ID: 1126817239

View in Genome Browser
Species Human (GRCh38)
Location 15:52466108-52466130
Sequence ACTGCTTGAGGAAGTATCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 105}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126817237_1126817239 -3 Left 1126817237 15:52466088-52466110 CCAGGAGACTGTGAGAAGGAACT 0: 1
1: 7
2: 9
3: 37
4: 224
Right 1126817239 15:52466108-52466130 ACTGCTTGAGGAAGTATCCCAGG 0: 1
1: 0
2: 1
3: 12
4: 105
1126817233_1126817239 21 Left 1126817233 15:52466064-52466086 CCCTAGATCTAACATGCGGAGCA 0: 1
1: 0
2: 0
3: 1
4: 45
Right 1126817239 15:52466108-52466130 ACTGCTTGAGGAAGTATCCCAGG 0: 1
1: 0
2: 1
3: 12
4: 105
1126817234_1126817239 20 Left 1126817234 15:52466065-52466087 CCTAGATCTAACATGCGGAGCAG 0: 1
1: 0
2: 0
3: 1
4: 53
Right 1126817239 15:52466108-52466130 ACTGCTTGAGGAAGTATCCCAGG 0: 1
1: 0
2: 1
3: 12
4: 105
1126817231_1126817239 30 Left 1126817231 15:52466055-52466077 CCTTCTAAGCCCTAGATCTAACA 0: 1
1: 0
2: 0
3: 8
4: 99
Right 1126817239 15:52466108-52466130 ACTGCTTGAGGAAGTATCCCAGG 0: 1
1: 0
2: 1
3: 12
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126817239 Original CRISPR ACTGCTTGAGGAAGTATCCC AGG Intronic
900286140 1:1901542-1901564 CCTGCTTGAGGAAGAAGCTCAGG + Intergenic
902215249 1:14930698-14930720 ACTGCAGGAGGAAGGGTCCCAGG - Intronic
902695761 1:18139810-18139832 ATTGCCTGAGGCAGCATCCCTGG + Intronic
903975059 1:27144238-27144260 ACGGCTTGAGGAATCTTCCCAGG + Intronic
906035709 1:42749158-42749180 ACTGCTTGATGAGGCCTCCCTGG + Intronic
906530811 1:46522961-46522983 AGTGCTTCAGGAAGAATCCAGGG + Intergenic
910003593 1:82367068-82367090 AGAGCTTGAGTAAGTTTCCCTGG - Intergenic
915439786 1:155938530-155938552 AATGCTTGAGGTAGTACCCCTGG - Intergenic
922902653 1:229148571-229148593 ATTGCTTGAGGAAGTGGCCCAGG - Intergenic
923019844 1:230154856-230154878 ACTACCTGAGTAAGTATGCCAGG - Intronic
924618751 1:245641087-245641109 ACTGCTTGGTGCAGTATCCTTGG + Intronic
1062904924 10:1173396-1173418 ACTGGTGGAGGTAGCATCCCGGG + Intergenic
1066199932 10:33134851-33134873 ACTGCTTTGGGAGTTATCCCAGG + Intergenic
1066266712 10:33783047-33783069 ACTGCTTTGGGAATTACCCCTGG - Intergenic
1069031100 10:63597132-63597154 ATTGGTTGAGGAAGTATACTGGG + Intronic
1069293059 10:66807468-66807490 ACTACTTTGGGAACTATCCCTGG + Intronic
1072265652 10:93724657-93724679 AAGGCTTGAGGGAGTATCCAAGG - Intergenic
1072641369 10:97213627-97213649 ACAGCTCCAGGAAGTGTCCCTGG + Intronic
1073545032 10:104340468-104340490 ACTCCTTCAGGAAGTCTTCCTGG + Intergenic
1075652692 10:124139666-124139688 TCTGCTTTAGGAACTATCCCAGG - Intergenic
1075689276 10:124384822-124384844 AGTGCTGGAGGGAGTCTCCCAGG + Intergenic
1078118022 11:8474947-8474969 ACTGTTTGAGGAAGAAAACCAGG + Exonic
1078777996 11:14411270-14411292 ATTGGGTGAGGAAGTATCCAAGG - Intergenic
1083331652 11:61901189-61901211 ACAGCTTGAGGAACCATCTCAGG - Intronic
1084545848 11:69814761-69814783 ACTGCTTGGCTAAGCATCCCTGG + Intronic
1085058224 11:73420686-73420708 AATTCATGAGGAAATATCCCAGG - Intronic
1085468633 11:76741622-76741644 TCTGCTCCAGGAAGTACCCCAGG - Intergenic
1088994167 11:114982035-114982057 GCTGCTTGATCAATTATCCCAGG + Intergenic
