ID: 1126819391

View in Genome Browser
Species Human (GRCh38)
Location 15:52487087-52487109
Sequence ATTATTTCCTGGGGGATGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 136}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126819391 Original CRISPR ATTATTTCCTGGGGGATGTA TGG Intronic
900247213 1:1642321-1642343 AGTCTTTTCTGGGGGATGTTTGG - Intronic
900258437 1:1709453-1709475 AGTCTTTTCTGGGGGATGTTTGG - Intronic
902767634 1:18627962-18627984 ATGGTTTCCTGAGGTATGTATGG - Intergenic
902981650 1:20127523-20127545 ATTATTTCCTGTGGAGTGGATGG - Intergenic
904829999 1:33300135-33300157 TTTTTTCCCGGGGGGATGTAGGG - Exonic
907187215 1:52618900-52618922 TTTATTTCTTGGGGGATATTTGG + Intergenic
907449952 1:54539523-54539545 ATTATTTGCTTGGGGATGTGGGG + Intergenic
908943962 1:69471682-69471704 TCTATTTCCTGGTGGATGCAAGG + Intergenic
912258338 1:108083927-108083949 ATTATTTACCAGGGGACGTAGGG - Intergenic
912476005 1:109935443-109935465 CTTCTTTCCTGGTGGATTTAGGG - Intergenic
917968066 1:180191020-180191042 ACAATTTCCTGGGGGAAGTTGGG + Intronic
922941255 1:229468900-229468922 GTTAGTTCCTGGGGAATGGAAGG - Intronic
923790814 1:237109741-237109763 ATAATTTCCTGGGATAGGTAGGG + Intronic
1064952588 10:20870569-20870591 ATTATTTCCTTGGGGATGGTGGG + Intronic
1065288382 10:24206980-24207002 AAGATTTCCTGGGGGCTGTTTGG - Intronic
1065965030 10:30763887-30763909 TTTCTTTCCTGGGGTATGTCTGG - Intergenic
1067482250 10:46609860-46609882 ATTATGTTCTGGTTGATGTAGGG + Intergenic
1067612499 10:47731808-47731830 ATTATGTTCTGGTTGATGTAGGG - Intergenic
1068079190 10:52298472-52298494 ATTATTTCATGAGGGATGCTTGG - Intergenic
1068584998 10:58788098-58788120 ATGATCTCCTGGGGGCTGTGGGG + Intronic
1068613305 10:59084887-59084909 ATTATTTCCTGAGCTGTGTATGG + Intergenic
1068741976 10:60483716-60483738 ATGAGTTCCTGGGGGCTGGAGGG - Intronic
1070835258 10:79443963-79443985 ATTATTTACTAGGGGAGGCATGG - Intronic
1071181403 10:82988419-82988441 ATTATTTACTGGAGAATGGATGG + Intergenic
1071627920 10:87192055-87192077 ATTATGTTCTGGTTGATGTAGGG - Intergenic
1074663412 10:115690176-115690198 ACTATTTCCTGGGGAAAGGATGG - Intronic
1080446758 11:32344804-32344826 GTTCTTTCCTGGGGGATGAAGGG - Intergenic
1083466687 11:62851646-62851668 GTTTTTTCCTGGGGGAAGCAAGG - Intergenic
1093929292 12:24938553-24938575 TGTATTCCCTGGGGGATGTTGGG + Intronic
1095287304 12:40429578-40429600 ATTATGCCCTGGAAGATGTAAGG + Exonic
1095452619 12:42348978-42349000 ATTTTTCCCATGGGGATGTAAGG - Intronic
1096743257 12:53709873-53709895 TTTATTTTCTGGGGGAGGTTGGG - Intronic
1097504247 12:60445023-60445045 ATTATTCCCTGCTGTATGTATGG - Intergenic
1098433637 12:70447072-70447094 ATTTTTGCCTGGGGGAAGGATGG + Intergenic
1098736786 12:74114663-74114685 ATTATTTCCTGTGGGAGGTATGG + Intergenic
