenic
1193112357 X:77742842-77742864 CTGTGAGAAAGAACTGTTTCAGG + Intronic
1194029104 X:88789612-88789634 CAGTGAGAAGGAATGGATTGGGG + Intergenic
1194405696 X:93493872-93493894 CAGTGAGGAGGAATTGGTTGGGG - Intergenic
1195647356 X:107247315-107247337 CTGTGAGATGAAACAGCATGTGG + Intergenic
1196483840 X:116181525-116181547 CTATGAGAAGGAACTGCTCCAGG + Intergenic
1198507228 X:137312783-137312805 CTGTGGGAAGGAACTGCAACAGG + Intergenic
1198724996 X:139667653-139667675 GTGAGAGCAGGCACTGCTTGTGG + Intronic
1198725112 X:139668395-139668417 CCGTGAGATGGAACTGCTCCAGG - Intronic
1198790723 X:140342639-140342661 CTGTGAGAAAGAACAGCAAGAGG + Intergenic
1199111453 X:143940180-143940202 CTGACAGAATGAACTGTTTGTGG + Intergenic
1199369521 X:147030890-147030912 CTGTGGGAATGAACTTCATGAGG - Intergenic
1199428821 X:147735511-147735533 CTCTGGGAAGGCTCTGCTTGAGG - Intergenic
1200782834 Y:7232277-7232299 GTGTGAGAAGGAACTGATACAGG + Intergenic
1201252445 Y:12073124-12073146 CTGTGAAAAAGAAGAGCTTGGGG + Intergenic
1201973334 Y:19819143-19819165 CAGTGAGAAGGAACAGGATGAGG - Intergenic
1202041094 Y:20684816-20684838 CTGGGAGAAGGCACTGCATATGG - Intergenic