1089855937 11:121544848-121544870 ACTGCCTGAGGAAGCAGGCCAGG + Intronic
1095368496 12:41437992-41438014 ACTGCTGTATGAAGTTTCCCAGG + Intronic
1097733534 12:63155432-63155454 ACTGCTTTGGGAACTCTCCCTGG - Intergenic
1099437003 12:82657485-82657507 AGTTCTTGAGGAAGTATCCAAGG + Intergenic
1102901676 12:116643336-116643358 CCTGTTTGAGGAATTATACCTGG - Intergenic
1104090317 12:125511548-125511570 TCTGCTTGAAAAAGCATCCCAGG + Intronic
1106667093 13:31863458-31863480 ACTTCATGAGGAAGAATCCCTGG + Intergenic
1115517610 14:34201804-34201826 TCAGCTTGAGAAAGAATCCCAGG + Intronic
1120554458 14:85912087-85912109 ACTGCTTGAGGATAAATCCCCGG + Intergenic
1126817239 15:52466108-52466130 ACTGCTTGAGGAAGTATCCCAGG + Intronic
1127650167 15:60999276-60999298 ACTGCTGTGGGAAGTTTCCCAGG + Intronic
1130643953 15:85707042-85707064 ACTGATTCAGGAAGCATCACAGG - Intronic
1131601480 15:93853619-93853641 CCTGCTTGAGGAAGGAGCCACGG + Intergenic
1135243328 16:20830545-20830567 AGTGCTTTGGGAACTATCCCTGG - Intronic
1135492511 16:22922191-22922213 ACTGCTTTGGAAACTATCCCTGG - Intergenic
1137610350 16:49813526-49813548 TCTGCTTGAGGATCAATCCCTGG - Intronic
1138881412 16:61019393-61019415 ACTGCTTGAGGAAGTAAAGTTGG + Intergenic
1143660927 17:8324264-8324286 ACTTCCAGAGGAAGTAGCCCTGG + Intergenic
1153458644 18:5309088-5309110 ACTGCTTTGAGAACTATCCCTGG + Intergenic
1157627514 18:49062825-49062847 ACAGGATGAGGAAGAATCCCTGG - Intronic
1159750169 18:72291149-72291171 ATTGCTTGAGAAAATAACCCTGG - Intergenic
1161002050 19:1915436-1915458 ACTGCCTGAGGAAGTGTCCCTGG - Intronic
1166341662 19:42141085-42141107 ACAGCTCCAGGTAGTATCCCCGG + Intronic
926695896 2:15770108-15770130 GCTGCTTAAGGGAGTAGCCCTGG - Intergenic
935505255 2:103892404-103892426 AATGCTTGAGAAAATTTCCCTGG - Intergenic
938456400 2:131468017-131468039 ACTGCTTGAGAACAAATCCCAGG + Intronic
940197472 2:151111785-151111807 ACTTCTTGAGGCTGCATCCCTGG - Intergenic
940578635 2:155548932-155548954 ACTGCTTGAAGAAATATCTGAGG + Intergenic
941216221 2:162712997-162713019 ACTGATTCAGGATGAATCCCTGG + Intronic
942201516 2:173576320-173576342 GATGCTTGAGGAAGTGTACCAGG - Intergenic
943361458 2:186923736-186923758 ACTGCTTTAGGAACTATCCTGGG + Intergenic
944646163 2:201782718-201782740 ACTTCTTGAGGCTGTGTCCCAGG - Intergenic
945011531 2:205469156-205469178 AATGCTTTAGGAACTATGCCAGG - Intronic
946354811 2:219178090-219178112 TCTGGTTGACGAAGTACCCCGGG - Exonic
948737493 2:240018553-240018575 ACTGCTTTCGGATGAATCCCTGG + Exonic
1170592497 20:17781469-17781491 GCTGCTTTGGGAATTATCCCTGG + Intergenic
1172612818 20:36264421-36264443 CCTTCTTGAAGAAGCATCCCAGG - Intronic
1173018381 20:39247091-39247113 CCTGCTTGAGAAAGTTCCCCTGG + Intergenic
1174355947 20:49998058-49998080 ACTGCATGAGCAGGTACCCCAGG + Intergenic
1176078841 20:63261558-63261580 AATGCTTGAGCAAGAAACCCTGG - Intronic
1179307060 21:40164340-40164362 GCTGCTTGGGTAGGTATCCCTGG + Intronic
1179458402 21:41515596-41515618 TCCCCTTGAGGAAGGATCCCAGG - Intronic
1182756639 22:32685258-32685280 ACTCCTTGAAGAAGTTTTCCAGG - Intronic
953715618 3:45314795-45314817 ACTGCATAAAGAATTATCCCCGG + Intergenic
953769772 3:45771207-45771229 ACTGCTTGAAGAAGTAAGCCTGG - Exonic
956333146 3:68133528-68133550 ACTGCTTGAGGAAATAAGACAGG - Intronic