1101375048 12:104164310-104164332 ATGATTTCCTGCTGGATGTGAGG + Intergenic
1105752532 13:23434609-23434631 ATTATTTCCTGGGAGATAGGTGG + Intergenic
1106345426 13:28872250-28872272 ATGAATTCATGGGGGGTGTAAGG + Intronic
1107530671 13:41279549-41279571 ATTATTACCTAAGGGGTGTAGGG + Intergenic
1109468761 13:62776516-62776538 ATTATTTTCAGGGGGAAATAAGG + Intergenic
1109562536 13:64071418-64071440 ATTTTTTTCTGGAGGTTGTAGGG + Intergenic
1110027228 13:70555954-70555976 ATTATTTTCTCTGGGATGTAGGG + Intergenic
1112841561 13:103585395-103585417 ATTCTTTCCTGGTGGCTCTAGGG - Intergenic
1113663338 13:112122241-112122263 ATTATTCACTGGGGAATGAATGG - Intergenic
1117136141 14:52735973-52735995 ATTATTTCCAGGGTCCTGTATGG + Intronic
1118581764 14:67307613-67307635 TTTATTTCTTGGTGGATGTGGGG + Intronic
1119914283 14:78382818-78382840 ATTATCTCCTGGGGCTTGTGAGG + Intronic
1119940762 14:78638846-78638868 ACTCATTCCTGGGGGATGGAGGG - Intronic
1124184074 15:27506564-27506586 ATTCTTTTCTGGGGGCTCTAGGG - Intronic
1124597003 15:31099658-31099680 ATTATTTTCTGGGAGAAGTTTGG - Intronic
1125223013 15:37361574-37361596 ATTTTTTCCTGTGAGATGCATGG - Intergenic
1126819391 15:52487087-52487109 ATTATTTCCTGGGGGATGTATGG + Intronic
1126838945 15:52696880-52696902 ATTATATTCTGGGGGATTCATGG + Intronic
1127908146 15:63392487-63392509 ATGCTGTCCTGGGGGATCTAAGG + Intergenic
1133227440 16:4348572-4348594 ATTAGGTCCTGAGGGATGTTGGG - Intronic
1138524462 16:57594241-57594263 TTAATTTCCTGGTGGATGTTGGG + Intergenic
1141205141 16:81927719-81927741 TTTATTTTCTAAGGGATGTAGGG + Intronic
1146266509 17:31456838-31456860 ATTATTGCCTGGGGGTGGTGGGG + Intronic
1150367327 17:64601077-64601099 ATTATTTTGTGGGGGATGGGGGG - Intronic
1151825370 17:76521069-76521091 ACTATTTCCTGGGGGAAGAACGG - Intergenic
1156521650 18:37726862-37726884 ATTATTTGCTGGGGGACTTATGG + Intergenic
1157048901 18:44136867-44136889 GATATTTCCTGGAGGATGTGGGG - Intergenic
1160118862 18:76109120-76109142 TTTTTTTTCTGGGGGGTGTAGGG - Intergenic
1161580376 19:5077534-5077556 CTTATCTCCTGGGGTATGTGCGG - Intronic
1163021501 19:14483075-14483097 AGTATTTCCTTGGGCCTGTATGG - Intronic
1166029389 19:40115450-40115472 CTTATTTCAGGAGGGATGTATGG + Intergenic
1166347314 19:42174801-42174823 CTTATATCCTGGGGGGTGGAAGG + Intronic
931202053 2:60106903-60106925 ACAATTACCTGGGGGATGTCTGG - Intergenic
931562623 2:63579057-63579079 ATTATTTTCTGGAGAACGTAAGG - Intronic
934229921 2:90169975-90169997 ATTCTTTCTTGGGGGTAGTATGG + Intergenic
934922751 2:98359302-98359324 AGTGTTTCCTGGGGGAAGTAAGG + Intronic
935373834 2:102375292-102375314 ATTAATTCCTGTGACATGTATGG + Intronic
935549047 2:104432252-104432274 ATTATTTACTGGGGGTTGGCGGG - Intergenic