959081517 3:101806589-101806611 ACTGCATGAGTAAGTATCTGGGG + Intronic
964294432 3:155217744-155217766 ACTGCTTGAGGTAGCATGGCTGG + Intergenic
966310200 3:178585604-178585626 AGTGTTACAGGAAGTATCCCAGG - Intronic
972995451 4:44873218-44873240 AGAGGTAGAGGAAGTATCCCAGG - Intergenic
978117919 4:105044028-105044050 ACTGCATGAGCAAGTAGCCCAGG - Intergenic
978206019 4:106082429-106082451 ACTGCTTGAGGAAGAATGGTGGG + Intronic
978789605 4:112647070-112647092 ACTGTTTTAGGAAATATGCCAGG - Exonic
981290861 4:143072851-143072873 ACTGCTTTGGGAAATATCCCAGG + Intergenic
982051227 4:151504439-151504461 ACTGGCTGAGGAAGTATCTGGGG - Intronic
987134786 5:14890405-14890427 TCGGCTTGAGGAAGGAGCCCTGG + Intergenic
1003119091 6:3305380-3305402 AATGCCTGAGGAAGCATCTCTGG - Intronic
1006686449 6:35838663-35838685 TCTGCTTCCTGAAGTATCCCTGG + Intronic
1010949849 6:82022836-82022858 ACTGTTAGAGGAAGTAATCCAGG - Intergenic
1011438722 6:87366008-87366030 ACTGCTTTGGGGACTATCCCTGG - Intronic
1013068439 6:106705939-106705961 AATGCTGGAGGAAGTAACCAGGG - Intergenic
1017347732 6:153404563-153404585 ACTGCCTGAGGATGTATCATGGG - Intergenic
1018186081 6:161266035-161266057 ACTGCTTGAGGGGGAATTCCCGG - Intronic
1020505994 7:8988455-8988477 ACTGATTGAGGCAGGATACCAGG - Intergenic
1021668790 7:23014142-23014164 GCTGCTTGAGGACGGGTCCCTGG - Intergenic
1021874672 7:25037326-25037348 ACTGCATCAGGAAATATCCCAGG - Intergenic
1022033524 7:26513651-26513673 ACTACTGGGGGAAGTATCACTGG - Intergenic
1023308077 7:38852367-38852389 ACTGCTTTGAGAACTATCCCTGG + Intronic
1024201008 7:47105796-47105818 ACCGAATGAGGAAGCATCCCCGG + Intergenic
1024330315 7:48148427-48148449 ACTGCTTTAGGAACTATGCCTGG - Intergenic
1024996140 7:55274379-55274401 ACTGCTTGAGGAAGGAGCGAGGG - Intergenic
1028216477 7:88139705-88139727 ACTGCTTTGGGAACTATCCATGG - Intronic
1030319676 7:108152239-108152261 ACTGCTTGATGAGGTCTTCCTGG - Intronic
1032706820 7:134427094-134427116 AGTACTTCAGGAATTATCCCTGG - Intergenic
1035465754 7:159075579-159075601 ACTGCATCAGGGAGTAGCCCAGG + Intronic
1038509623 8:28119470-28119492 TATGCATGATGAAGTATCCCGGG - Intronic
1039532174 8:38272543-38272565 AGTGCCTGAGAAAGTTTCCCAGG + Exonic
1042343545 8:67704870-67704892 ACTTCTTGAGGATGCATCCAAGG - Intronic
1051253702 9:15189733-15189755 ACTGCTGGAGGAAGGGTGCCAGG + Exonic
1057871722 9:98723144-98723166 ACTGCTTGAGTACGTAACACAGG + Intergenic
1059400055 9:114063307-114063329 AGTCCTTGAGGCAGGATCCCAGG + Intronic
1190258855 X:48785804-48785826 ACTCCTCGAGGAATCATCCCTGG + Intergenic
1191607681 X:63080018-63080040 AGTTCTTGAGGATGTATACCAGG - Intergenic
1192611457 X:72571443-72571465 ATTGCTTGGTTAAGTATCCCAGG - Intronic
1194426435 X:93744407-93744429 ACTGCTTGTAGAAGTAGCTCTGG - Intergenic
1195805101 X:108756775-108756797 AGTCCTTCAGGAAGTATTCCAGG - Intergenic
1195967723 X:110444044-110444066 TCTGCTTTAAGAACTATCCCTGG + Intronic
1198521581 X:137458770-137458792 TTTGCTTGAGAAAGTATCCATGG - Intergenic
1199530254 X:148838752-148838774 ACTCCTTGAGGTGGTATCCAAGG - Intronic
1199974130 X:152882612-152882634 CCAGCTTGAGGAAGCATCCTGGG + Intergenic
1200913772 Y:8553631-8553653 GCCGCTTCAGGAAGTCTCCCTGG - Intergenic