936678326 2:114740991-114741013 TTTATTTCCTGTGGGATATGTGG + Intronic
939877436 2:147593947-147593969 ATTTCTTCCTGGAGGCTGTAGGG + Intergenic
944560918 2:200936780-200936802 ATTATTTCTGGGGAGTTGTAGGG - Intronic
944731377 2:202521045-202521067 ATTGTTGCCATGGGGATGTAGGG + Intronic
945199031 2:207263355-207263377 ATTATATCCCTGGGGATGTGGGG + Intergenic
946086584 2:217179516-217179538 ATTATTTTCTGGAGGCTCTATGG - Intergenic
946720064 2:222595725-222595747 ATTATTTCTTGTAGAATGTATGG - Intronic
947705659 2:232273541-232273563 ATTATTTGCTGGGGCATCCAGGG + Intronic
1169031917 20:2416064-2416086 ATTCTTTCCTGGGTGATGCCAGG - Intronic
1169548745 20:6679369-6679391 ACTATTTCCTGGAGGCTGAAGGG + Intergenic
1172886643 20:38235637-38235659 ATTCTTTCCTGGAGGCTCTAAGG - Intronic
1172922765 20:38499853-38499875 ATTTTTTTGTGGGGGAAGTAGGG - Intronic
1173523279 20:43714453-43714475 ATTATGGCCTGGGGGCTGCACGG + Intronic
1175612827 20:60365532-60365554 ATTATTTCCTGAGGCATACAGGG + Intergenic
1177755288 21:25339437-25339459 AATATTTCCTGGGGTATGCTAGG - Intergenic
1181138386 22:20785766-20785788 ATTATTTCCTTGAGACTGTATGG - Intronic
1181774993 22:25153211-25153233 ATTGTTTCTTGGGGGATGTGTGG - Intronic
949344491 3:3064244-3064266 ATTCTATCCTGGGGGATCAATGG - Intergenic
949732214 3:7126579-7126601 ACTATTTCCTGGGCTATGTGGGG + Intronic
950536320 3:13581147-13581169 ATTACTTCCTGGGGGATACGTGG + Intronic
951092625 3:18592450-18592472 ATTTTTTCCCGGGGTGTGTATGG + Intergenic
951393041 3:22130357-22130379 ATTAATTCCTGGGGAAGGTCTGG - Intronic
952507080 3:34016957-34016979 TTTATTTCCTGGAGTACGTATGG - Intergenic
956113994 3:65900253-65900275 TTTATGTCCTGGGTGATGGATGG - Intronic
956545068 3:70392276-70392298 CTTACTTCCTGGGGGATGGGTGG - Intergenic
956888500 3:73585648-73585670 ATTATTTCCTGGAAGATGGATGG + Intronic
957144251 3:76402578-76402600 ATTATTTTCTGGAGGGTCTAAGG + Intronic
960630534 3:119726106-119726128 ATTATATACTGGGGGGTGCATGG + Intronic
962069712 3:132020604-132020626 TTTTTTCCCTGGGGGATGGAAGG + Intronic
962446428 3:135469969-135469991 GTTCTTTCCTGGAGGCTGTAGGG - Intergenic
963848578 3:150184215-150184237 ATTAATTCCTGGGTGGTGGACGG + Intergenic
964591106 3:158362654-158362676 ATTATTTCACAGGGGATGGAGGG + Intronic
969188835 4:5500794-5500816 CTTATTTCCTGGGGGAGGTGGGG - Exonic
971570290 4:28203719-28203741 ATTTTTACCTGGGTGATTTAGGG - Intergenic
976140681 4:81988495-81988517 ATTCTTTTTTGGAGGATGTAGGG - Intronic
976888634 4:90016629-90016651 ATCACTTCCTGGGGGAGGAAGGG - Intergenic
977841556 4:101712826-101712848 ATTATTTACTCGGGGTAGTACGG + Intronic
978967113 4:114753781-114753803 ATTATTTCTTATGTGATGTAAGG + Intergenic
985159604 4:187030801-187030823 ATTATTTCTGGGGGCATATATGG - Intergenic
985561875 5:592121-592143 ATAATCTCCTGGGGGCTCTAGGG - Intergenic
990001522 5:50898813-50898835 TTTATTTCCTTGTGGTTGTAGGG - Intergenic
992151848 5:73912223-73912245 ATTGTTTTCTGGGGGATATGAGG + Intronic
996573726 5:124960406-124960428 ATTATTTCCTGGGTGAAGCCAGG - Intergenic
1002161711 5:177317914-177317936 ATAATTTCTTGGGTGATGTTGGG - Intergenic
1002496558 5:179617380-179617402 ATTAATTCTTGGGGGATGCGGGG - Intronic
1006977730 6:38119267-38119289 GTTATTTCCTTGAGGATGCATGG + Intronic
1015647988 6:135416411-135416433 ATTATTTCCTGAGGAATGTAAGG + Intronic
1015994062 6:138980017-138980039 ATTGTTTCGTGGGAGAGGTAAGG - Intronic
1016216291 6:141607852-141607874 ATAATCTCTTGGGGGATCTAGGG - Intergenic
1016528167 6:145026963-145026985 ATTAGTTCCTGGGGGGTGGGTGG + Intergenic
1017987522 6:159456703-159456725 ATTATTTCCTGGGCTATATCTGG - Intergenic
1022843236 7:34184568-34184590 CTTCTTGCCTGGGGGATGGAGGG - Intergenic
1023270856 7:38461107-38461129 ATTCTTACATGGGAGATGTACGG - Intronic
1023373022 7:39530678-39530700 ATATTTTCCTGGGGCAGGTATGG - Intergenic
1024301173 7:47888873-47888895 TTTATTTCCTGTGGGACTTAGGG + Intronic
1025169928 7:56747344-56747366 ATGCTTTCTTGGGGTATGTATGG - Intergenic
1034377715 7:150660683-150660705 ATTATTTCCTGTTGGATCCAGGG - Intergenic
1036527586 8:9549435-9549457 GTTATTTTCTGGGGGCTCTAGGG + Intergenic
1038862791 8:31405650-31405672 ATTGTTTCCTGTGCTATGTAGGG - Intergenic
1039303606 8:36236913-36236935 ATGCTTTCCTGGGGATTGTATGG + Intergenic
1041716849 8:60940429-60940451 ATTATTCCCTAGGGGATGGTGGG + Intergenic
1042131614 8:65592920-65592942 ATTATTTACTAGGCGTTGTATGG - Intergenic
1043678101 8:82986833-82986855 ATTATTACCTGGGGAATATAAGG + Intergenic
1044748797 8:95396778-95396800 TTTATTTTATGGAGGATGTAGGG - Intergenic
1045224355 8:100229993-100230015 TTTCTTTCCTGTGGGATTTAAGG - Intronic
1046601591 8:116323440-116323462 AGAATTTCCTGGGGGGTGTAGGG + Intergenic
1048825044 8:138416140-138416162 ATTTTGTCCTGGGGGATCAAGGG - Intronic
1050987314 9:12100008-12100030 AATCTTTCCTGGGAGATGGAAGG + Intergenic
1051638411 9:19202508-19202530 ATCACTTCCTGGGGGATGGGAGG + Intergenic
1058953345 9:109923878-109923900 GTTATTTCCATGGGGAAGTAGGG + Intronic
1189263326 X:39693788-39693810 ATTATTTTATGCTGGATGTATGG - Intergenic
1196656348 X:118221569-118221591 ATTATTATCTGGGGGATGGTTGG - Intergenic
1196939264 X:120759681-120759703 GTGCTGTCCTGGGGGATGTAAGG + Intergenic
1197717436 X:129719705-129719727 GTTATTTCCTGGTGGGTGGAGGG - Intergenic
1198440418 X:136657920-136657942 AGTACTTGCTGTGGGATGTAGGG - Intronic
1199489730 X:148384968-148384990 ATTATTTCCTTGGGGATCCTGGG + Intergenic
1199610992 X:149613479-149613501 TTTAGTTCCTTGGGGTTGTAGGG - Intronic
1201741373 Y:17327305-17327327 AATATTACCTGGAGGATGTCAGG - Intergenic